ID: 902594339

View in Genome Browser
Species Human (GRCh38)
Location 1:17498060-17498082
Sequence CCTAATGACTACTTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594334_902594339 17 Left 902594334 1:17498020-17498042 CCAAAATGCTGGGATTACAGGTG 0: 3865
1: 80658
2: 217963
3: 284981
4: 250431
Right 902594339 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
902594331_902594339 21 Left 902594331 1:17498016-17498038 CCTCCCAAAATGCTGGGATTACA 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235
Right 902594339 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
902594329_902594339 27 Left 902594329 1:17498010-17498032 CCTTGGCCTCCCAAAATGCTGGG 0: 4293
1: 91194
2: 212713
3: 235265
4: 160325
Right 902594339 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
902594335_902594339 -10 Left 902594335 1:17498047-17498069 CCACAGCACCCAGCCTAATGACT No data
Right 902594339 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
902594333_902594339 18 Left 902594333 1:17498019-17498041 CCCAAAATGCTGGGATTACAGGT 0: 3931
1: 88811
2: 317136
3: 261500
4: 233797
Right 902594339 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594339 Original CRISPR CCTAATGACTACTTTCCCTC TGG Intergenic
No off target data available for this crispr