ID: 902605555

View in Genome Browser
Species Human (GRCh38)
Location 1:17567176-17567198
Sequence AGGTGCCCAAAAATGCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902605555_902605556 -9 Left 902605555 1:17567176-17567198 CCAGCTAGCATTTTTGGGCACCT 0: 1
1: 0
2: 1
3: 10
4: 94
Right 902605556 1:17567190-17567212 TGGGCACCTGTTATGCTTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902605555 Original CRISPR AGGTGCCCAAAAATGCTAGC TGG (reversed) Intronic