ID: 902605555

View in Genome Browser
Species Human (GRCh38)
Location 1:17567176-17567198
Sequence AGGTGCCCAAAAATGCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902605555_902605556 -9 Left 902605555 1:17567176-17567198 CCAGCTAGCATTTTTGGGCACCT 0: 1
1: 0
2: 1
3: 10
4: 94
Right 902605556 1:17567190-17567212 TGGGCACCTGTTATGCTTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902605555 Original CRISPR AGGTGCCCAAAAATGCTAGC TGG (reversed) Intronic
900360926 1:2288746-2288768 ATGACCCCAAAAATGCCAGCAGG - Intronic
900544091 1:3218859-3218881 ACGTCTCCAAAAATGCCAGCTGG - Intronic
902605555 1:17567176-17567198 AGGTGCCCAAAAATGCTAGCTGG - Intronic
903524475 1:23982690-23982712 AAGTGCCCTAAAATGTTAACAGG + Intergenic
906159343 1:43636143-43636165 AAGTGCTTAATAATGCTAGCAGG - Intergenic
906806906 1:48787899-48787921 ATGTGGCCAAATATGTTAGCAGG - Intronic
911110422 1:94178262-94178284 AGCTGCACAAAAATACTAGGGGG + Intronic
911385704 1:97172339-97172361 ACGAGCCCAAAAATGCTAAGAGG + Intronic
912590802 1:110817839-110817861 AGGTGCCCAACAGTGGTAACTGG - Intergenic
913085052 1:115429204-115429226 AGGTGCTCAAAGATGCCATCAGG + Intergenic
915937563 1:160098326-160098348 AGGAGCCCCGAAATGCTAGGGGG + Intronic
917588881 1:176457077-176457099 TGGAGCCCAAAAGTGCTTGCAGG - Intergenic
917598824 1:176555657-176555679 AGGGGCACAAAAATGCAAGCTGG - Exonic
920282886 1:204857635-204857657 GGGTGCCCCAAAATGTCAGCTGG + Intronic
922708118 1:227802114-227802136 AAGTACCCAAAAAAGTTAGCTGG - Intergenic
1063927543 10:10995353-10995375 AGGTGCTCAAAAATACTGGCTGG - Intergenic
1069572573 10:69503346-69503368 AGGAGCACAAGAATGCTGGCTGG - Intronic
1069684969 10:70312125-70312147 AGGTAACCAGAATTGCTAGCTGG + Intronic
1070049905 10:72878277-72878299 AAATGCCAAAAAATCCTAGCTGG - Intronic
1072036343 10:91566283-91566305 AGCTGCCCACGCATGCTAGCCGG + Intergenic
1073540489 10:104313301-104313323 AGGTGCTCAAAAATGCTACCCGG - Exonic
1077759449 11:5076342-5076364 AGGTGCCCAAAGATTTGAGCCGG + Intergenic
1081698025 11:45131870-45131892 AGTTGCTCAAAAATGTTATCCGG + Intronic
1082936161 11:58658972-58658994 AGGTGACCAAATATGCTGTCTGG + Intronic
1088107648 11:106224408-106224430 AGGGGGCCAAAAATGATAGAGGG + Intergenic
1088952917 11:114588919-114588941 AGGTTCTCCAAAATGCTATCTGG - Intronic
1091791357 12:3273901-3273923 ATATGCCCAAAGATGCCAGCTGG - Intronic
1097465129 12:59913361-59913383 GGTTGCCAAAAAGTGCTAGCAGG + Intergenic
1104483152 12:129126383-129126405 AGGGGCCAAAAAATGCAAACAGG - Intronic
1112727412 13:102320384-102320406 AGGTGCCCAGAAGTGTTTGCAGG - Intronic
1113124719 13:106964583-106964605 AGGTCCCCAAACCTACTAGCAGG - Intergenic
1113408611 13:110064280-110064302 AGGTGCCCCAAAATTCGGGCAGG + Intergenic
1115416357 14:33139273-33139295 ATGTGCACATAGATGCTAGCTGG - Intronic
1124596558 15:31096476-31096498 AGGTGCCCCAAGATCCTTGCTGG - Intronic
1127360984 15:58245107-58245129 AGGTGCCCAAGAGTTCCAGCAGG + Intronic
1133236218 16:4388577-4388599 AGGTGCCCATCCATGCCAGCCGG + Exonic
1136734879 16:32457315-32457337 AGGTATCCAAAAGTGTTAGCAGG - Intergenic
1137440594 16:48495784-48495806 AGCTGCCAAAAACTGCCAGCAGG - Intergenic
1137896185 16:52215552-52215574 ATGTGCCCAAAATTTCTAGAAGG + Intergenic
1203018199 16_KI270728v1_random:372278-372300 AGGTATCCAAAAGTGTTAGCAGG + Intergenic
1203036534 16_KI270728v1_random:645436-645458 AGGTATCCAAAAGTGTTAGCAGG + Intergenic
1146453217 17:32991027-32991049 GGGTGCCCAAGGATGGTAGCAGG - Intronic
1159025010 18:63175702-63175724 AGGTGCCCAAAAATACTCTCAGG + Intronic
1164682993 19:30148372-30148394 AGGTGGCCAAGAAGGCTGGCTGG - Intergenic
1166599813 19:44083970-44083992 AGGTGCCCAAGCATGCTGTCTGG - Intronic
1167525957 19:49983914-49983936 AGGCGCACAAAAATGCTCTCTGG - Intronic
926663718 2:15496681-15496703 AGGTGCAAAAAGAAGCTAGCAGG + Intronic
927137194 2:20105574-20105596 CGGCTCCAAAAAATGCTAGCAGG - Intergenic
931605558 2:64049085-64049107 AGGAGGCCAAAAATGGGAGCAGG - Intergenic
931701894 2:64916060-64916082 AGGTGCCCAAAAAGCTGAGCTGG - Intergenic
931815520 2:65896940-65896962 AGGTGCTCAAAAATGTTAACTGG + Intergenic
932099577 2:68885576-68885598 AGATGCCCATAAATGCTATCGGG - Intergenic
932735911 2:74254517-74254539 AGGTGCTCAAATGTGCTGGCTGG + Intronic
934310847 2:91862131-91862153 AGGTATCCAAAAGTGTTAGCAGG + Intergenic
937300108 2:120833747-120833769 AGCTCCCCAAACCTGCTAGCTGG + Intronic
948223304 2:236290215-236290237 AGGTTCCCAAACATGCAGGCTGG - Intergenic
1173376247 20:42486085-42486107 AGGTGCTCAACAAGGCCAGCAGG - Intronic
1176194158 20:63829629-63829651 AGGTGCCCAAAAGTGCCAGTTGG + Intronic
1178102688 21:29286806-29286828 AGGTGCACAAAAATGGTAAAAGG + Intronic
1179114853 21:38480953-38480975 ATTTGCCCACAAATGTTAGCAGG - Intronic
1180065765 21:45411432-45411454 AGGTGCTCAAAAATGCACACAGG - Intronic
1180537603 22:16408061-16408083 AGGTATCCAAAAGTGTTAGCAGG + Intergenic
1180750224 22:18119368-18119390 CGGTGCAGAAAAATGCTACCAGG + Intronic
1185115968 22:48938377-48938399 AGGAGCCCAGGAATGGTAGCAGG + Intergenic
949674812 3:6441248-6441270 AGGTGGCCATAAATACTTGCTGG + Intergenic
952300323 3:32099131-32099153 AGTTGCCCAAGACTGATAGCTGG + Intergenic
954860779 3:53688818-53688840 AGAGGCCCAAAACTGCCAGCAGG - Intronic
955661215 3:61301341-61301363 AGGTGAAAAAAAATGCTGGCTGG - Intergenic
958501663 3:94918615-94918637 AGGTGCTCAAAAATATTAGTAGG - Intergenic
961798388 3:129426122-129426144 AGGGGCCCAAAAACAATAGCCGG - Intronic
963703259 3:148653601-148653623 AGGTGCCAATAAATGCTCACAGG - Intergenic
964189058 3:153980771-153980793 AGCTGCCCAGGAATTCTAGCAGG - Intergenic
976712984 4:88093135-88093157 AGTTGCACAAAAATGGTATCAGG - Intronic
977944007 4:102890077-102890099 AGGTATCCAAAAGTGTTAGCAGG + Intronic
984304909 4:177976241-177976263 AGGAGTGCAAAAATGCTATCGGG + Intronic
986455684 5:7915606-7915628 GGTTACCCAAAAATGCTTGCTGG + Intergenic
989463834 5:41731184-41731206 AGATGCCCAAGAAGGCAAGCAGG - Exonic
989542193 5:42630504-42630526 AGGTGACCAAAAAGGAGAGCTGG + Intronic
995189168 5:109302502-109302524 AGGTGCCACAGAATGCTAGCTGG - Intergenic
997244316 5:132333500-132333522 AGGTGGCCAAAAACTCTAGCAGG + Intronic
997388531 5:133494847-133494869 AGATGCCTTAAAATGCAAGCCGG - Intronic
1001536351 5:172500919-172500941 AGGTGCTTAAAAATGGGAGCTGG + Intergenic
1002447566 5:179298664-179298686 AGATGCCTAGAAATGCTAGAGGG + Intronic
1002806351 6:578564-578586 AGATCCCCACAAATTCTAGCTGG + Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1013932477 6:115550765-115550787 AAGTGCCCATAAATGATAGACGG + Intergenic
1013968319 6:115983334-115983356 AGCTGCCTAAAAGTGCTTGCTGG - Intronic
1014644187 6:123953676-123953698 AGGTGTCCAAACATGCTGACTGG - Intronic
1016662826 6:146600550-146600572 AGGTGGCCAAAGAAGCTAACAGG - Intronic
1018456369 6:163956817-163956839 AGGTGCCCAGAACTTCCAGCAGG - Intergenic
1020341273 7:7113816-7113838 TGGTGGCCAAAAACTCTAGCGGG - Intergenic
1021988534 7:26120195-26120217 AGGAGCCTAAATTTGCTAGCAGG + Intergenic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1039697373 8:39927093-39927115 AGGTGCCCATCAATGGTAGATGG - Intronic
1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG + Intronic
1042215357 8:66425600-66425622 AGCTGCACAAAAGTGGTAGCTGG + Intergenic
1042649496 8:71024014-71024036 AAGTGCCCAAGCATGCCAGCTGG - Intergenic
1043152998 8:76741916-76741938 ATATGACCAAAAATGCTGGCTGG - Intronic
1051091370 9:13413080-13413102 ATGTGCAGAAAAATGCTAGAAGG - Intergenic
1051890177 9:21933237-21933259 AGTTGCCAAAATATGCTATCTGG + Intronic
1056447518 9:86680025-86680047 AGATGCCAATAAATGCTGGCTGG - Intergenic
1056596846 9:88014812-88014834 AGTTGCCTCAAAATGCTGGCAGG + Intergenic
1058505857 9:105665455-105665477 TGGTGTACAAAAATGCAAGCAGG - Intergenic
1189653138 X:43211448-43211470 TGGTGCAAAAAAATGCTGGCAGG - Intergenic
1191680492 X:63835376-63835398 AGCAGCCCAAGAATGCTGGCTGG - Intergenic
1196023614 X:111016355-111016377 AGGTCCCCATAAATGTTAGCTGG + Intronic