ID: 902594342

View in Genome Browser
Species Human (GRCh38)
Location 1:17498078-17498100
Sequence TCTGGATAGATACCCAGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34665
Summary {0: 52, 1: 914, 2: 2055, 3: 4806, 4: 26838}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594338_902594342 -5 Left 902594338 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
Right 902594342 1:17498078-17498100 TCTGGATAGATACCCAGTAGTGG 0: 52
1: 914
2: 2055
3: 4806
4: 26838
902594336_902594342 0 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594342 1:17498078-17498100 TCTGGATAGATACCCAGTAGTGG 0: 52
1: 914
2: 2055
3: 4806
4: 26838
902594335_902594342 8 Left 902594335 1:17498047-17498069 CCACAGCACCCAGCCTAATGACT No data
Right 902594342 1:17498078-17498100 TCTGGATAGATACCCAGTAGTGG 0: 52
1: 914
2: 2055
3: 4806
4: 26838
902594337_902594342 -1 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594342 1:17498078-17498100 TCTGGATAGATACCCAGTAGTGG 0: 52
1: 914
2: 2055
3: 4806
4: 26838

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594342 Original CRISPR TCTGGATAGATACCCAGTAG TGG Intergenic
Too many off-targets to display for this crispr