ID: 902594347

View in Genome Browser
Species Human (GRCh38)
Location 1:17498096-17498118
Sequence AGTGGGATTGCTGGATTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24857
Summary {0: 177, 1: 621, 2: 3190, 3: 6269, 4: 14600}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594341_902594347 -3 Left 902594341 1:17498076-17498098 CCTCTGGATAGATACCCAGTAGT 0: 56
1: 885
2: 2029
3: 4258
4: 24200
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG 0: 177
1: 621
2: 3190
3: 6269
4: 14600
902594335_902594347 26 Left 902594335 1:17498047-17498069 CCACAGCACCCAGCCTAATGACT No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG 0: 177
1: 621
2: 3190
3: 6269
4: 14600
902594338_902594347 13 Left 902594338 1:17498060-17498082 CCTAATGACTACTTTCCCTCTGG No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG 0: 177
1: 621
2: 3190
3: 6269
4: 14600
902594336_902594347 18 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG 0: 177
1: 621
2: 3190
3: 6269
4: 14600
902594340_902594347 -2 Left 902594340 1:17498075-17498097 CCCTCTGGATAGATACCCAGTAG No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG 0: 177
1: 621
2: 3190
3: 6269
4: 14600
902594337_902594347 17 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG 0: 177
1: 621
2: 3190
3: 6269
4: 14600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594347 Original CRISPR AGTGGGATTGCTGGATTGAA TGG Intergenic
Too many off-targets to display for this crispr