ID: 902600771

View in Genome Browser
Species Human (GRCh38)
Location 1:17539378-17539400
Sequence GGGGTCTCCCCGCGGAGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902600764_902600771 -3 Left 902600764 1:17539358-17539380 CCAGCACCCTGCGCGCCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 197
Right 902600771 1:17539378-17539400 GGGGTCTCCCCGCGGAGAACCGG 0: 1
1: 0
2: 0
3: 8
4: 89
902600767_902600771 -9 Left 902600767 1:17539364-17539386 CCCTGCGCGCCTGCGGGGTCTCC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 902600771 1:17539378-17539400 GGGGTCTCCCCGCGGAGAACCGG 0: 1
1: 0
2: 0
3: 8
4: 89
902600768_902600771 -10 Left 902600768 1:17539365-17539387 CCTGCGCGCCTGCGGGGTCTCCC 0: 1
1: 0
2: 0
3: 14
4: 137
Right 902600771 1:17539378-17539400 GGGGTCTCCCCGCGGAGAACCGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902600771 Original CRISPR GGGGTCTCCCCGCGGAGAAC CGG Intergenic
900092106 1:925057-925079 GGGGTGTCCCCGCGCAGCCCTGG - Intronic
902600771 1:17539378-17539400 GGGGTCTCCCCGCGGAGAACCGG + Intergenic
904677108 1:32205427-32205449 GGGCTGTCTCCGCGGAGACCGGG - Intergenic
914095376 1:144540173-144540195 TGGGTCCCCTCGCGGAGAGCAGG + Intergenic
914303150 1:146393723-146393745 TGGGTCCCCTCGCGGAGAGCAGG - Intergenic
921055353 1:211538726-211538748 GGGGACTCCCTGCAGAGACCTGG - Intergenic
923630995 1:235649615-235649637 GGGCTCTCCCCGCGGACACCCGG + Intronic
1065812806 10:29458234-29458256 GGCGTCTCCCCACTCAGAACAGG + Exonic
1071527775 10:86367779-86367801 GGGGCCCCTCCGCGGACAACAGG - Intergenic
1073292820 10:102421674-102421696 GGGGTCTCTCCTGGGAGAGCAGG + Intronic
1074225265 10:111478671-111478693 GGGGTCACCCAGCTGAGAGCTGG - Intergenic
1076717482 10:132373774-132373796 GGGGTCTCCACAGGGAGACCAGG + Intronic
1083893919 11:65610989-65611011 GGGGTCACCCAGAGGAGAATGGG + Intronic
1088152744 11:106765640-106765662 GGGGTGTCCCAGGGGAGAAAAGG - Intronic
1090391037 11:126387484-126387506 GGGGTCTCACCACGTTGAACAGG - Intronic
1091327127 11:134699832-134699854 GGGGACTCCCAGAGGAGAAGGGG + Intergenic
1091425889 12:389111-389133 GGGGGGTCCCCGTGGGGAACCGG + Exonic
1091771992 12:3158139-3158161 GAGGGCTCCCCTCGGAGCACAGG + Intronic
1096542197 12:52314177-52314199 CGGGTGTCCAGGCGGAGAACAGG + Intergenic
1104940353 12:132392134-132392156 GGAGGGTCCCCGGGGAGAACGGG - Intergenic
1104940406 12:132392248-132392270 GGAGGGTCCCCGGGGAGAACGGG - Intergenic
1104940433 12:132392305-132392327 GGAGGGTCCCCGGGGAGAACGGG - Intergenic
1104940460 12:132392362-132392384 GGAGGGTCCCCGGGGAGAACGGG - Intergenic
1104940487 12:132392419-132392441 GGAGGGTCCCCGGGGAGAACGGG - Intergenic
1104940514 12:132392476-132392498 GGAGGGTCCCCGGGGAGAACGGG - Intergenic
1112291182 13:98144544-98144566 GGGGTTTCCACGCAGAGACCAGG - Intronic
1115752694 14:36507151-36507173 GGGGTCTCCCTGAGGAGGGCAGG + Intronic
1117402823 14:55372854-55372876 GGTTTCTCCACGCAGAGAACCGG - Intronic
1119193507 14:72700808-72700830 TGGGTCTCACCGCGGGGAGCAGG - Intronic
1130272630 15:82460015-82460037 GGGGTCTCGCCGAGGAGGAGGGG - Intergenic
1130464982 15:84187368-84187390 GGGGTCTCGCCGAGGAGGAGGGG - Intergenic
1130487706 15:84407436-84407458 GGGGTCTCGCCGAGGAGGAGGGG + Intergenic
1130499283 15:84486169-84486191 GGGGTCTCGCCGAGGAGGAGGGG + Intergenic
1130587272 15:85191982-85192004 GGGGTCTCGCCGAGGAGGAGGGG - Intergenic
1132604737 16:788962-788984 GGGGTCGGCCCGCGGTGAACAGG - Exonic
1134056255 16:11171464-11171486 GGGCTCTCCCCACAGAGCACTGG - Intronic
1141688638 16:85584270-85584292 TGGGCCTCCCAGCTGAGAACTGG + Intergenic
1142285714 16:89170723-89170745 GGGGTCTCGAAGGGGAGAACAGG + Intergenic
1148795086 17:50193039-50193061 GGGCTCTCCCTGTGGAGAAAGGG + Exonic
1152111709 17:78360522-78360544 GGGGTGTCCCCGCGGGGTCCGGG - Intergenic
1152654619 17:81513998-81514020 GGGGTCCCCACGCGGAGTCCGGG + Intronic
1160023940 18:75204131-75204153 GGGGTCTCCCTGCAGAGGAGCGG - Intronic
1160755924 19:757185-757207 GGGGGCTCCACTCGGAGAACAGG + Exonic
1160865521 19:1254306-1254328 GGGGTCCCCCCGCGCAGCAGCGG - Exonic
1160879688 19:1313722-1313744 GGGGCCTCCCCGGGGAACACAGG - Intergenic
1162962454 19:14136178-14136200 GGGGTCTCCACCGGGAGATCCGG + Intronic
1163157928 19:15449394-15449416 GGGCACTGCCCGCGGGGAACGGG + Intronic
1165476276 19:36032689-36032711 GGGGGCGGCCCGCGGAGAAGGGG - Intronic
1165938289 19:39402873-39402895 GGGGTCCCCCCGCGGGGCGCTGG - Intergenic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
1167503816 19:49861244-49861266 GGGCTCAGCCCTCGGAGAACTGG + Exonic
1167638262 19:50667415-50667437 GGGGTCCCCCCTCGGAGGACGGG - Exonic
929555666 2:42924226-42924248 GGTGCCTCCCTGTGGAGAACAGG - Intergenic
932490105 2:72114889-72114911 GGGGTCTCCCTGAGGAGGCCAGG - Intergenic
934978718 2:98823209-98823231 GGGGGCTCCACGCGGAGAGTGGG + Exonic
935033568 2:99345751-99345773 GGGGTCTCCCCACGTTGCACGGG - Intronic
936962289 2:118088550-118088572 GGGGTCTCCCGGCGAAGCGCGGG + Intronic
938971228 2:136434878-136434900 GGGGCCTCCCAGGGGAGAAATGG - Intergenic
943580468 2:189677700-189677722 GGGGTCTCCCTGTGTTGAACAGG + Intronic
948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG + Intronic
1169642451 20:7769447-7769469 GCAGTCTCCCCGAGGAGGACTGG - Intergenic
1170211330 20:13848811-13848833 GGGGACGCCCCAGGGAGAACAGG + Intergenic
1170764647 20:19279652-19279674 GGGGTCTCCCGGTGGAGAAGAGG - Intronic
1175307000 20:57982986-57983008 GGGGTCTATCCAGGGAGAACAGG - Intergenic
1183503602 22:38196032-38196054 GGGGTGCCCACGCGGAGAAATGG + Intronic
1184352687 22:43955064-43955086 GGGGTCTCCCCGCTGAGTCTCGG + Intronic
950590507 3:13933182-13933204 GGGGTCCCCTCGCCGAGAATCGG + Intergenic
954664731 3:52245790-52245812 GGGGGCTGCCCGCGGAGCGCGGG - Intronic
956105322 3:65811421-65811443 GGGGGCTCCCCATGGAGATCTGG - Intronic
962607109 3:137041735-137041757 GGGGACTCCCTGGTGAGAACCGG + Intergenic
966674324 3:182568948-182568970 GGGTTCTCCCCTGGGAGGACAGG + Intergenic
966847657 3:184143159-184143181 GGGATCACCCCGAGGAGAACAGG - Intronic
975986271 4:80203318-80203340 TGTGTCTGCCCGCGCAGAACTGG + Exonic
978935722 4:114372733-114372755 GGGGTCTCCCTACGGAGCCCAGG - Intergenic
999890582 5:155974799-155974821 GGGATATCCCCGTGGAGAATGGG + Intronic
1004462280 6:15848769-15848791 GCGGTCTTCCAGCGGAGACCTGG - Intergenic
1004562000 6:16760656-16760678 GGGGTCTCCCCTCGGAGGGCCGG - Intronic
1007415304 6:41688064-41688086 GGGGGCTCCCCGTGGAGAGGGGG - Intronic
1008130994 6:47720192-47720214 GGGGTCTCTCAGCGGAGACAGGG + Intronic
1018793809 6:167170808-167170830 GGGGTATCCCCTCGGAGGAGCGG + Intronic
1018822527 6:167384273-167384295 GGGGTATCCCCTCGGAGGAGCGG - Intronic
1024034735 7:45497672-45497694 GGGCCCTTCCCGCAGAGAACGGG + Intergenic
1024089264 7:45921645-45921667 GAGGTCTCCCTGCGGCGAGCCGG + Intronic
1034978021 7:155459087-155459109 CGGGCCTCCCCGCGGCGAGCCGG - Intronic
1035167958 7:157002821-157002843 GGGGTCCCCCTGCGTAGACCTGG + Intronic
1035632373 8:1117751-1117773 GGGGGCTCCCCCAGGAGAGCAGG + Intergenic
1036723564 8:11200497-11200519 GGGGCCGCCCCGCGAAGCACCGG + Intronic
1039798235 8:40933278-40933300 GCAGTCTCCCCGAGGAGCACGGG + Intergenic
1049791039 8:144472852-144472874 TGGGTCTCCCCGCGGCGGGCCGG - Exonic
1053139906 9:35675937-35675959 GGGGTCTCCCCGCCGAGACTTGG + Intronic
1056446101 9:86667461-86667483 GGGGTCCCCCCGGGGAGCAGTGG - Intergenic
1057421713 9:94918203-94918225 GGGGACTCCCAGCGTAGGACAGG + Intronic
1059109312 9:111539936-111539958 GGGGTCTCCCTGCGCGGATCAGG - Intronic
1061972954 9:134054614-134054636 GGAGGCTCCCCTCGGAGCACAGG + Intronic
1062581240 9:137230156-137230178 GGGGTGTCCCCTAGGAGGACTGG - Intergenic
1062679603 9:137771666-137771688 GGGGTCTTACCGAGGAGACCGGG + Intronic
1189330445 X:40141509-40141531 GGAGTCTCCCAGCAGAGAAGGGG - Intronic
1192809396 X:74536059-74536081 GTGGCCCCCCCGCGGAGACCGGG + Intergenic