ID: 902597932

View in Genome Browser
Species Human (GRCh38)
Location 1:17521829-17521851
Sequence ATGGTGAAGCTGAGGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902597926_902597932 1 Left 902597926 1:17521805-17521827 CCTAGGGAGGGGGTCCTGCCTGT No data
Right 902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG No data
902597919_902597932 20 Left 902597919 1:17521786-17521808 CCATAGGAGAATGGGGCTTCCTA No data
Right 902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902597932 Original CRISPR ATGGTGAAGCTGAGGTTGGA AGG Intergenic
No off target data available for this crispr