ID: 902601846

View in Genome Browser
Species Human (GRCh38)
Location 1:17545262-17545284
Sequence CCTGTTTACCAGCACACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 16, 3: 69, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902601846 Original CRISPR CCTGTTTACCAGCACACCAC TGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901755483 1:11439028-11439050 GCTGTTTTCCAACACACCCCAGG - Intergenic
902601846 1:17545262-17545284 CCTGTTTACCAGCACACCACTGG + Intronic
904374159 1:30069281-30069303 CCTTTCTACCACCAAACCACAGG - Intergenic
905243739 1:36597892-36597914 CCGATTTACCAGCACACTACTGG + Intergenic
906026997 1:42682496-42682518 CCTAGTTACCATCACACCCCGGG + Exonic
907773017 1:57484863-57484885 CTTGTTCACCAGCACCACACAGG - Intronic
908807816 1:67949015-67949037 CCTCTCAACCAGCACACCACTGG + Intergenic
909186526 1:72493549-72493571 CCTTTCTACAAGCACACCAAAGG - Intergenic
909555694 1:76951314-76951336 AATATTTACCAGCACAACACTGG - Intronic
911444507 1:97973645-97973667 CCAGCTTACCAGAACACCACTGG - Intergenic
912963229 1:114214413-114214435 ACAGTTTACCAGCACCCCACTGG - Intergenic
913296202 1:117323047-117323069 CCAGTTAACCAGCACACCGCTGG + Intergenic
914689876 1:150016358-150016380 AATATTTACTAGCACACCACTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915586018 1:156844394-156844416 CCTGGTCCCCAGCCCACCACAGG - Intronic
916341970 1:163746128-163746150 AATATTTACCAGCACACCACTGG - Intergenic
917479320 1:175397423-175397445 GGTATTTAACAGCACACCACTGG + Intronic
918108596 1:181435191-181435213 AATGTTTACCAGCACACCACTGG + Intronic
918725432 1:187915923-187915945 CCTTTTTACCAGGTCAACACTGG - Intergenic
918811145 1:189122702-189122724 CCTGGTTCCCAGCAGGCCACAGG - Intergenic
920063692 1:203248729-203248751 CCTGTTTAGCTCCACCCCACAGG + Intronic
920700260 1:208212692-208212714 AATATTTACCAGCACACCACTGG + Intronic
921081727 1:211744759-211744781 AACATTTACCAGCACACCACTGG + Exonic
922058182 1:222062123-222062145 AATATTTACCAGCACACCACTGG - Intergenic
922241225 1:223756565-223756587 CCAGTTTCCCAGCACACCCCTGG + Intronic
922537139 1:226389802-226389824 CTTGTTAACAAGCACACCAGGGG - Intronic
923336098 1:232971458-232971480 GCTGTTTACCACCACACTCCAGG - Intronic
923465468 1:234244351-234244373 CCTTTCTACCAGCACCCCACCGG - Intronic
923689497 1:236178473-236178495 CGTCTTTACCAGCACAGCACAGG - Exonic
1064104456 10:12489522-12489544 AACATTTACCAGCACACCACTGG - Intronic
1064119962 10:12610010-12610032 AACGTTTACCAGCACACTACTGG - Intronic
1065899083 10:30188764-30188786 CACGTTTACCAGCACGTCACTGG + Intergenic
1066373134 10:34834453-34834475 CCTGTTTCCCACAACCCCACAGG - Intergenic
1070325823 10:75388227-75388249 ACCATTTACCAGCTCACCACTGG - Intergenic
1070766587 10:79060137-79060159 AACATTTACCAGCACACCACTGG + Intergenic
1071007515 10:80899896-80899918 TTTATTTGCCAGCACACCACTGG - Intergenic
1074935522 10:118175984-118176006 TCAGTTTACCAGCACACCATTGG - Intergenic
1075449669 10:122541326-122541348 GCTGTTTACCAGCATATCCCTGG - Intergenic
1075532147 10:123238723-123238745 GCAGTTTACCAGCACACCAGTGG + Intergenic
1075899922 10:126033269-126033291 CCAGTTTGCCAGCATACCATTGG + Intronic
1076133099 10:128027391-128027413 CCTACTGACCAGCACCCCACAGG + Intronic
1076341805 10:129754461-129754483 CCTGTTGTCCCCCACACCACAGG + Intronic
1078120617 11:8505103-8505125 AATATTTACCAACACACCACTGG + Intronic
1078361813 11:10675071-10675093 GCTGTTTCCCAGCCCAGCACTGG - Intronic
1078882858 11:15469779-15469801 AATGTTTACCAGCAAACTACTGG - Intergenic
1081909840 11:46693912-46693934 GCCATTTACCAGCACACCACTGG + Intronic
1084090781 11:66878309-66878331 CCTGTTTACCCACAAACCACGGG - Intronic
1085206431 11:74735635-74735657 AACATTTACCAGCACACCACTGG - Intergenic
1085410871 11:76289595-76289617 TACATTTACCAGCACACCACTGG - Intergenic
1085516463 11:77114774-77114796 GCAGTTTACCAGCACAGCACAGG - Intronic
1085806774 11:79643628-79643650 TCTGCGTACCTGCACACCACTGG - Intergenic
1086949323 11:92875547-92875569 CTGGTTTACCAGCACACCCCTGG - Intronic
1087020804 11:93601144-93601166 GCAGTTTAGCAGCACACCACAGG + Intergenic
1087311720 11:96551504-96551526 AATGTTTACCAGCACACCACTGG + Intergenic
1088965531 11:114717246-114717268 ACTGTTCATCTGCACACCACTGG - Intergenic
1089411380 11:118245777-118245799 GCTGTTTACCAAAAGACCACTGG - Intronic
1090823476 11:130366156-130366178 GTTATTTACCAACACACCACTGG + Intergenic
1091143493 11:133256920-133256942 CTGGTCTACCAGCCCACCACTGG - Intronic
1091809967 12:3389019-3389041 CCTGCTTGCCAGCACCACACTGG + Intronic
1092027204 12:5251631-5251653 AATATTTACCAGCCCACCACTGG + Intergenic
1093076507 12:14764422-14764444 CCTGTATCCCAGCACTCAACAGG + Intergenic
1093201462 12:16191883-16191905 CCTGTTGACGAGCACCCCACAGG - Intronic
1095493702 12:42762549-42762571 TCATTTTACCAGCACACCACTGG + Intergenic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1097938103 12:65276060-65276082 AATGTTTACCAGCACACCACTGG + Intergenic
1099666056 12:85630892-85630914 CCAATTTGCTAGCACACCACTGG - Intergenic
1101467921 12:104966898-104966920 CCAGTTTAGCGGTACACCACTGG - Intergenic
1102962796 12:117104208-117104230 CTTGTTTACCAGCTCACCACTGG - Intergenic
1105324226 13:19355605-19355627 CTGGCTTACCAGCACACCCCCGG - Intergenic
1105806375 13:23953789-23953811 CCTGTTCCCCCGCACTCCACCGG + Intergenic
1105869038 13:24487799-24487821 CTGGCTTACCAGCACACCCCCGG + Intronic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1110368350 13:74712951-74712973 CTTGTCTACCAGCACATCACTGG - Intergenic
1111880097 13:93945100-93945122 AACATTTACCAGCACACCACTGG - Intronic
1113101288 13:106722146-106722168 CCTTTCCACCAGCCCACCACAGG - Intergenic
1116923022 14:50601413-50601435 ACATTTTGCCAGCACACCACTGG - Intronic
1116923555 14:50608496-50608518 CCAGTTTATCAGCACATCACTGG + Intronic
1117305935 14:54473119-54473141 CCAGATTACCAGCTCATCACAGG - Intergenic
1121312792 14:92944212-92944234 CCTGTTCTCCTGCACCCCACAGG - Intronic
1121346621 14:93140946-93140968 CCTGGTTCTCAGCCCACCACCGG - Intergenic
1122024561 14:98866400-98866422 CCTGTGTCCCATCCCACCACAGG + Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1126789944 15:52211853-52211875 CATGTTCACCACCACGCCACGGG + Exonic
1127855830 15:62953102-62953124 CCTATTTACCATCACAACCCAGG + Intergenic
1129069493 15:72938921-72938943 CCTGGTTGCCAGCACAAAACTGG - Intergenic
1129969481 15:79765191-79765213 CACGTTAACCAGCATACCACTGG - Intergenic
1130038225 15:80380817-80380839 AAAATTTACCAGCACACCACTGG + Intronic
1130811979 15:87389355-87389377 CCAGGTAACCAGCACACCAATGG - Intergenic
1131992775 15:98106720-98106742 CCAGTTTGCCAGCAAACCACAGG - Intergenic
1132098154 15:99003753-99003775 CCAGTTTGCCAGCAAACCACAGG + Intronic
1133112686 16:3558005-3558027 CCAGTTTACCAGTACACCACTGG - Intronic
1133312985 16:4862932-4862954 CCTGGTCACCAGCTCCCCACTGG - Intronic
1135416391 16:22271298-22271320 AATGTTCCCCAGCACACCACTGG - Intronic
1136013235 16:27378408-27378430 TTGGCTTACCAGCACACCACTGG + Intergenic
1139028694 16:62852408-62852430 CCAGTTTATTAGCACACCACTGG - Intergenic
1140406922 16:74717377-74717399 CTGGTTTTCCAGCACATCACTGG - Intronic
1140651658 16:77094733-77094755 GCCATTTTCCAGCACACCACTGG - Intergenic
1140778179 16:78269629-78269651 CCTGTTTGCCAGCTCACTAATGG + Intronic
1140835011 16:78785423-78785445 ATCATTTACCAGCACACCACTGG - Intronic
1144669675 17:17125903-17125925 CATGGTTACCACCACACCAGGGG - Intronic
1145011241 17:19369480-19369502 CTACTTTACCAGCACATCACTGG + Intronic
1145788006 17:27606567-27606589 CACATTTACCAGCACACCACTGG - Intronic
1145894111 17:28442258-28442280 AATGTTTATCAGCACACCATTGG + Intergenic
1147401877 17:40185180-40185202 AATATTTACCAGTACACCACTGG - Intronic
1148448174 17:47754027-47754049 CTGGTTTACTACCACACCACTGG + Intergenic
1148984134 17:51606812-51606834 CTGGTCTACCAGCACACCAATGG - Intergenic
1150480594 17:65506021-65506043 TTGGTTTACCAGCATACCACTGG - Intergenic
1150863343 17:68823697-68823719 CAGGTTTACCAGCACACTCCTGG + Intergenic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1152505051 17:80743894-80743916 CCTGGTTACGAGCACAGCCCTGG + Intronic
1152505057 17:80743930-80743952 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505068 17:80744002-80744024 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505071 17:80744020-80744042 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505074 17:80744038-80744060 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505079 17:80744074-80744096 CCTGGTTACGAGCACAGCCCTGG + Intronic
1152505082 17:80744092-80744114 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505085 17:80744110-80744132 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505090 17:80744146-80744168 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505113 17:80744308-80744330 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505121 17:80744362-80744384 CCTGGTTACGAGCACAGCCCTGG + Intronic
1152505134 17:80744452-80744474 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505137 17:80744470-80744492 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505142 17:80744506-80744528 CCTGGTTACGAGCACAGCCCTGG + Intronic
1152505150 17:80744560-80744582 CCTGGTTACGAGCACAGCCCTGG + Intronic
1152505155 17:80744596-80744618 CCTGGTTACTAGCACAGCCCTGG + Intronic
1152505163 17:80744650-80744672 CCTGGTTACGAGCACAGCCCTGG + Intronic
1152505191 17:80744866-80744888 CCTGGTTACGAGCACAGCCCTGG + Intronic
1153109592 18:1568848-1568870 ACCACTTACCAGCACACCACTGG + Intergenic
1153498687 18:5725478-5725500 CCTATTTATCAACACACCATTGG + Intergenic
1157291710 18:46414286-46414308 GCTGTTTACCAACACAGCATAGG - Intronic
1158448528 18:57542506-57542528 AACGTTTATCAGCACACCACTGG + Intergenic
1159605906 18:70474628-70474650 CCAGTTTACCAGCACAACACTGG - Intergenic
1160012374 18:75115860-75115882 CCTGGCTCCCAGCAGACCACCGG + Intergenic
1161257578 19:3318041-3318063 CATGTTAGCCAGCACACCACAGG + Intergenic
1161841923 19:6687118-6687140 AACTTTTACCAGCACACCACGGG - Intronic
1164665988 19:30037302-30037324 CCTGCTCACCAGTACACCAGGGG + Intergenic
1165242229 19:34478050-34478072 GACATTTACCAGCACACCACTGG + Intergenic
1165467506 19:35983734-35983756 CCTGGTTACCAGGACCCCAAGGG - Intergenic
1167171628 19:47836221-47836243 CCTGTTTCCCATCCCACCCCAGG + Exonic
925881144 2:8353536-8353558 CCAGTTTACTATCATACCACTGG - Intergenic
926136234 2:10338587-10338609 CCTGGTCACCAACACAGCACTGG - Intronic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
930224845 2:48781519-48781541 CTGGTTTACCAGCACAGCACTGG - Intergenic
932087988 2:68779146-68779168 ACTATCTACCAGCACACCGCTGG - Intronic
932320066 2:70815492-70815514 CTTTTTACCCAGCACACCACTGG + Intronic
936049054 2:109209330-109209352 AACGTTTGCCAGCACACCACTGG - Intronic
936454611 2:112662801-112662823 TCTGTTTGCCAGAATACCACTGG + Intronic
938552251 2:132393249-132393271 TCAGTTTACCAGCACACCGCTGG + Intergenic
944358339 2:198820630-198820652 CCAGTTTACCAGCACACCCCTGG - Intergenic
946475228 2:220000589-220000611 CCTGTGTACCTCCACACCACTGG + Intergenic
947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG + Intergenic
1170592990 20:17785329-17785351 AATATTTACCAGCATACCACTGG + Intergenic
1170729198 20:18957639-18957661 AATATTTGCCAGCACACCACTGG - Intergenic
1171424397 20:25040556-25040578 GCTGTTATCCAGCACAGCACTGG - Intronic
1173048378 20:39534955-39534977 AATGTTTACCAGAACACCACTGG + Intergenic
1175220452 20:57413784-57413806 CCTCTTTACCTTCACACCAGTGG + Intergenic
1175311573 20:58015371-58015393 CTGGTTCACCAGCACACCCCTGG - Intergenic
1176246681 20:64100749-64100771 CCTGTTGAGCAGCACAGGACAGG - Intergenic
1176264426 20:64201692-64201714 CCTGTTTACCAGCACACGCTGGG + Intronic
1176983414 21:15408767-15408789 CATGTTTCCCAGCACCCCATAGG - Intergenic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
1183412363 22:37662410-37662432 CATGTTTCTCAGCGCACCACTGG - Intronic
950311902 3:11966187-11966209 TCAGTTTACCAGCAAATCACAGG - Intergenic
955532068 3:59884401-59884423 AATATTTACCAGCACACCACTGG + Intronic
957767112 3:84639486-84639508 CATTTTTACCAGCACCTCACTGG - Intergenic
960645267 3:119873485-119873507 CCTGTTTACCTGCCCTCCAAGGG + Intronic
960722950 3:120642485-120642507 AATATTTACCAGCACACCACTGG - Intronic
960973968 3:123157855-123157877 CCTGCTTGCCAGCCCACCACAGG - Intronic
961073298 3:123958137-123958159 CTTGTATAACATCACACCACTGG + Intronic
962146477 3:132845027-132845049 AATATTTACCGGCACACCACTGG + Intergenic
962897795 3:139731547-139731569 ACTGTGTGCCAGCACACTACTGG - Intergenic
964174432 3:153808747-153808769 CTTATTTACCAGCACACTACTGG + Intergenic
965748362 3:171949700-171949722 AACATTTACCAGCACACCACTGG - Intergenic
965836979 3:172863573-172863595 CCAGTTTTCCAGCACACCTTTGG - Intergenic
965850537 3:173017504-173017526 CCAGGTTACCAGCATACCATTGG - Intronic
966274389 3:178147268-178147290 AATGTTTACCAGCACATCATTGG + Intergenic
966515669 3:180818340-180818362 AATATTTACCAGCACACAACTGG + Intronic
969453104 4:7286127-7286149 ACTGTTTACCAGCTCATCAGGGG - Intronic
971033551 4:22667580-22667602 GCTGGTTACCAGCACAGCACTGG + Intergenic
974017296 4:56659221-56659243 CCTTTTGGCCAGCTCACCACAGG - Intronic
975582215 4:75917381-75917403 CTGGTTTACTAGCAGACCACTGG + Intronic
976749373 4:88438829-88438851 GATATTTACCAGCACACCAATGG + Intronic
977097437 4:92764157-92764179 ACCGTTCAGCAGCACACCACTGG + Intronic
978718606 4:111876819-111876841 ACCATTTACCAGCATACCACTGG - Intergenic
978819712 4:112951658-112951680 AATGTTTACTAGCACACCACTGG - Intronic
979358768 4:119736634-119736656 AACGTTTACCAGCACACCACTGG - Intergenic
981015008 4:139964821-139964843 GCTATTTGCCAGCATACCACTGG - Intronic
981354230 4:143768695-143768717 TGAGTTTATCAGCACACCACCGG - Intergenic
981887742 4:149697566-149697588 CAAATTTACCAGCACACCATTGG + Intergenic
982220483 4:153120969-153120991 AACATTTACCAGCACACCACTGG + Intergenic
982596433 4:157391093-157391115 CCAATTTACCAGCACACCATTGG - Intergenic
984133683 4:175910006-175910028 TCAGCTTACTAGCACACCACTGG - Intronic
984711758 4:182891160-182891182 CCTGTGCACCAGGCCACCACAGG + Exonic
986197952 5:5555226-5555248 CCTGATTAAGAGCACACAACAGG - Intergenic
986787247 5:11125624-11125646 GCGGGTTACCAGCACCCCACAGG + Intronic
989452314 5:41601043-41601065 AGCATTTACCAGCACACCACTGG + Intergenic
990494826 5:56337043-56337065 AATATTTACCAGCACACCACTGG + Intergenic
992023775 5:72651093-72651115 CCTGTTTACCAGAAGACAATGGG - Intergenic
992486814 5:77205079-77205101 CCTGTTAACAAGCACCCCACAGG - Intergenic
993520107 5:88889672-88889694 CCTCTTTACCAACAAACCACCGG - Intronic
996464671 5:123785958-123785980 CTTCTTGACAAGCACACCACTGG + Intergenic
996601924 5:125274094-125274116 CCCATTTACCAGCATACCACCGG - Intergenic
997528297 5:134567359-134567381 CCTGTTTCCCAGCACACAGCTGG - Intronic
997890148 5:137668903-137668925 AACATTTACCAGCACACCACTGG + Intronic
997911159 5:137874930-137874952 GACATTTACCAGCACACCACTGG - Intronic
998080660 5:139272896-139272918 CCTGCCTACCAGCCCAGCACTGG + Intronic
1000304827 5:159985672-159985694 GCTATTTACCAGCACACCAAAGG + Intergenic
1000882197 5:166711209-166711231 CCTGCTCCCCAGCACAACACTGG + Intergenic
1002082203 5:176743689-176743711 CCTGTTTACCAGCACGACAACGG + Intergenic
1002380764 5:178827827-178827849 AGCATTTACCAGCACACCACTGG + Intergenic
1003692965 6:8372908-8372930 GGTATTTACCAGCACACCACTGG - Intergenic
1006406569 6:33849019-33849041 CCTGTCTACCTGCCCACCTCTGG - Intergenic
1006784834 6:36659355-36659377 CTGGTTTACCAGCACACTACTGG - Intergenic
1006841905 6:37033862-37033884 CATTTTTACCAGCACCTCACTGG + Intergenic
1007483432 6:42164811-42164833 AACATTTACCAGCACACCACAGG + Intronic
1008008033 6:46433271-46433293 GCTGCTAACCAGCATACCACTGG - Intronic
1008428538 6:51387790-51387812 CCTGTTTCCAAGGAGACCACAGG + Intergenic
1010072252 6:71757166-71757188 ATTATTTACCAGCACACCACTGG - Intergenic
1011258356 6:85447027-85447049 AACATTTACCAGCACACCACTGG - Intergenic
1012777947 6:103521896-103521918 CCTGGTTTCCAGCACAAAACTGG + Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1013830751 6:114269725-114269747 TCTGGTTATCAGCACACCCCAGG + Intronic
1015314492 6:131803246-131803268 TCTTTTTACCCCCACACCACTGG - Intergenic
1015403576 6:132813736-132813758 CCGCTTTACCAACACACCGCAGG + Intergenic
1015622057 6:135141641-135141663 CTGGTTAAACAGCACACCACTGG - Intergenic
1015953839 6:138580464-138580486 CCAGTTTACTAACACACCACTGG - Intronic
1016322915 6:142866950-142866972 CCTGTTCACCAGTTTACCACAGG - Intronic
1017330709 6:153195139-153195161 AACATTTACCAGCACACCACTGG - Intergenic
1018102537 6:160453944-160453966 CCTGGCCACCAGCACACCCCAGG + Intergenic
1018133251 6:160752514-160752536 CCTGGCCACCAGCACACCCCAGG - Intronic
1019739596 7:2666054-2666076 CCTTTTGACCAGCAGAGCACAGG + Intergenic
1020672239 7:11130834-11130856 CCTCTCTACCATCAAACCACTGG + Intronic
1020979235 7:15046908-15046930 GCTGCTTACCAGCAGACCAAAGG + Intergenic
1021678789 7:23107918-23107940 CCTGTTTAACATCATAACACAGG + Intronic
1022816152 7:33916473-33916495 CCTGCTTTCCAGCAAACCACAGG + Intronic
1026957602 7:74387564-74387586 CTTGTTCACCAGAACACCAGTGG + Intronic
1028095345 7:86753787-86753809 AATATTTACCAGCACACCACTGG - Intronic
1029093012 7:98063230-98063252 AACATTTACCAGCACACCACTGG + Intergenic
1030665480 7:112273201-112273223 CCTGAGTTCCAGCAAACCACGGG - Intronic
1031438867 7:121767552-121767574 CCTGTTTTTCTGCACACCAACGG + Intergenic
1032344075 7:131103901-131103923 CTTGTTTATCTGCACATCACTGG - Intergenic
1032748524 7:134812550-134812572 TCCATTTACCAGCGCACCACTGG + Intronic
1033451429 7:141465422-141465444 CCAGTTTGCCACCAAACCACAGG + Intronic
1033538561 7:142334727-142334749 CCAGTTTACAAGGACATCACTGG + Intergenic
1033540960 7:142355689-142355711 TCAGTGTACCAGCACATCACTGG + Intergenic
1033552184 7:142457635-142457657 CCAGTTTATCAGCACATCCCTGG + Intergenic
1033554453 7:142476572-142476594 CCAGTTTATCAGCACATCACTGG + Intergenic
1034133568 7:148743446-148743468 CCAATTTACCAGTATACCACTGG + Intronic
1034429355 7:151033536-151033558 CCTGCTGACCAGCACACCCATGG - Intronic
1035304929 7:157925819-157925841 TCTGTTTACCATCACGTCACTGG - Intronic
1036685435 8:10906274-10906296 AACATTTACCAGCACACCACCGG + Intronic
1037552422 8:19987635-19987657 TGTATTTACCAGCACAACACTGG + Intergenic
1037922522 8:22817431-22817453 CTGGGTTACCAGCATACCACTGG + Intronic
1039274100 8:35915772-35915794 CCTTTTTTCCAGCAAACCCCGGG - Intergenic
1040413160 8:47175606-47175628 CACATTTACCAGCACACCACTGG + Intergenic
1040580171 8:48691367-48691389 TACATTTACCAGCACACCACTGG - Intergenic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1042952387 8:74214461-74214483 CCCTTTAACCAGCACACAACTGG - Intergenic
1043885761 8:85598095-85598117 AACATTTACCAGCACACCACTGG - Intergenic
1044400386 8:91763995-91764017 CAGGTTTACCAGCACAACATTGG + Intergenic
1047035182 8:120930421-120930443 TTTGTTTACCAGCACACCACTGG + Intergenic
1047123538 8:121933191-121933213 AATATTTACCAGCACACCACTGG + Intergenic
1047360143 8:124161581-124161603 CCTCTGTACCTGCACACCCCAGG - Intergenic
1048316968 8:133369772-133369794 CCTCTTTACCCCCACACCACAGG - Intergenic
1048539808 8:135332630-135332652 CCTCTTTAGCAGCCCACCAGTGG + Intergenic
1049130188 8:140832623-140832645 CCTGTCCACCAGCAAACCTCAGG - Intronic
1049263116 8:141650439-141650461 CCAGTTCACCAGCACACAACTGG - Intergenic
1049698005 8:143993118-143993140 CCTGTCTGCCAGCCCACCCCAGG + Exonic
1051522220 9:18001850-18001872 TCTCTTTACCAGCTCACCACTGG - Intergenic
1053181277 9:35972366-35972388 CCTAGTTACCATCACACCCCGGG - Intergenic
1053378972 9:37633533-37633555 CCTAGTTTACAGCACACCACTGG - Intronic
1055401233 9:75926318-75926340 ACTATTTATCAGCACATCACTGG - Intronic
1056597408 9:88019178-88019200 CCTGTTGACCAGGGCATCACTGG - Intergenic
1056623399 9:88234231-88234253 CCTGTGTTCCAGCACACTGCTGG - Intergenic
1056721691 9:89077479-89077501 AACATTTACCAGCACACCACTGG + Intronic
1057387684 9:94618918-94618940 CCAGTTTACCAGCACATCACTGG + Intronic
1057710021 9:97431870-97431892 CCTGTTGACCAGCCCTCCAGTGG + Intronic
1059731451 9:117061012-117061034 TCAGTTTACCAGCATACCACTGG + Intronic
1060398385 9:123332534-123332556 GCAGTTTACCAGCACACCACTGG - Intergenic
1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG + Intergenic
1061055444 9:128220045-128220067 CTTGTTCTCCAGCACATCACGGG - Exonic
1185449919 X:276463-276485 CCTGATTCCCAGCCCACAACAGG - Intronic
1187199505 X:17121294-17121316 AAGGTTTACCAACACACCACTGG - Intronic
1187592492 X:20733612-20733634 CTGGTTTAAAAGCACACCACTGG + Intergenic
1187773925 X:22733400-22733422 AATATTTACCAGCACACCACTGG + Intergenic
1188022068 X:25170036-25170058 CCAATTTACCAGCGCACCACTGG - Intergenic
1189277595 X:39798001-39798023 GTTGTTCACCAGCTCACCACAGG - Intergenic
1189969212 X:46400754-46400776 AACATTTACCAGCACACCACTGG - Intergenic
1190822274 X:53985030-53985052 CCTGCTTCCCAGCGCACCCCAGG - Exonic
1191636051 X:63378278-63378300 CAGGTTTACCAGCACACCACTGG - Intergenic
1195507707 X:105677687-105677709 GCTGTTTAGTAGTACACCACTGG + Intronic
1197074088 X:122334979-122335001 CTGGTTTACCAGCACAGTACTGG - Intergenic
1197163236 X:123346931-123346953 CCAGTTTTCCAGCATACCACTGG - Intronic
1197651613 X:129071618-129071640 CCAATTTACCAGCACACCACAGG + Intergenic
1197938336 X:131763205-131763227 CCTGTTGTCCAGCAAACAACTGG - Intergenic
1198119891 X:133581450-133581472 AATATTTACCAGCTCACCACTGG - Intronic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic
1199544778 X:148996294-148996316 ACATTTTACCAGCACACCACTGG - Exonic
1200207488 X:154327861-154327883 CCTGTTTACCATTAAACCTCTGG + Exonic