ID: 902594344

View in Genome Browser
Species Human (GRCh38)
Location 1:17498087-17498109
Sequence ATACCCAGTAGTGGGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63564
Summary {0: 1417, 1: 9343, 2: 26302, 3: 15708, 4: 10794}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594337_902594344 8 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594344 1:17498087-17498109 ATACCCAGTAGTGGGATTGCTGG 0: 1417
1: 9343
2: 26302
3: 15708
4: 10794
902594338_902594344 4 Left 902594338 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
Right 902594344 1:17498087-17498109 ATACCCAGTAGTGGGATTGCTGG 0: 1417
1: 9343
2: 26302
3: 15708
4: 10794
902594335_902594344 17 Left 902594335 1:17498047-17498069 CCACAGCACCCAGCCTAATGACT No data
Right 902594344 1:17498087-17498109 ATACCCAGTAGTGGGATTGCTGG 0: 1417
1: 9343
2: 26302
3: 15708
4: 10794
902594336_902594344 9 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594344 1:17498087-17498109 ATACCCAGTAGTGGGATTGCTGG 0: 1417
1: 9343
2: 26302
3: 15708
4: 10794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594344 Original CRISPR ATACCCAGTAGTGGGATTGC TGG Intergenic
Too many off-targets to display for this crispr