ID: 902594343

View in Genome Browser
Species Human (GRCh38)
Location 1:17498079-17498101
Sequence CTGGATAGATACCCAGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33430
Summary {0: 48, 1: 878, 2: 1969, 3: 4517, 4: 26018}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594337_902594343 0 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594343 1:17498079-17498101 CTGGATAGATACCCAGTAGTGGG 0: 48
1: 878
2: 1969
3: 4517
4: 26018
902594336_902594343 1 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594343 1:17498079-17498101 CTGGATAGATACCCAGTAGTGGG 0: 48
1: 878
2: 1969
3: 4517
4: 26018
902594338_902594343 -4 Left 902594338 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
Right 902594343 1:17498079-17498101 CTGGATAGATACCCAGTAGTGGG 0: 48
1: 878
2: 1969
3: 4517
4: 26018
902594335_902594343 9 Left 902594335 1:17498047-17498069 CCACAGCACCCAGCCTAATGACT No data
Right 902594343 1:17498079-17498101 CTGGATAGATACCCAGTAGTGGG 0: 48
1: 878
2: 1969
3: 4517
4: 26018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594343 Original CRISPR CTGGATAGATACCCAGTAGT GGG Intergenic
Too many off-targets to display for this crispr