ID: 902605567

View in Genome Browser
Species Human (GRCh38)
Location 1:17567251-17567273
Sequence GGCCACTGGCCTCTTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902605559_902605567 -3 Left 902605559 1:17567231-17567253 CCCTTGATCCCACCTTCCCAGGC 0: 1
1: 0
2: 2
3: 22
4: 431
Right 902605567 1:17567251-17567273 GGCCACTGGCCTCTTTCTGCTGG 0: 1
1: 0
2: 1
3: 26
4: 311
902605560_902605567 -4 Left 902605560 1:17567232-17567254 CCTTGATCCCACCTTCCCAGGCC 0: 1
1: 0
2: 2
3: 52
4: 430
Right 902605567 1:17567251-17567273 GGCCACTGGCCTCTTTCTGCTGG 0: 1
1: 0
2: 1
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902605567 Original CRISPR GGCCACTGGCCTCTTTCTGC TGG Intronic
900162703 1:1231966-1231988 GGCCACTGCCATCTTTCTTGCGG + Exonic
900204649 1:1426815-1426837 GGCCCCGGGCCCCTTTCTGCTGG + Intronic
900226758 1:1536596-1536618 AGCCTCTGGCCTCTTGCTGCTGG + Intronic
900395988 1:2453460-2453482 GGCCAGTGGCCCCCTTCTCCAGG - Intronic
900602815 1:3510266-3510288 GGTCACTGGCCGCTCTCTCCTGG - Intronic
901775479 1:11557703-11557725 GGGCACTGCCTTCTCTCTGCAGG - Intergenic
902309037 1:15566495-15566517 AGACCCTGGCCTCTTGCTGCTGG - Intronic
902605567 1:17567251-17567273 GGCCACTGGCCTCTTTCTGCTGG + Intronic
902616418 1:17625899-17625921 GGGCACTGGGCCCTCTCTGCAGG + Intronic
902788344 1:18747412-18747434 GGTCAAGGGCCTCTTTCTGAAGG - Intronic
903140688 1:21337390-21337412 GGCCAGTGGCCACCTGCTGCAGG + Intronic
903773416 1:25778193-25778215 GGCACCTGGCCTGTTTCTCCGGG + Exonic
904249758 1:29214746-29214768 GCCCACTGGATTCTTTCTCCTGG - Intronic
906614531 1:47225442-47225464 AGCCGCTGGCCTCTCTCGGCAGG - Exonic
908520446 1:64936073-64936095 GCACATTGGCCTCTTCCTGCCGG - Intronic
910000557 1:82336295-82336317 TGACACTGTCCTCCTTCTGCAGG - Intergenic
911179119 1:94845525-94845547 AACCACTGGCCTGTTTCTGTAGG + Intronic
912806884 1:112763872-112763894 GGCCTCTGTCCTCCTTGTGCAGG - Intergenic
913133085 1:115860606-115860628 GGCCACTAGTCTCTTTGTGAGGG + Intergenic
914516720 1:148380420-148380442 GGCCACTGGTGTGTTTCTACAGG + Intergenic
915296364 1:154924561-154924583 GGCAACTGGCCTGTTTATGTTGG - Intergenic
915567403 1:156723283-156723305 GTCCACTGCCCTGTTTCTCCTGG + Exonic
915641068 1:157226843-157226865 GAACACTGGACTGTTTCTGCTGG - Intergenic
918098693 1:181355087-181355109 GCCCACTGGGCTCTTTCCCCAGG - Intergenic
918998008 1:191787865-191787887 GGACACTGGTTTCTCTCTGCAGG - Intergenic
919741603 1:200984440-200984462 GGGGTCTGGTCTCTTTCTGCTGG + Intronic
920380144 1:205530422-205530444 GGCCTCTGGCCTCTTTGTTCTGG - Intronic
922397914 1:225222007-225222029 GGCTACTGGACTCTTTTTGGTGG + Intronic
922712805 1:227845835-227845857 GGGCACTGGCCCCTTCCAGCAGG + Intronic
923139745 1:231151298-231151320 GGCCTGTAGCCTCTTTCTTCTGG - Intergenic
1062834737 10:628306-628328 GGCCAATGGTCTCGTTCTTCAGG - Intronic
1065702969 10:28443432-28443454 GCCCACTGTCCTCCATCTGCAGG - Intergenic
1065917757 10:30366839-30366861 GGCCCCTGGCCCCTTGCTCCAGG + Intronic
1065973968 10:30826645-30826667 GGGAAATGGCCTCTTCCTGCTGG - Intronic
1066090271 10:32011852-32011874 GGTCACTGACCACTGTCTGCTGG - Intronic
1066101149 10:32119824-32119846 AGCCAGTGGCCTATGTCTGCTGG - Intergenic
1067295701 10:44974170-44974192 GGCCACTGGGCACTTGCTGCAGG + Intronic
1069723032 10:70561649-70561671 CCTCACTGGCCTCTGTCTGCAGG + Intronic
1070846495 10:79526632-79526654 AGCCTCTGCCCTCGTTCTGCAGG - Intergenic
1071558912 10:86630463-86630485 GCCTGTTGGCCTCTTTCTGCTGG + Intergenic
1072727535 10:97823834-97823856 GCCCAGTGGCCTCTTGCTCCTGG - Intergenic
1073149011 10:101299006-101299028 GGCCTCTGGCTTCCTTCTGGGGG + Intergenic
1073625181 10:105089622-105089644 TGCCAGTGGCCACATTCTGCTGG + Intronic
1074053194 10:109898588-109898610 GGCCTCTTGCCTCTTGCTTCTGG - Intronic
1074284969 10:112089408-112089430 GCCCACTGGCCTCTATCTGCAGG + Intergenic
1074285141 10:112091012-112091034 GCCCACTGGTCTCTATCTGCAGG + Intergenic
1075325254 10:121526634-121526656 GGCACCTGGGCTCTTTCTGAAGG - Intronic
1076188794 10:128468713-128468735 GGCCACTGGCCCCCGTCTGTTGG + Intergenic
1076309621 10:129495825-129495847 AGACACAGGCCTATTTCTGCAGG - Intronic
1076430239 10:130396765-130396787 GGCGAGTGTACTCTTTCTGCAGG - Intergenic
1076533830 10:131163148-131163170 GGCCACTGGCCTGTTGCCTCTGG + Exonic
1076722253 10:132397771-132397793 GGCCACGGGCCCCTGGCTGCTGG + Intronic
1076736649 10:132462065-132462087 GGTCACTGGGCTCTTCCTCCTGG + Intergenic
1076816794 10:132918991-132919013 GGCCACTGCCCTCTGCCTGCAGG + Intronic
1079040242 11:17052857-17052879 GGCCACTGCACCCTTTCTGGGGG - Intergenic
1079131389 11:17748854-17748876 GGCCTCTGGCCTCTTCCTGAAGG + Intronic
1081678548 11:44985784-44985806 GGCCCCTTGCCTTTTCCTGCAGG + Intergenic
1083164893 11:60877852-60877874 GGCCATTGGCTTTTCTCTGCCGG + Intergenic
1084228855 11:67735702-67735724 GGCCACTGCACTCTTTCTTGGGG + Intergenic
1085663398 11:78390953-78390975 GCCCACTTCCCTATTTCTGCTGG - Intronic
1086013419 11:82133884-82133906 GATTACTGGCCTCTTTCTTCTGG - Intergenic
1086406757 11:86505273-86505295 ACCCACTGGCCTTTTTCTGGAGG - Intronic
1086441358 11:86832633-86832655 GGCCACTGCACCCTTTCTGGGGG + Intronic
1087781089 11:102302230-102302252 GGCCAATTGCCTCTTTCTTTTGG - Intergenic
1087806912 11:102565304-102565326 GGCACCCGGCCTCTTTCTTCAGG - Intergenic
1088863103 11:113820788-113820810 GTCCACTGCCCTATTTCTCCTGG + Intronic
1089528895 11:119113907-119113929 GCCCACTGGGCTCTGTCAGCTGG - Exonic
1090105962 11:123853940-123853962 GGCCAGTTGCCTCTTTCTTTTGG + Intergenic
1090225794 11:125071571-125071593 GGCCAATGGCTTCTTTCTCTAGG + Intronic
1090777354 11:129977156-129977178 GGGCACTGTGCTCTGTCTGCTGG - Intronic
1091134292 11:133174289-133174311 GGCCCCTGTCCTCTCTCTCCAGG - Intronic
1091315595 11:134611772-134611794 GGCGACAGGCCTCTTGCTGGTGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094047175 12:26179691-26179713 GTCCACTGGCATCATTCTGTAGG - Intronic
1096649065 12:53053090-53053112 GGACACTGGCTTCTTTCACCGGG - Intronic
1098150055 12:67537492-67537514 GGGCACTGGCCTTTCTCTCCTGG + Intergenic
1101166056 12:102034939-102034961 GGTTATTGTCCTCTTTCTGCTGG - Intronic
1101538038 12:105638502-105638524 GCCCACTGGCCTTTTTATGTAGG - Intergenic
1102000850 12:109557363-109557385 GGGCAATGGCCTCATCCTGCAGG - Intronic
1103923678 12:124412357-124412379 TGGCACTGGCGTCTTGCTGCTGG + Intronic
1104960346 12:132485697-132485719 ATCCACTGGCCTCTTTCTGTGGG - Intergenic
1105069414 12:133225727-133225749 GGCCTCTGCCCTCTGGCTGCTGG - Intronic
1105218315 13:18303379-18303401 GGTCACTGGCCTATATCGGCAGG - Intergenic
1107352197 13:39527287-39527309 GGCCAAAGGCCTCTTTCTCAGGG - Intronic
1107545661 13:41431369-41431391 GGCCACTGCACCCTTTCTGGGGG + Intergenic
1108786525 13:53909683-53909705 GGCCCCTGTCCTCTTTCTCTGGG + Intergenic
1109069786 13:57749849-57749871 GTCCACTGGACTCTTTTTTCTGG + Intergenic
1110817346 13:79876606-79876628 CACTACAGGCCTCTTTCTGCTGG - Intergenic
1112457680 13:99576909-99576931 GGCCACTTGGCTTTTTCAGCTGG - Intergenic
1113634642 13:111911209-111911231 GGCCCCTGGCCAGTTTCTGCAGG - Intergenic
1114242060 14:20877177-20877199 GTCCACTGGGTTCTTTCTGGAGG - Intergenic
1114248927 14:20940794-20940816 GACCACTGGATTCTTTCTGGAGG - Intergenic
1114439234 14:22732802-22732824 TGCCCTTGTCCTCTTTCTGCAGG - Intergenic
1117754177 14:58957011-58957033 TGCTCCTGGCCTATTTCTGCTGG - Intergenic
1118206441 14:63727875-63727897 GGAAACGGGCCACTTTCTGCGGG + Exonic
1118322102 14:64759305-64759327 GGCCACAGGCCTCCCACTGCAGG - Intronic
1122932486 14:104940737-104940759 GGGCACTGCACTCTTTCTCCAGG + Exonic
1123472451 15:20565315-20565337 GGCCCCTGTCCCCTTTCTTCAGG - Intergenic
1123473294 15:20570325-20570347 GGCCCCTGGCCCCTTACTCCAGG - Intergenic
1123644714 15:22430028-22430050 GGCCCCTGGCCCCTTACTCCAGG + Intergenic
1123645553 15:22435038-22435060 GGCCCCTGTCCCCTTTCTTCAGG + Intergenic
1123733594 15:23165336-23165358 GGCCCCTGGCCCCTTACTCCAGG - Intergenic
1123751723 15:23362711-23362733 GGCCCCTGGCCCCTTACTTCAGG - Intronic
1124284095 15:28386635-28386657 GGCCCCTGGCCCCTTACTTCAGG - Intronic
1124298602 15:28524979-28525001 GGCCCCTGGCCCCTTACTTCAGG + Intronic
1125597220 15:40894739-40894761 GGCCTCTGGGCTCTTTGTCCGGG - Exonic
1125756150 15:42066337-42066359 GGCTACTGGGCTGTTCCTGCTGG - Intergenic
1127772934 15:62245091-62245113 GGCCCCTGGCCCCTTGCTCCAGG + Intergenic
1129030017 15:72611253-72611275 GGCCCCTGGCCGCTTGCTCCAGG - Intergenic
1129475905 15:75784565-75784587 GGCCCCTGGCCCCTTGCTCCAGG - Intergenic
1129695847 15:77740327-77740349 GGGACCTGGCCTTTTTCTGCAGG - Intronic
1129753316 15:78080985-78081007 AGCCACTGCCCTCTTCCTTCTGG + Intronic
1130259329 15:82343324-82343346 GGCCCCTGGCCCCTTGCTCCAGG + Intronic
1130259865 15:82346472-82346494 GGCCCCTAGCCCCTTTCTTCAGG + Intronic
1130268860 15:82432964-82432986 GGCCCCTAGCCCCTTTCTTCAGG - Intronic
1130269348 15:82435841-82435863 GGCCCCTGGCCCCTTGCTCCAGG - Intronic
1130281366 15:82522537-82522559 GGCCCCTAGCCCCTTTCTTCAGG - Intergenic
1130281936 15:82525858-82525880 GGCCCCTGGCCCCTTGCTCCAGG - Intergenic
1130473304 15:84242021-84242043 GGCCCCTGGCCCCTTGCTCCAGG - Intronic
1130480718 15:84356085-84356107 GGCCCCTGGCCCCTTGCTCCAGG - Intergenic
1130484913 15:84393512-84393534 GGCCCCTGGCCCCTTGCTCCAGG - Intergenic
1130490994 15:84431674-84431696 GGCCCCTGGCCCCTTGCTCCAGG + Intergenic
1130502578 15:84510473-84510495 GGCCCCTGGCCCCTTGCTCCAGG + Intergenic
1130595035 15:85243354-85243376 GGCCCCTAGCCCCTTTCTTCAGG - Intergenic
1130595589 15:85246616-85246638 GGCCCCTGGCCCCTTGCTCCAGG - Intergenic
1130667813 15:85884713-85884735 TGCCACTGGACCATTTCTGCAGG + Intergenic
1131055150 15:89370630-89370652 GGCCTCTGGCCTCTCTCCGAGGG - Intergenic
1131135916 15:89935263-89935285 TGCGCCTGGCCTCATTCTGCAGG + Intergenic
1131188226 15:90293375-90293397 GGCCCCTGGCCCCTTGCTCCAGG - Intronic
1131372110 15:91891250-91891272 GACAGCTGGGCTCTTTCTGCTGG - Intronic
1131501304 15:92969505-92969527 GAAGACTGGCCTCTTTCTGATGG + Intronic
1132284929 15:100655820-100655842 TGCCACTGGCCTGTGTGTGCAGG - Intergenic
1132371300 15:101301225-101301247 GGCCACTGGGCACTGGCTGCTGG - Intronic
1132432732 15:101774052-101774074 GGCCCCTGGCCCCTTGCTCCAGG + Intergenic
1132773110 16:1575723-1575745 TGCCACTGGCCTCTCCCAGCAGG + Intronic
1132866996 16:2097984-2098006 GACCACTGCCCTCGTCCTGCAGG - Exonic
1132924686 16:2422900-2422922 GGCCACTTACCTCTTCCTGCAGG - Intergenic
1133116476 16:3580524-3580546 GGCCTCTGGCCTGTTTCGGAAGG - Intergenic
1133367932 16:5225860-5225882 CACCTCTGGCCTCCTTCTGCAGG + Intergenic
1134687626 16:16169749-16169771 AGCAAGTGGCCTCCTTCTGCCGG - Exonic
1135187764 16:20329892-20329914 GTACACTGGCCTCTGGCTGCAGG - Intergenic
1135869809 16:26138844-26138866 GCCCTCTGCCCTCTTTCTCCAGG - Intergenic
1136683635 16:31981865-31981887 GGCCGCTGCCCACTTTCTGCAGG - Intergenic
1136708232 16:32208798-32208820 GGCCACTGCACTCTAGCTGCAGG - Intergenic
1136759676 16:32720608-32720630 GGCCACTGCACTCTAGCTGCAGG + Intergenic
1136784263 16:32925425-32925447 GGCCGCTGCCCGCTTTCTGCAGG - Intergenic
1136808428 16:33149778-33149800 GGCCACTGCACTCTAGCTGCAGG - Intergenic
1136885521 16:33928381-33928403 GGCCGCTGCCCGCTTTCTGCAGG + Intergenic
1137514647 16:49132694-49132716 GTCCACAGTCCTCTTTGTGCAGG + Intergenic
1138345175 16:56316196-56316218 GGCTCCTGGCCTCTTCCTGCAGG - Intronic
1138348217 16:56332736-56332758 GCCCTCTGGCCTCTCTGTGCTGG - Intronic
1139578132 16:67855362-67855384 GGCCACAGGGCTCCTACTGCTGG + Intronic
1139910628 16:70395276-70395298 GGGCACAGGCCTCTTTATCCAGG + Intronic
1141282445 16:82641094-82641116 GGAAACTGGCTTCTTGCTGCTGG + Intronic
1141323326 16:83032586-83032608 AGCAACTACCCTCTTTCTGCTGG + Intronic
1203061830 16_KI270728v1_random:980918-980940 GGCCACTGCACTCTAGCTGCAGG + Intergenic
1203086920 16_KI270728v1_random:1189431-1189453 GGCCGCTGCCCGCTTTCTGCAGG - Intergenic
1142808606 17:2384914-2384936 GGCCACTGGCCTCAGGATGCAGG + Exonic
1143178088 17:4967971-4967993 AGCCTCCGGCCTCTGTCTGCGGG - Intronic
1143273048 17:5689709-5689731 GGCCACTTGAGTCTCTCTGCTGG - Intergenic
1147144552 17:38477572-38477594 GGCCGCTGCCCGCTTTCTGCAGG - Exonic
1149794234 17:59504954-59504976 CGCCCCTGGCCTCTTGCTTCAGG + Intergenic
1150280941 17:63929372-63929394 GGTCAGTGGCCACTATCTGCTGG - Intronic
1150838384 17:68585177-68585199 AGCCACTGACCTCTGTCTACAGG - Intronic
1151967531 17:77439294-77439316 AGCCTCTGGCCACTTCCTGCAGG + Intronic
1152298315 17:79481188-79481210 GGCCTCTGGTCTCTTTGTCCAGG + Intronic
1152299854 17:79488862-79488884 AGCCACAGGCCTCTTTGTGATGG + Intronic
1152532455 17:80927026-80927048 GGGCACTTCCCTCTGTCTGCAGG - Intronic
1153800467 18:8663567-8663589 GGCCACTGTCCTCTGCTTGCTGG - Intergenic
1155211627 18:23607070-23607092 GCCCCCTGACCTCTATCTGCTGG + Intronic
1155494879 18:26433005-26433027 GGCTACTGCCATCCTTCTGCTGG + Intergenic
1155507100 18:26545124-26545146 GTCTACTGGCATCTGTCTGCTGG - Intronic
1158155786 18:54424079-54424101 GGCTGATGGCCTCTCTCTGCTGG - Intergenic
1159253396 18:65911417-65911439 TGCCAATGGCCCATTTCTGCTGG - Intergenic
1160346928 18:78139733-78139755 GGCCACTGCCCGCTTTGTCCTGG + Intergenic
1160738384 19:674943-674965 GGCCCCTGGCCACTGGCTGCTGG + Intergenic
1160856413 19:1219944-1219966 GGCCACTGGCCTCAGGCAGCAGG - Intronic
1160939798 19:1614914-1614936 GGACACTGGCCTCTGTGAGCTGG + Intronic
1162500844 19:11052746-11052768 GGCCCATGGCCACTGTCTGCAGG - Intronic
1163714744 19:18867256-18867278 TTCCAGTGGCTTCTTTCTGCGGG + Exonic
1164301683 19:23967673-23967695 GGCAACTGTCTCCTTTCTGCAGG + Intergenic
1165219803 19:34306205-34306227 GGCCACAGACCTCTTTCCCCAGG - Intronic
1165843269 19:38802194-38802216 GCCCACTGGCCTCTTCCCACTGG - Intronic
1166045786 19:40230051-40230073 GGCCACTGGAAGCTTTCTGTTGG + Intergenic
1166487379 19:43225096-43225118 AGCCACTGATCTCTTTCTGGTGG + Intronic
1167656963 19:50771248-50771270 GACCATTGGCCACTTCCTGCTGG + Exonic
1168151644 19:54452236-54452258 GGCCACAGGCCCATTGCTGCTGG - Exonic
925413805 2:3655812-3655834 AACCACTGGCCTCTTGCAGCTGG + Intergenic
926980064 2:18559703-18559725 GGCCTCTGCCCCTTTTCTGCTGG - Intronic
931233333 2:60392508-60392530 GATCACTGGCCCCTTCCTGCCGG - Intergenic
932480536 2:72036520-72036542 TGCCACTGGCCCCGTTTTGCAGG + Intergenic
932659427 2:73639576-73639598 GGCCTCTTGCCTCTTTCTTTTGG + Intergenic
932790933 2:74654208-74654230 GACCATTGGCCCCTTTCTGAGGG + Exonic
933746900 2:85578199-85578221 TGCCACTGGCCTATTTTTGGAGG + Intronic
934924470 2:98372330-98372352 AGCCACTGGCCTCTGGCTTCTGG + Intronic
934947693 2:98553949-98553971 GGGCAGTGGGCTCTCTCTGCAGG + Intronic
936021227 2:108996479-108996501 GGACACTGGCCTCATTAAGCAGG + Intergenic
937417887 2:121731419-121731441 CTTCACTGGCTTCTTTCTGCAGG + Intronic
938905569 2:135832888-135832910 GGCAAGTGGCTTCTTCCTGCAGG + Intronic
940630230 2:156229463-156229485 TGCCTATGGGCTCTTTCTGCTGG - Intergenic
941650357 2:168085764-168085786 GGGCACTGGACTCTGTCTGTTGG - Intronic
942069129 2:172299479-172299501 GGCCACTGAATTCTTTTTGCTGG + Intergenic
943836155 2:192516439-192516461 GGCCCCTTGTGTCTTTCTGCTGG - Intergenic
944926955 2:204475139-204475161 AGCCACTTGCCTCCTTCTGCAGG + Intergenic
945099847 2:206253714-206253736 GGGCAGTGGCCACTGTCTGCTGG + Intergenic
946252321 2:218421238-218421260 GCCCCCTGGCCCCTCTCTGCTGG - Intronic
946427695 2:219608240-219608262 GGCCTCTGGCTTCCTCCTGCGGG - Exonic
948706947 2:239800787-239800809 GGCCACTGCCAGCTTGCTGCGGG + Exonic
1168794839 20:604560-604582 GGCTCCTGGCCTCCTTCTCCAGG + Exonic
1173150955 20:40566103-40566125 GTCCCCTGGGTTCTTTCTGCAGG - Intergenic
1173158966 20:40638510-40638532 GGCCACTGCCCCCATTGTGCTGG + Intergenic
1173238223 20:41267723-41267745 GGCTACTGCCCTCCTTCTTCAGG - Intronic
1173944621 20:46940874-46940896 GGTCACTGGCCCCGTTCTGCGGG - Intronic
1174053477 20:47783265-47783287 GGCTTCTGGACTCCTTCTGCAGG + Intronic
1174186100 20:48707326-48707348 GTCCCCTGCGCTCTTTCTGCTGG - Intronic
1175150670 20:56931462-56931484 GGCCTCTGGCCACTTCCTGGTGG + Intergenic
1179466980 21:41582306-41582328 GGACACTGGCATCTGTCTGCAGG - Intergenic
1179647183 21:42783186-42783208 GGCCTCTGCCCACATTCTGCTGG + Intergenic
1179830557 21:43993629-43993651 CCCCACTGGCCGCTTTCTCCAGG + Intergenic
1179962070 21:44773157-44773179 TCCCACTGGCCTCTAACTGCTGG + Intronic
1180048384 21:45320250-45320272 GGCCACGGGCCTCCTCCTGCAGG + Intergenic
1180090682 21:45532367-45532389 GGCCACTGCCAGCTTTCCGCAGG - Intronic
1180604546 22:17047302-17047324 AGCCTCTGCCCTCGTTCTGCAGG + Intergenic
1180762689 22:18221824-18221846 GGGCACTGGCTTCTTCTTGCTGG - Intergenic
1180772978 22:18402784-18402806 GGGCACTGGCTTCTTCTTGCTGG + Intergenic
1180804336 22:18652339-18652361 GGGCACTGGCTTCTTCTTGCTGG + Intergenic
1180806417 22:18717077-18717099 GGGCACTGGCTTCTTCTTGCTGG - Intergenic
1181217363 22:21342858-21342880 GGGCACTGGCTTCTTCTTGCTGG - Intergenic
1181752315 22:24997354-24997376 GGCGACTGGCAGCTTTCTGCGGG + Intronic
1182422380 22:30254730-30254752 GGCCACTGTCCTCCCTCTGCAGG - Intergenic
1182445337 22:30386648-30386670 GGCCACTGCCCTTATTCTCCTGG + Exonic
1183530717 22:38351898-38351920 GGCCACTGGGCTGTGTATGCAGG + Intronic
1184044162 22:41962047-41962069 GGGCAATGGCCTGTTTCTGTAGG - Intergenic
1184518823 22:44980211-44980233 GAGCACTGGTTTCTTTCTGCAGG + Intronic
1185050980 22:48553792-48553814 AGCCTGTGGCCTCTTTTTGCTGG + Intronic
1203234813 22_KI270731v1_random:143772-143794 GGGCACTGGCTTCTTCTTGCTGG + Intergenic
949532866 3:4974880-4974902 TGCCACTGATCTCTTTCTGGTGG + Intergenic
949771864 3:7587890-7587912 GTTCACTGGCCTCTTTCTGAAGG - Intronic
951206896 3:19934679-19934701 GGCCATTGGCCTCTTAATGTTGG + Intronic
954698221 3:52438759-52438781 GCCCACTGGCCACTTGTTGCAGG + Intronic
955868974 3:63417191-63417213 GGCCTCTGGCCCCTTTCTTTGGG - Intronic
958894766 3:99817342-99817364 AGCCACTTGCGTCTTTCTGTGGG + Intergenic
961537732 3:127580203-127580225 GGCCACTGTCCTCCTTCCCCTGG + Intronic
961599953 3:128052660-128052682 GGGCACGGGCCGCGTTCTGCAGG - Intronic
961697367 3:128714779-128714801 GGCCACTGGTCTCTTTCATGAGG - Intergenic
967321686 3:188200970-188200992 GGCAACTGGCCTGTTTTTTCAGG - Intronic
967874246 3:194255979-194256001 GGACACTGGACTATTTCTGGAGG + Intergenic
968384717 4:125635-125657 GGGCACTGTCCTCTTCCTCCAGG + Intronic
968989722 4:3901674-3901696 GGCCACTGCACTCTTTCTCGGGG + Intergenic
969093193 4:4712186-4712208 GGGCATTGGCCTCTCTGTGCTGG - Intergenic
969401993 4:6961798-6961820 CGCGACTGGCATCTGTCTGCAGG + Intronic
969421040 4:7095974-7095996 GGCCACGGCCCCCTTGCTGCTGG + Intergenic
969519009 4:7665024-7665046 CGTCACTGGCCTGTTTCTTCTGG + Intronic
969787413 4:9469853-9469875 GGCCACTGCACTCTTTCTCGGGG - Intergenic
969947663 4:10801135-10801157 TGCCTCTAGCCACTTTCTGCTGG + Intergenic
970556823 4:17242403-17242425 GGCCTGTGTCCTCTTTCTACAGG + Intergenic
971253021 4:24988980-24989002 GGTTAATGGCCTCTTTCTTCTGG - Intergenic
972566656 4:40275545-40275567 GGCCACTGGCCTCTATAATCAGG + Intergenic
975696923 4:77022849-77022871 GGCCACTGGGCCCTTCCTGGTGG - Intronic
979888772 4:126063962-126063984 GGCGAGTGTACTCTTTCTGCAGG - Intergenic
985275051 4:188230069-188230091 TGCCCCTGGCTTCTTCCTGCGGG + Intergenic
987112644 5:14701682-14701704 GGCACCCGGCCTCCTTCTGCAGG - Intergenic
988848413 5:35153946-35153968 GTCCAGTGGGCTCTTTCTGGAGG - Intronic
989323642 5:40165361-40165383 GTCCTCTGGCCTCCTACTGCGGG - Intergenic
990535369 5:56716378-56716400 GGCCACTGGCCGCATTCCTCTGG + Intergenic
992448585 5:76855547-76855569 GGCCTCTGGCCTCTTTTTGGGGG + Intronic
996295467 5:121909683-121909705 GGCCATTGGCAGCTTTCAGCTGG - Intergenic
997305119 5:132830807-132830829 GGCCACAGGCCTCTTGCCCCAGG + Exonic
997521800 5:134527799-134527821 GGCTGCTGGCCTCTTGCTGGAGG + Intronic
998561400 5:143175332-143175354 TGCCACAGTCCTCTATCTGCAGG - Intronic
998880258 5:146638196-146638218 GGCCACTGGCCCCAATGTGCTGG - Intronic
1001638365 5:173228760-173228782 GGCCACAGGCCCCTTTCTCCAGG + Intergenic
1001910825 5:175516125-175516147 GCCCACTGCCCTCCTCCTGCTGG + Intronic
1003206598 6:4018591-4018613 GGCCACCGGCCTCTATCCGTCGG - Intergenic
1004732711 6:18373785-18373807 GGCCACTTCCAGCTTTCTGCAGG - Intergenic
1006447737 6:34089309-34089331 GTACAGTGGCCTCTTTCTACTGG + Intronic
1008339047 6:50342614-50342636 GTCCACTTGCCTCATTCTGGGGG + Intergenic
1010517329 6:76789538-76789560 GGCCTCTAGCCTCTTTCTCTTGG - Intergenic
1013323752 6:109022945-109022967 GTCCCTTGGCCTCTTTCTGATGG - Intronic
1016613817 6:146024529-146024551 GGCCTATGGCCTCTTTGTTCTGG + Intergenic
1017372993 6:153735477-153735499 AGTCAGTGGCTTCTTTCTGCAGG + Intergenic
1017861126 6:158398215-158398237 GGCCTTTTGCCTCTTTCAGCGGG + Intronic
1018235396 6:161718610-161718632 GGCCACTGGGCTGTTTCTCTCGG - Intronic
1019282944 7:209677-209699 GGCCGCTGGCCCCTTCCTGTGGG - Intronic
1019479575 7:1260292-1260314 GGCATCTGGGCTCTTTCTCCAGG - Intergenic
1019481038 7:1266998-1267020 GGCCTCTGACCCCCTTCTGCAGG - Intergenic
1020260800 7:6529802-6529824 GGCCACAGGACTCTTCCTGGGGG + Intronic
1020305944 7:6834928-6834950 GGCCACTGCACCCTTTCTGGGGG + Intergenic
1020312536 7:6879727-6879749 GGCCACTGCACTCTTTCTCGGGG + Intergenic
1022483992 7:30763771-30763793 GGGCAGTGGTCTCTTTCTCCAGG - Intronic
1024669665 7:51582896-51582918 GGCTACTACCCTCTTGCTGCAGG - Intergenic
1026905437 7:74060354-74060376 CACCACTGCCCTCTGTCTGCAGG + Exonic
1028641188 7:93043683-93043705 GCCCGCAGGCCGCTTTCTGCAGG - Intergenic
1029080084 7:97966197-97966219 GGCCACTGCACCCTTTCTGGGGG + Intergenic
1029461055 7:100694093-100694115 GGCCACTGGGCGCTTACCGCGGG + Intergenic
1031901684 7:127418080-127418102 CGCCACTTGCCTCTTGCTGTTGG - Intronic
1031944001 7:127819534-127819556 GGCCACCTGCCTCTTTATGGTGG - Intronic
1032476245 7:132213431-132213453 GGCCCCTGTTCTCTTCCTGCTGG - Intronic
1033742177 7:144284029-144284051 GGCCACTGGCTCCTTGCTGAGGG + Intergenic
1033751725 7:144365585-144365607 GGCCACTGGCTCCTTGCTGAGGG - Exonic
1034929978 7:155153885-155153907 GGGCAGTGGCCTCTTCCTCCTGG - Intergenic
1035577264 8:715752-715774 GGCCTCGGGCATCTGTCTGCAGG - Intronic
1036077040 8:5513635-5513657 TGACACTTGCCTCTTTCTGTAGG - Intergenic
1037440192 8:18908228-18908250 GGTGACTGCCCTCTTTCTGGGGG - Intronic
1037622242 8:20574690-20574712 TGCCACTTGTCTCTTTCTGGGGG + Intergenic
1038698488 8:29827615-29827637 AGCCCCTGGCTTCTGTCTGCTGG - Intergenic
1038941432 8:32310061-32310083 GGCCAGTGCCCGCTCTCTGCAGG + Intronic
1039695372 8:39904874-39904896 TGCCACTGGCCTCTTGGGGCGGG + Intronic
1040010828 8:42659784-42659806 AGCCACTGGCCCCCTTCTCCAGG + Intergenic
1042059128 8:64798545-64798567 GGCCACGGGCCGCTTTTCGCTGG - Exonic
1045239246 8:100384556-100384578 GGCCACTGCTCTATTTCAGCAGG - Intronic
1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG + Intronic
1047005605 8:120616920-120616942 GGCTGCTGGCCTCGCTCTGCAGG - Intronic
1047374674 8:124284658-124284680 GGCCTCTGGACTCTTTCTAAAGG - Intergenic
1048354718 8:133643559-133643581 TGTCCCTGGCCTCTTGCTGCTGG + Intergenic
1049164163 8:141116398-141116420 GACCTGTGGCCTCTTTCTGCGGG + Intergenic
1049457265 8:142700161-142700183 GGCCGCCGGCCACTTTCTGTGGG + Exonic
1059071851 9:111146351-111146373 GGGCACTGCCCTTTTTCTTCTGG - Intergenic
1059390842 9:113998804-113998826 GGCCATGGTCCTCTTTTTGCTGG + Intronic
1059542795 9:115146771-115146793 AGCGACTGACCTCATTCTGCAGG + Intronic
1060428579 9:123527202-123527224 GGCCACCATCTTCTTTCTGCTGG + Intronic
1061974285 9:134060654-134060676 GGCCACTGCCCTCTCCCCGCTGG - Intronic
1062023539 9:134330162-134330184 GGCCTCTGCCCTGTGTCTGCTGG - Intronic
1062218738 9:135403164-135403186 TGCCCCTGGGCTCTTGCTGCTGG + Intergenic
1062231746 9:135485778-135485800 GGCCACTAGCTTCTTCTTGCTGG - Exonic
1062371238 9:136239960-136239982 GGGCACTGGCCTCATTCAACGGG + Intronic
1187258352 X:17661585-17661607 ACCCACTAGCCTGTTTCTGCAGG - Intronic
1187676946 X:21725678-21725700 TGCAACTGTCCTCTTTCTCCTGG - Intronic
1188863809 X:35289567-35289589 GTCTATTGGCCTCTTTGTGCAGG - Intergenic
1189011423 X:37049211-37049233 GGCCTCTGGCCTCTTTGTTTTGG + Intergenic
1189801828 X:44698693-44698715 GGTCAGTGACCTCTTTCTCCTGG + Intergenic
1200735174 Y:6786469-6786491 GGCGAGTGTACTCTTTCTGCAGG + Intergenic
1201607515 Y:15803398-15803420 TGCAAGTGGCCTCTTTCTCCCGG - Intergenic
1201773613 Y:17642112-17642134 GGACACTGCCCTCTTGCTCCGGG - Intergenic
1201827943 Y:18263873-18263895 GGACACTGCCCTCTTGCTCCGGG + Intergenic
1202366770 Y:24171048-24171070 GGCCCCTAGCCCCTTTCTTCAGG - Intergenic
1202373638 Y:24214435-24214457 GGCTCCTGGCCCCTTTCTTCAGG + Intergenic
1202497143 Y:25455685-25455707 GGCTCCTGGCCCCTTTCTTCAGG - Intergenic
1202504012 Y:25499075-25499097 GGCCCCTAGCCCCTTTCTTCAGG + Intergenic