ID: 902601213

View in Genome Browser
Species Human (GRCh38)
Location 1:17540858-17540880
Sequence CCCTCTCTCCCCAGAACCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902601213_902601217 -10 Left 902601213 1:17540858-17540880 CCTCGGGTTCTGGGGAGAGAGGG 0: 1
1: 0
2: 1
3: 40
4: 373
Right 902601217 1:17540871-17540893 GGAGAGAGGGCAGGTTGTGCGGG 0: 1
1: 0
2: 5
3: 60
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902601213 Original CRISPR CCCTCTCTCCCCAGAACCCG AGG (reversed) Intronic
900092172 1:925280-925302 TCCAGTCTCCCCCGAACCCGGGG - Intronic
900097423 1:945670-945692 CCCTCTCTCACCTGAGCCCCTGG - Intronic
900126481 1:1071066-1071088 CACTCTCTCCCCACAGTCCGAGG + Exonic
900127372 1:1074515-1074537 CCCTCTCTCCCTATAGCCCCAGG + Intergenic
900158482 1:1212743-1212765 CCCCATGTCCCCAGCACCCGGGG - Intronic
900221457 1:1511610-1511632 CCCTCCCGCCCAAGACCCCGGGG - Intergenic
900231814 1:1562857-1562879 CCCTCTCTCTGCAGAAGCCCTGG - Intronic
900290874 1:1923107-1923129 CCCTCTCTCTCCAGAAGCTGAGG - Exonic
900503791 1:3019215-3019237 CCCTCTCTGCCCACAGCCCCCGG - Intergenic
901380516 1:8870646-8870668 CCCTTTCCCCCCAGAATCGGAGG + Intronic
901853344 1:12029605-12029627 CCCTTTCCTCCCAGAACCTGGGG - Intronic
902601213 1:17540858-17540880 CCCTCTCTCCCCAGAACCCGAGG - Intronic
902633335 1:17718914-17718936 CCCTGCCTTCCCAGAACCCAGGG - Intergenic
902770934 1:18645263-18645285 CCGCCTCTCCCTCGAACCCGTGG - Intronic
902835628 1:19045032-19045054 CCCTCTGTCCCCAGAAGACATGG + Intergenic
902943078 1:19814491-19814513 TGCTGTCTCCCCAGCACCCGGGG - Exonic
903217260 1:21850184-21850206 CCCTCTGTCCCCAGCACTTGGGG - Exonic
903335561 1:22622028-22622050 CCCACTCTCCACAGTAACCGAGG - Intergenic
903407709 1:23112195-23112217 CCCTCTGTCCCCAAAACAAGAGG + Intronic
903886809 1:26545688-26545710 CCCCCTCTCCTCAGAGCCTGAGG - Intronic
904238889 1:29131355-29131377 CCCTCACTGCCCAGAGCCAGCGG + Intergenic
904617036 1:31755479-31755501 CTCTCTCTGCCCTGACCCCGGGG + Intronic
904785215 1:32977522-32977544 CCACCCCTCCCCAGAACCCTCGG - Intergenic
905815729 1:40949367-40949389 CCCTGTGTCCCCAGCACCAGGGG + Intergenic
906376990 1:45303888-45303910 CCCTCTCTCCCCAATCCCAGGGG - Intronic
907829054 1:58046803-58046825 CCCTCTATCCCCAGCACCAGTGG - Intronic
907996178 1:59634991-59635013 CCCTCTCTCTCATGAACCCCAGG - Intronic
909529165 1:76662268-76662290 CCCTCTTTCCCCTTAACCCTCGG - Intergenic
909646949 1:77928201-77928223 TCCTCTCGCCTCAGCACCCGGGG - Intronic
913319672 1:117579406-117579428 CCTTCTCTGCCCAGAGCCCCAGG + Intergenic
916079828 1:161225540-161225562 CCTTCTCTCCAAAGAACCCATGG - Intergenic
918952001 1:191151533-191151555 CCCTCACTGCCCAGAGCCGGTGG - Intergenic
919923748 1:202181644-202181666 CCTTCTCTCCACAGAGCCCTGGG + Intergenic
920310286 1:205044419-205044441 CCCTCTAGCCCCAGACCCCTGGG + Intronic
920380759 1:205533287-205533309 ACCTCCCTCCCCAGAAGCCAGGG - Intergenic
920946812 1:210536931-210536953 CCCTCTCTCTCCACACCCCAGGG - Intronic
921343081 1:214153914-214153936 TCCTCTCTCCCCTGAACCCATGG + Intergenic
922779826 1:228243169-228243191 CACTCTGTCCCCAGAGCCCAAGG + Exonic
1062812909 10:478947-478969 CCCTCCTTCCCCAGCACCCAGGG + Intronic
1062907658 10:1189732-1189754 ACCTCCTTCCCCAGAACACGTGG + Intronic
1062907664 10:1189759-1189781 ACCTCCTTCCCCAGAACACGTGG + Intronic
1062907670 10:1189786-1189808 ACCTCCTTCCCCAGAACACGTGG + Intronic
1062907676 10:1189813-1189835 ACCTCCTTCCCCAGAACACGTGG + Intronic
1062907682 10:1189840-1189862 ACCTCCTTCCCCAGAACACGTGG + Intronic
1062907688 10:1189867-1189889 ACCTCCTTCCCCAGAACACGTGG + Intronic
1062907694 10:1189894-1189916 ACCTCCTTCCCCAGAACACGTGG + Intronic
1064110039 10:12530642-12530664 CGCTGCCTCCCCAGACCCCGAGG - Intronic
1064965101 10:21007205-21007227 CCCTCTCTCCCCACAGCCGCTGG + Intronic
1065888072 10:30096204-30096226 GCCTCTGTCCCCAGCACCTGGGG - Intronic
1066758177 10:38730795-38730817 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1066963508 10:42241921-42241943 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1067529070 10:47057481-47057503 CCCTCTGTCCCCCCAACCCCTGG - Intergenic
1067715359 10:48686065-48686087 ACCTCTCTGGCCAGAACCCCAGG - Intronic
1068554966 10:58448509-58448531 CCCTCACTGCCCAGGACCTGCGG + Intergenic
1069604635 10:69731680-69731702 CCCTTTCTCCCCAGATCCTGTGG + Intergenic
1069987499 10:72294373-72294395 CCCTCTGTCCCCAGGACACCAGG + Intergenic
1072642248 10:97220596-97220618 CCCTCTCTCCCCAGCCCCCAAGG - Intronic
1073039215 10:100588819-100588841 CCCTCCCTCCCCCAAACCCTTGG - Intergenic
1073472151 10:103729549-103729571 CCCACTTGCCCCAGAACCTGAGG - Intronic
1073618412 10:105022030-105022052 CCCTCTTTCCCCACAACCCCTGG - Intronic
1074859015 10:117496196-117496218 CCCTCTCCCCCCAGCACCGCAGG + Intergenic
1075140028 10:119824507-119824529 CCCTCCCTCCCCACAGCACGAGG - Intronic
1075487526 10:122837725-122837747 CCCTCTCTGCCCTGCACCAGTGG - Intronic
1077613314 11:3658534-3658556 CCCTCTTCCCCCAGCACCCGGGG + Intronic
1077976285 11:7251930-7251952 CCGTCCCTCCCCAGACACCGAGG - Exonic
1078480223 11:11668973-11668995 CCCTCTCTGCTCAGAGCACGGGG + Intergenic
1081869885 11:46378540-46378562 GCCTCGCTCCCCAGGGCCCGAGG - Intronic
1083552138 11:63598006-63598028 CCCTCTCTTCCCAGCCCCTGGGG + Intronic
1084268283 11:68016131-68016153 CCCTCTCTCCCCTTCACCCTGGG - Intronic
1084430267 11:69106966-69106988 CCTCCTCTCCCCAGAAGCTGTGG - Intergenic
1084483372 11:69434602-69434624 CCCTCCCTCCCCAGGGCCTGGGG - Intergenic
1085527679 11:77173662-77173684 CCTTCCCTCCCCAGATCCCGAGG - Intronic
1086070823 11:82797168-82797190 CTCTTTTTCCCCAGAACCCAGGG - Intergenic
1088186480 11:107176801-107176823 CGGTCACTCCCAAGAACCCGTGG + Intergenic
1089354849 11:117842773-117842795 CCCTCTGTCCCCAGACGCCATGG - Exonic
1089460474 11:118650212-118650234 CTCCCTCTCCCCAGCACCCCAGG - Intronic
1090188166 11:124751713-124751735 CCCTCCCTTCCCAAAACCTGAGG + Intronic
1094226343 12:28050614-28050636 CACTCTCTCCCCACATCCCTAGG + Intergenic
1096039955 12:48506508-48506530 CCCTCCCTCCCCACAACCCCTGG - Intergenic
1096109470 12:49020476-49020498 CCCTCTCCCCCCACCCCCCGGGG - Exonic
1096693436 12:53334830-53334852 CCCTTTGTCCCCAGCACCAGAGG + Intronic
1096803312 12:54126069-54126091 CCCTTTCTCCCCAGAGCCGAGGG - Intergenic
1097243901 12:57595251-57595273 CCCTTTCTCCCCAGCAACTGAGG + Intronic
1098196184 12:68004432-68004454 CTCTCTCTCCCCAGAGGCTGGGG + Intergenic
1098776150 12:74620266-74620288 CCCTCCTTCCCCACAACCCCTGG + Intergenic
1099226271 12:79973142-79973164 CTCTCTCTCCTCAGAACTCATGG - Intergenic
1101992271 12:109496071-109496093 TCCCCTCTCCCCAGAACCCCTGG + Intronic
1102522227 12:113485532-113485554 CCCTCTCTCCCCTGAGCCAGTGG + Intergenic
1103436540 12:120931195-120931217 CCTTCTCTCCCCAGAAACAGGGG - Intergenic
1103834367 12:123807393-123807415 CATTCTCTCCCCAGAACACTAGG - Intronic
1103929903 12:124444595-124444617 GCCTCCCTCCCTAGAACCCAGGG - Intronic
1103941709 12:124504858-124504880 TCCTCCCTCCCCACAACCCCTGG - Intronic
1104343007 12:127968598-127968620 TCATCCCTCCCCACAACCCGTGG + Intergenic
1105576588 13:21658821-21658843 GCCTCTCTCCCCAGAAACCTGGG - Intergenic
1106357051 13:28992885-28992907 CCATCTCTCCCCACAGCCCCTGG + Intronic
1106384142 13:29267788-29267810 TCCTTTCTCCCCACAACCCTCGG - Intronic
1106480392 13:30133190-30133212 CCCTCTTTCCCCAGAGCCAGCGG + Intergenic
1111084659 13:83359363-83359385 ACCTGTCTCCCCAAAACCCATGG - Intergenic
1111633939 13:90879248-90879270 CTCTCTCTCCCCTGACCCCCTGG + Intergenic
1112670274 13:101627620-101627642 CCCTCTCTCCCTACAACCCCTGG + Intronic
1112774964 13:102833679-102833701 CCCTCTCTTCCCCAAACCCGAGG - Intronic
1113385760 13:109846441-109846463 CTCTCTCTCCCCAGCTCCTGAGG - Intergenic
1113779102 13:112965817-112965839 GCCTCTCTCCCGGGAACCAGAGG - Intronic
1114646976 14:24261270-24261292 CCCTCTGTCCCCATGACCCAAGG - Intronic
1115289509 14:31753643-31753665 CCCCCACTCCCCAGGACCCAAGG - Intronic
1117028990 14:51651018-51651040 CGCCCCCTCCCCAGACCCCGAGG + Intronic
1119303458 14:73589233-73589255 CCCTCCCTCCCCACAATCCCTGG + Intergenic
1119898925 14:78243649-78243671 CCCCGGCTCCCCAGAAGCCGAGG - Intronic
1119957971 14:78821415-78821437 CCTTTCCTCCCCAGAATCCGAGG + Intronic
1121312143 14:92940991-92941013 CCCTCCCTCCCCACAGCCAGAGG - Exonic
1123058645 14:105584415-105584437 CCCACTGTCCCCAGACCCCAAGG - Intergenic
1123082974 14:105704641-105704663 CCCACTGTCCCCAGACCCCAAGG - Intergenic
1123441580 15:20295509-20295531 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1125242323 15:37589597-37589619 CCCTCCCTCCCCCAAACCCCTGG + Intergenic
1125533340 15:40428373-40428395 CCCTCTCTCCCAGGTACCCCGGG + Intronic
1128109656 15:65068225-65068247 CCCTCTCTCCCCCTAGCCCTGGG - Intronic
1128247600 15:66143746-66143768 CCCTGTCTCCCCAGGACTCAGGG + Intronic
1129389227 15:75212349-75212371 CCCTCTCTCCTGAGACCCCGTGG + Intergenic
1129484685 15:75858674-75858696 GCCTCTCTCCCCAGCACTCCTGG + Intronic
1129824373 15:78625105-78625127 TCCTCTCACCCCACAACCCAGGG + Exonic
1130108269 15:80945093-80945115 TCTTCTCTCCCCAGGACCCTGGG - Intronic
1132093072 15:98961111-98961133 CCATCTCTCCCAGGACCCCGGGG + Exonic
1132406101 15:101542648-101542670 CCCACTTTCCCCAGAACTGGGGG + Intergenic
1132692618 16:1188357-1188379 ACCCCTCTCCCCAGAGCCAGCGG - Intronic
1132846570 16:2003538-2003560 CCCACTCTCCTCACAACCGGAGG - Intronic
1133176223 16:4016812-4016834 CCCTCTCTCTCCTAAACCCATGG - Intronic
1133230180 16:4362656-4362678 CCCTCACTCTCCAGCACCAGTGG - Exonic
1133280971 16:4665085-4665107 CCCTCTCTCCCCAGCAGTGGTGG + Exonic
1134537816 16:15040748-15040770 CCCTCTCCCCCCAGCACCCCAGG - Intronic
1135016184 16:18926487-18926509 GCCTCTCTCCCCAGGCCCGGCGG - Intergenic
1135437171 16:22436952-22436974 GCCTCTCTCCCCAGGCCCGGCGG + Intronic
1136333276 16:29595420-29595442 GCCTCTCTCCCCAGGCCCGGCGG - Intergenic
1136447960 16:30335451-30335473 GCCTCTCTCCCCAGGCCCGGCGG - Intergenic
1136719624 16:32310001-32310023 CCCACTCTCCCCAGTCCCCGTGG - Intergenic
1136724656 16:32348401-32348423 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1136837998 16:33516281-33516303 CCCACTCTCCCCAGTCCCCGTGG - Intergenic
1136842983 16:33554441-33554463 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1138433353 16:56983437-56983459 GCCTCTCTCCCCAGGAACAGGGG - Intronic
1139070137 16:63370322-63370344 CCCTCCCTCCCCATAATCCCTGG + Intergenic
1139166579 16:64573092-64573114 CCTTCTCTCCTCAAAACCAGAGG + Intergenic
1139711124 16:68777221-68777243 CCGTCTGGCCCCAGAGCCCGTGG - Intronic
1140688594 16:77458496-77458518 CCTTCTCTCCTCAGAACCATGGG + Intergenic
1141664905 16:85461051-85461073 CCCTCTCTCCCCACACCCTTAGG + Intergenic
1141957818 16:87384115-87384137 CCCTATCTCCACAAAAGCCGCGG - Intronic
1142187424 16:88701183-88701205 CCCACCCTCTGCAGAACCCGTGG + Intronic
1142246421 16:88972202-88972224 CCCTCCCTCCCCAGTAAGCGTGG - Intronic
1142286075 16:89172041-89172063 CACTCACTCCCCACAACCCCTGG - Intronic
1203001774 16_KI270728v1_random:169354-169376 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1203006807 16_KI270728v1_random:207768-207790 CCCACTCTCCCCAGTCCCCGTGG + Intergenic
1203133377 16_KI270728v1_random:1705760-1705782 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1203148178 16_KI270728v1_random:1816565-1816587 CCCACTCTCCCCAGTCCCCGTGG - Intergenic
1203153148 16_KI270728v1_random:1854739-1854761 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1144830250 17:18127174-18127196 ACCTGTCTCCCCAGGACCCTAGG + Intronic
1145941084 17:28743792-28743814 CCGCTTCTCCCCAGAGCCCGCGG - Intergenic
1145990214 17:29074727-29074749 CCCTCTCACCCCAGGGCCTGTGG - Exonic
1146415534 17:32629205-32629227 CCCTCTTTCCCCTGAACCTACGG - Intronic
1147613224 17:41813310-41813332 CACTCCGTCCCCTGAACCCGGGG + Intronic
1148045546 17:44741759-44741781 CCCTGTCCGCCCAGAACCCCTGG + Intronic
1148103814 17:45108698-45108720 CCCACCTTCCCCAGAACCAGGGG + Exonic
1148246302 17:46033037-46033059 CCCTCTCTCCACAGGCCCTGGGG + Intronic
1148664696 17:49365685-49365707 CTTTCTCTCCCCAGAAGCCTGGG + Intergenic
1150135454 17:62692752-62692774 CTCTTTCTCCCCAGAGCCCCCGG + Exonic
1150268851 17:63849564-63849586 CCCTCTCTCCGCTGGACCCGAGG + Intergenic
1151675319 17:75594595-75594617 GCCCCTCTCCCCAGGACCCTCGG - Intergenic
1152023920 17:77796667-77796689 CCCTCTCCTCCCAGAATCCAAGG - Intergenic
1152262086 17:79272759-79272781 CCCTCCCTCCACAGCACCCCAGG - Intronic
1152511861 17:80795422-80795444 CCCTCCCTCCCCAGCACCAAAGG + Intronic
1152889060 17:82869819-82869841 CTCTCCCTCCCCTGAACCAGGGG + Intronic
1152889070 17:82869845-82869867 CTCTCCCTCCCCTGAACCAGGGG + Intronic
1153144455 18:2014404-2014426 CCCTCTCTCCCCTCAAGCCCCGG + Intergenic
1153219341 18:2847787-2847809 CCCTCTCTCTCCTGCACCCCAGG + Exonic
1154951132 18:21210987-21211009 CCCTCCCTCCCCTCAACCCTTGG + Intergenic
1156150341 18:34234065-34234087 CCCTCACTGCCCAGGACCAGCGG - Intergenic
1156597662 18:38565978-38566000 CCCTCTCTCCCCCTCACCTGTGG + Intergenic
1158529077 18:58242058-58242080 TCATCTCTACCCAGATCCCGTGG + Intronic
1158549737 18:58425120-58425142 CCCTATCTCCCCAGCACTCTCGG + Intergenic
1160723686 19:608390-608412 GCCTCTCCCCTCAGACCCCGGGG - Intronic
1160807511 19:998995-999017 CGGTGTCTCCCCAGATCCCGCGG - Intergenic
1161138914 19:2636668-2636690 GCCTCTCTGCCCAAAACCAGAGG - Intronic
1161408004 19:4101195-4101217 CCCGCCCTCCCCAGAGCCCCGGG - Intronic
1161959725 19:7516678-7516700 CCCTCTTCCCCCAGGACCCTAGG + Intronic
1162806012 19:13138487-13138509 CTGTCCCTCCCCAGGACCCGCGG + Exonic
1163455686 19:17404508-17404530 CCCTCTGTCCCCAGGACCTAGGG - Intronic
1163569097 19:18069705-18069727 CCCTCTCCTTCCAGAACCAGTGG - Exonic
1163783355 19:19261805-19261827 CCCCCCCACCCCAAAACCCGAGG + Intronic
1164237022 19:23346252-23346274 CACCCTCTCCCCAGAAGACGAGG + Intronic
1164606028 19:29598727-29598749 CCCTCTCTCTCTAGCACCAGTGG + Intergenic
1164765445 19:30762342-30762364 CCATCTCACCCCACAACCCCTGG + Intergenic
1165108621 19:33488535-33488557 CTCTCTCTCCCCAGGCCCCCAGG - Intronic
1165361289 19:35338448-35338470 TCTTCTCTCCCTAGAACCAGAGG - Intronic
1165992651 19:39825423-39825445 CCCCCTCACCCCAGGACCCTAGG - Exonic
1166076103 19:40414689-40414711 CCCTGACTCACCAGACCCCGGGG + Intergenic
1166136539 19:40780517-40780539 CTCTCTCTCCCCATCACCCTTGG - Intronic
1166507580 19:43380800-43380822 CCCTCTCTCCCCGCAAGCAGGGG - Intergenic
1166802993 19:45469464-45469486 CTCTCTGTCCCCGGAACCCGTGG + Intronic
1166841287 19:45698714-45698736 CCCTCCCTCGCCAGAAGCCAGGG - Intronic
1166843227 19:45711619-45711641 CCCTCTCCCCCCGGGAGCCGAGG - Exonic
1166857793 19:45791997-45792019 GCCTGCCACCCCAGAACCCGGGG + Intronic
1167355826 19:49003394-49003416 CCCACACTCCCCAGGACCCTGGG - Intronic
1167565689 19:50255206-50255228 TCCTCACTCCCCAGAACATGGGG + Exonic
1167678728 19:50906515-50906537 CCCTCCTTCCCCAGACCCAGAGG - Exonic
1168112719 19:54203096-54203118 CCCACTCCCCACAGAACCCTGGG - Intronic
1168287702 19:55342669-55342691 CCCTCTCTCTCCAGGACTCTAGG - Intronic
925387622 2:3473158-3473180 TGCTCTCTCTGCAGAACCCGAGG - Intronic
927147095 2:20173370-20173392 TCCTCTCTTCCCAGAAGCCCTGG - Intergenic
927375872 2:22412896-22412918 GTCTCTCTCCCCAGAACCGTAGG + Intergenic
927600295 2:24434843-24434865 TTCTCTCTCCCCAGGACCTGGGG + Intergenic
927789884 2:26001805-26001827 CCTTCTATTGCCAGAACCCGTGG + Intergenic
927985673 2:27409139-27409161 CCCTCTCGGCCCTGACCCCGCGG + Intronic
928104113 2:28456694-28456716 CCCTCCCTCCCCACAACCCCTGG + Intergenic
928600576 2:32900261-32900283 CCCACTCTTCCCAGGACCCCGGG + Intergenic
929066998 2:37987523-37987545 CCCTCCCTCCCCGCAACCCCTGG - Intronic
930249664 2:49021299-49021321 CCCTCTCTCCTCACAACCTCTGG - Intronic
930920078 2:56742356-56742378 CTCCCTCACCCCAGAACCCAGGG - Intergenic
931865308 2:66404044-66404066 CCCTCTCTCCCTGGAAACCATGG - Intergenic
932619403 2:73256982-73257004 CCCTGTGACCCCAGAACCAGAGG - Exonic
933907548 2:86910185-86910207 CTCTCTCTCTCCAGGACCTGTGG + Intronic
933908794 2:86919877-86919899 CTCTCTCTCTCCAGGACCTGTGG + Intronic
934023932 2:87983508-87983530 CTCTCTCTCTCCAGGACCTGTGG - Intergenic
935167943 2:100585961-100585983 TCCACTCTCCCCTGAACCCCTGG - Intergenic
935405827 2:102708002-102708024 TCCCCTCTCCCCAGAGCCCCAGG + Intronic
935549845 2:104441338-104441360 CCCTCTCTCCCCAGGCCGCACGG - Intergenic
936364585 2:111841226-111841248 CTCTCTCTCTCCAGGACCTGTGG - Intronic
937158407 2:119737983-119738005 CCCTATGTCCCCAGAACCATTGG + Intergenic
937986326 2:127639797-127639819 CCTTCCCTCCCCAGAGCCCAGGG + Intronic
938070720 2:128306842-128306864 CCCTCACTCCCCAGGCCCCTTGG - Intronic
938672940 2:133602768-133602790 CCCTCCCTTCCCTTAACCCGGGG - Intergenic
938829297 2:135034809-135034831 CCCCCTCTCCCCACAGCCCACGG - Intronic
939886439 2:147686504-147686526 CCCTCACTGCCCAGGGCCCGCGG + Intergenic
940782339 2:157946024-157946046 CTTTCTCTCCCCACAACCCTAGG + Intronic
942543967 2:177043623-177043645 CCCTCTCTCCCCAAAATGCACGG + Intergenic
943876622 2:193074240-193074262 AGCTCTCTCCCCAGGACCAGAGG - Intergenic
946306903 2:218861162-218861184 CCCTATCTCTCCAGAGCACGGGG - Intronic
946901978 2:224381518-224381540 CCCTCCCTCCCCCCAACCCCTGG - Intronic
946903818 2:224396988-224397010 GCCCCTCTCCCCAGGACCCAAGG + Intronic
948459066 2:238120488-238120510 CCTTCTGTCCCCAGACCCCGTGG + Intronic
948477093 2:238227236-238227258 CCCTCTCTCTCCAGAAGTCCAGG + Intronic
948502809 2:238407261-238407283 CCCTCTCACCCCAGGTCCCCTGG - Intergenic
948806433 2:240455341-240455363 CCCTCTCTTCCCTGATCCCTGGG - Intronic
1168756398 20:321433-321455 CCCTGGCTCCCCACAACCCAGGG + Intergenic
1172874894 20:38158255-38158277 CCCTTTCTTCCCAGATCCTGGGG + Intronic
1172899607 20:38324866-38324888 CCCTGTCCTCCCAGAACCCCCGG - Intronic
1174135261 20:48374853-48374875 CCTTTTGTCACCAGAACCCGGGG + Intergenic
1175033571 20:55978437-55978459 CACTCTCTGCCCAGAATCAGTGG - Intergenic
1175214536 20:57384747-57384769 CCCTGGCTCCCCAGCACCAGAGG - Intergenic
1175306635 20:57980344-57980366 GCTTGTATCCCCAGAACCCGGGG - Intergenic
1175320533 20:58084710-58084732 CCCTCCCTCCACACAGCCCGTGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175510260 20:59519346-59519368 ACCTCTCTCCCCAGAGCCCTTGG + Intergenic
1175755602 20:61527870-61527892 AGCTCTGTTCCCAGAACCCGGGG + Intronic
1175814376 20:61875892-61875914 CCCTCTCTCCCCAGGGCAGGCGG - Intronic
1175979512 20:62730257-62730279 TCCTCCCTCCCCACAACCCCTGG + Intronic
1176103304 20:63374288-63374310 CCCACTCTCCCCTGAGCCCGGGG - Intronic
1176241272 20:64076946-64076968 GCCCCTCTCCCCAGACCCCCAGG - Exonic
1179025446 21:37675518-37675540 CCCTCGGTCCCCAGCACCCCTGG + Intronic
1179056506 21:37940644-37940666 CCCTCCCTCCCCCAAACCCCTGG + Intergenic
1179056791 21:37943804-37943826 CCATCTCTCCCCTGAGCCTGGGG + Intergenic
1179824576 21:43957040-43957062 CCTTGGCTCCCCAGAAACCGTGG - Intronic
1180309746 22:11159194-11159216 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1180548223 22:16521004-16521026 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1181147449 22:20858875-20858897 CCCTCTCTCCCCTGCAGCGGTGG - Intronic
1181450548 22:23017268-23017290 CCCTCACTGCCCAGGGCCCGGGG + Intergenic
1181735905 22:24881239-24881261 CCCATTCTCCCCACAACCCTAGG - Intronic
1182307441 22:29380394-29380416 CAACCTCTCCCCAGAACCCCCGG + Intronic
1182420216 22:30245332-30245354 CCCTCTCTTCCCACCTCCCGTGG + Intronic
1182421518 22:30250816-30250838 CCCTCTCTCCTGAGAGCCCCAGG - Intergenic
1182735418 22:32529459-32529481 CCCTCTTTCCTCTGAACCCTGGG - Intronic
1182759222 22:32708603-32708625 CCCTCTCTCCCCAAACCACCGGG - Intronic
1182781561 22:32872718-32872740 CCCTCTGTACCCAGCACCCCAGG + Intronic
1183104631 22:35607242-35607264 CCCGCTCTCTCTTGAACCCGGGG + Exonic
1183261284 22:36797516-36797538 CCCTCTCCACCCAGAGCCCAAGG - Intergenic
1183304769 22:37076669-37076691 CCCTCCCTCCACAGCAGCCGGGG + Intronic
1183483552 22:38077642-38077664 CCCACCCTCCCCAGGACCCCAGG + Intergenic
1183769104 22:39908161-39908183 CCCTCTGTTCCCAGACCCAGTGG - Intronic
1184614612 22:45629663-45629685 CTCTCTCTCCCCAGAAGTCAGGG + Intergenic
1185254886 22:49826782-49826804 CCCCGTCTCCCCAGAAAGCGCGG - Intronic
950679591 3:14575786-14575808 CCCTGTCTCCCCAGAGCTTGAGG + Intergenic
952946711 3:38482697-38482719 ACCTCACTCCCCATAACCCCTGG - Intronic
953869233 3:46611967-46611989 CCCTTTCTCCCTGGAACCAGAGG + Intronic
954140190 3:48600928-48600950 CCCTCTCTTCCCTGAAGGCGAGG + Intronic
956918508 3:73900568-73900590 CTCTCTCTCCCCTCACCCCGAGG + Intergenic
957446127 3:80314601-80314623 CCCTCACTGCCCAGTACCGGTGG - Intergenic
958428513 3:94008644-94008666 CCCCCTCTCGCTAGTACCCGTGG + Intronic
961376449 3:126469306-126469328 CCTGCTCTCCCCAGCACCAGTGG + Intronic
962222241 3:133573752-133573774 TCCGCTCTCCCCACAACCTGAGG - Exonic
962883351 3:139600009-139600031 CCCTCTCTCCTCAGTGCCCTTGG + Intronic
962904320 3:139788535-139788557 CCCTCTCTGTCCAGAAGCCTGGG - Intergenic
966194258 3:177297863-177297885 CAGTCACTCCCAAGAACCCGTGG - Intergenic
966931966 3:184681187-184681209 CTCTCTCACTCAAGAACCCGCGG + Intronic
970292565 4:14590592-14590614 GCCTCTCTCCCCATATCCCCTGG - Intergenic
970917099 4:21348834-21348856 CTCTCTTTCCCCAGAACTCATGG - Intronic
971161694 4:24140060-24140082 CCCTCTCTCCCCATGACCTCTGG - Intergenic
972532781 4:39976705-39976727 CCCTGTCTCCCCAGAGGCCGGGG + Intronic
974839799 4:67286949-67286971 CCCTCACTGCCCAGGGCCCGCGG + Intergenic
978423579 4:108559659-108559681 CCCTCTCTTCCCAGGGCCCAGGG - Intergenic
978603100 4:110449027-110449049 TCCTCTCTCCTCCGAACCCCTGG - Intronic
984412671 4:179414674-179414696 GGCTCTCTGCCCAGATCCCGGGG + Intergenic
985161225 4:187047007-187047029 CCCTCCCTCCCCAAAAACCCTGG - Intergenic
985485641 5:146696-146718 CCTTCTCTCCCCTGACCCTGCGG + Intronic
985546458 5:512092-512114 CCCTCTCTCCCCCTAACCCGTGG - Intronic
985689298 5:1298346-1298368 CCGCCTCTTCCCAGAACCCCTGG + Intergenic
985849805 5:2380682-2380704 TGCTCCCTCCCCAGAACCCCTGG - Intergenic
985888313 5:2697183-2697205 ACCTTTCTCACCAGCACCCGCGG + Intergenic
986462284 5:7983949-7983971 CCTTCTCTCCTCAGAGCCCTGGG - Intergenic
988407028 5:30836972-30836994 GCCTCTCTTCCCAGAATCAGTGG - Intergenic
991081805 5:62608917-62608939 CCCTCCCTCCCCTGAGCCCCTGG + Intronic
991450256 5:66743625-66743647 CCCTGTGTCCCCAGAACTCCAGG - Intronic
993863203 5:93160773-93160795 CCCTCCCTCCCGACAACCCCCGG + Intergenic
994876056 5:105422208-105422230 CCCTCGCCCCCCATAACCCCTGG + Intergenic
996529964 5:124518273-124518295 TCCTCCCTCCCCAGAAACAGGGG + Intergenic
997673343 5:135694307-135694329 CCCTCCCTCCACAGAGCCTGTGG - Intergenic
999243589 5:150141195-150141217 CCCACTGTGCCCAGCACCCGTGG + Intronic
999300604 5:150487856-150487878 GCCTCTCTCCCTAGCACCCAGGG + Intronic
999642231 5:153683091-153683113 CCCTCTCTCCCCCCATCCCAGGG - Intronic
999809570 5:155114940-155114962 CCCTCACTGCCCAGAGCCGGGGG - Intergenic
1000019883 5:157309915-157309937 TCCTCCCTCCCCAGATCCCTGGG + Intronic
1000020542 5:157314955-157314977 CCCACTCTCCCCAGTACTCTTGG + Exonic
1001574505 5:172753777-172753799 CCCTCCCTCCCCATAACTCCTGG - Intergenic
1002281465 5:178132465-178132487 CCCTCTCTCCCCACCACACCTGG - Intronic
1002708912 5:181182373-181182395 CACTCTCTCCCCGGACACCGCGG - Intergenic
1003700889 6:8463692-8463714 CCCTCCTTCCCCTGAACCCTTGG + Intergenic
1004985126 6:21072990-21073012 CCCTCTCTTCCCCAAACCCCTGG + Intronic
1005360159 6:25023955-25023977 CGGTCACTCCCAAGAACCCGTGG - Intronic
1005948866 6:30616504-30616526 CCCCCTCCCCCCTGAGCCCGAGG - Exonic
1006116843 6:31780146-31780168 CCCTCTCTCCCCAAGCCCGGAGG - Exonic
1006683102 6:35811509-35811531 CCCACTGTCCCCAGAACCGTGGG + Intronic
1007103396 6:39267135-39267157 CCCATTCTCCCCGCAACCCGGGG - Intergenic
1007706979 6:43797196-43797218 CCCTCTCTACCCAGAGCCCAGGG + Intergenic
1007834801 6:44666210-44666232 CCCCCTCTCCCCACAACCTCTGG - Intergenic
1008649581 6:53548866-53548888 CACCCTTTCCCCAAAACCCGCGG + Intronic
1009803621 6:68573706-68573728 CCCTCTATCCTCACAACCCAGGG - Intergenic
1010172126 6:72986844-72986866 CCCTCTCAGTCCAGAACCCTTGG + Intronic
1010260375 6:73808547-73808569 ACCTGTCTCTCCAGAACCCAAGG - Intronic
1010269335 6:73903268-73903290 CCCTCACTGCCCAGGACCAGTGG - Intergenic
1011899552 6:92275264-92275286 CCCTCTGCCCACAGAACCTGAGG + Intergenic
1012475621 6:99613199-99613221 CGGTCTCTCCCCAAAACCCCCGG + Exonic
1018296930 6:162357894-162357916 CCCTCCTTCCCCTGAACCTGTGG - Intronic
1018539849 6:164867226-164867248 TCCTCTCTCCCCAGAGTCCCTGG - Intergenic
1018698891 6:166411958-166411980 CCGTCTGTCCCCAGCTCCCGTGG - Exonic
1018795560 6:167182653-167182675 TCCTTTCTCCCCACAACCAGCGG + Exonic
1018820759 6:167372410-167372432 TCCTTTCTCCCCACAACCAGCGG - Exonic
1019285397 7:220693-220715 GCCTCTCTCCCCTGCACACGTGG - Intronic
1019526938 7:1484740-1484762 GCCTTTCTCCCCAGACCCTGAGG - Intronic
1019623970 7:2006392-2006414 CCCTCCCTCCACAGAACCTGGGG - Intronic
1019643147 7:2115406-2115428 TCCTCTGACCCCAGAACACGTGG - Intronic
1019762882 7:2826769-2826791 CCCTGTCTCCCCTCAACCCCTGG - Intronic
1021491132 7:21220911-21220933 CAGTCACTCCCAAGAACCCGTGG - Intergenic
1022050915 7:26670487-26670509 CTCTCTCTCCACAGAGCCTGGGG + Intronic
1022689051 7:32628030-32628052 CCCTCCTTCCCCCTAACCCGTGG - Intergenic
1022937524 7:35194329-35194351 CCCTCTTTCCCCCCAAACCGTGG + Intergenic
1023156284 7:37255877-37255899 CACTCTCTCACCAGAAGCCGTGG + Intronic
1023175606 7:37432730-37432752 CCCTCCCTCCCCAGTGCCTGTGG - Intronic
1023819443 7:43972498-43972520 TCTACTCTCCCCAGAAGCCGGGG - Intergenic
1024034406 7:45495287-45495309 CCCAGTCTCCCCAGCACCAGCGG + Intergenic
1025259085 7:57405132-57405154 CCCTCTCCCACCTGCACCCGGGG + Intergenic
1026290109 7:68998472-68998494 CCCTCTCTCCCCAGGCCACAGGG - Intergenic
1026339613 7:69424148-69424170 CCATTTCTCCCCAGCACCCCAGG - Intergenic
1028372606 7:90111272-90111294 CCCTCTTTCCCCCCAAACCGTGG - Intergenic
1029125944 7:98295292-98295314 CCCACCCTCCCCAGATCCCCTGG + Intronic
1029223459 7:99008363-99008385 TCCTCTCTCCCCAGTGCCCCGGG + Exonic
1029485328 7:100836576-100836598 CCCTCCCTCCCCAGGATCCAGGG + Intronic
1029597150 7:101543984-101544006 CCTTCTCTCCCCAGGGCCCCCGG + Exonic
1029744494 7:102509467-102509489 TCTACTCTCCCCAGAAGCCGGGG - Intronic
1029762485 7:102608629-102608651 TCTACTCTCCCCAGAAGCCGGGG - Intronic
1029833684 7:103286972-103286994 CCCTCTTTCCCCCCAAACCGTGG + Intergenic
1030735016 7:113037751-113037773 CACTCTCTCCCTAGATCCCTGGG - Intergenic
1033985099 7:147215357-147215379 CCCTCACTCCCCACAACCTCTGG + Intronic
1035552655 8:542236-542258 CCCTCCCTCCCCGGAACCCCTGG - Intronic
1035595996 8:858411-858433 CCCTCCCTCCCCACAGCCCATGG - Intergenic
1035632933 8:1121776-1121798 CCTTGTCTCCTTAGAACCCGTGG + Intergenic
1035744869 8:1954668-1954690 CCCTCTCTGCTCACAACCCTAGG + Intronic
1036641721 8:10588867-10588889 CCCTGCCTCCCCACAACCCCGGG - Intergenic
1038517164 8:28197085-28197107 CCCTCTCACCCCACATCCCTAGG + Intergenic
1040625550 8:49145467-49145489 CCATCACTCCTCAGAACCAGGGG + Intergenic
1042566606 8:70117998-70118020 CCCTGTCTCCCAAGAACCCCAGG - Intronic
1047927221 8:129693495-129693517 CCCTCTCCCCCCAGATCTTGGGG + Intergenic
1049310947 8:141933595-141933617 CCCTGGCTCCCCAGAGCCTGGGG + Intergenic
1049476051 8:142797457-142797479 TCCTCTCTCTCCAGGGCCCGGGG + Intergenic
1049599945 8:143503085-143503107 CCACCTCTCCCCAGAAGCTGAGG - Intronic
1049607495 8:143536510-143536532 CCCTTCCTCACCAGGACCCGAGG + Intronic
1051811637 9:21055931-21055953 CCCTCTCACCCAAGAATCCTTGG + Intergenic
1053462634 9:38282357-38282379 CCCCCTCTTCCCAGAAGCCGTGG - Intergenic
1054993209 9:71354174-71354196 CCCTCACTCCCCAAAACTCTGGG + Intronic
1055766787 9:79672115-79672137 CCCTCTCTCCCCAGGACAGGAGG - Intronic
1056011628 9:82337089-82337111 CCCTCTCTCCCCCTAGCCCCAGG - Intergenic
1056749117 9:89333577-89333599 CCCTCTCTCACGAGAACACCTGG - Intronic
1057251152 9:93503564-93503586 CCCTCCCTCCCCACAACCTCTGG - Intronic
1057366960 9:94431839-94431861 CACTCTCTCCTCTGAACCAGTGG - Intronic
1057656373 9:96956230-96956252 CACTCTCTCCTCTGAACCAGTGG + Intronic
1058690812 9:107519117-107519139 CTATCCCTCCCCAGAACCCCCGG + Intergenic
1058693251 9:107536845-107536867 TCCTCTCTCCCCAGCTCCCAGGG - Intergenic
1059868554 9:118545326-118545348 CTCTCTTTTCCCAGAACCCCAGG + Intergenic
1060389587 9:123267595-123267617 CCCTATCACCCCAGAAGCCTAGG + Intronic
1060392433 9:123289328-123289350 CCCTCTCTCCCCACTGCCCCTGG + Intergenic
1060484933 9:124040959-124040981 CCCCCTCTCCCCAGTCCCCAGGG - Intergenic
1060819091 9:126651340-126651362 CTATCTGTCCCCAGACCCCGAGG + Intronic
1061281244 9:129598588-129598610 CCCTCTCACCCCAGAGGCAGTGG - Intergenic
1061419974 9:130467827-130467849 CCCTCTCTATCCAGGACTCGAGG - Intronic
1061420507 9:130470853-130470875 CGGTCACTCCCAAGAACCCGTGG + Exonic
1061828199 9:133274885-133274907 CCCGCTCTCACCAGGACCCGGGG + Intronic
1061924973 9:133801522-133801544 CCCTCTCTCACCTGACCCAGGGG + Intronic
1062110382 9:134779009-134779031 CCCTCCCTCTCCAGGACCTGGGG + Intronic
1062623553 9:137433250-137433272 GCCTCTTACCCCAGCACCCGCGG - Exonic
1188013776 X:25085518-25085540 CCCTCTCTCCCCTGAAACTAAGG - Intergenic
1190339680 X:49286575-49286597 CCCTCTGTACCCAGAACCACAGG - Exonic
1190534519 X:51412318-51412340 CCGTCTGTCCCCAGAACCTAGGG + Intergenic
1192308837 X:69991863-69991885 CCCTCTCTCCCCAGATGCAGTGG - Intronic
1195392868 X:104381310-104381332 CCCTCTCTCCCTCTAACCTGTGG + Intergenic
1195865111 X:109424402-109424424 ACCTCTCTCCCCCTAACCCCTGG - Intronic
1196800173 X:119535742-119535764 TTCTCTCTCCCCACAACCCCTGG - Intergenic
1197192063 X:123658683-123658705 CCCTCTCTCCTCACAACCCCTGG - Intronic
1199635389 X:149807871-149807893 CCCACACTCCCCAGAACACAAGG + Intergenic
1200114753 X:153765172-153765194 CCCTTTGTCCCCGGATCCCGGGG + Intronic
1200147337 X:153933226-153933248 CCCTCCCTCTCCTTAACCCGTGG - Intronic
1201188977 Y:11430361-11430383 CCCTCTCCCCCCAGTCCCCGTGG + Intergenic