ID: 902606507

View in Genome Browser
Species Human (GRCh38)
Location 1:17572268-17572290
Sequence ATGGAGCAGGGGGCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1169
Summary {0: 1, 1: 0, 2: 11, 3: 127, 4: 1030}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902606507_902606523 16 Left 902606507 1:17572268-17572290 CCCTCCTCAGCCCCCTGCTCCAT 0: 1
1: 0
2: 11
3: 127
4: 1030
Right 902606523 1:17572307-17572329 ATCAGGGTAGAAAACTCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 164
902606507_902606520 -1 Left 902606507 1:17572268-17572290 CCCTCCTCAGCCCCCTGCTCCAT 0: 1
1: 0
2: 11
3: 127
4: 1030
Right 902606520 1:17572290-17572312 TGGGGCCTTGTGGGAATATCAGG 0: 1
1: 0
2: 3
3: 23
4: 188
902606507_902606518 -10 Left 902606507 1:17572268-17572290 CCCTCCTCAGCCCCCTGCTCCAT 0: 1
1: 0
2: 11
3: 127
4: 1030
Right 902606518 1:17572281-17572303 CCTGCTCCATGGGGCCTTGTGGG 0: 1
1: 0
2: 1
3: 20
4: 200
902606507_902606524 21 Left 902606507 1:17572268-17572290 CCCTCCTCAGCCCCCTGCTCCAT 0: 1
1: 0
2: 11
3: 127
4: 1030
Right 902606524 1:17572312-17572334 GGTAGAAAACTCTGCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 176
902606507_902606521 0 Left 902606507 1:17572268-17572290 CCCTCCTCAGCCCCCTGCTCCAT 0: 1
1: 0
2: 11
3: 127
4: 1030
Right 902606521 1:17572291-17572313 GGGGCCTTGTGGGAATATCAGGG 0: 1
1: 2
2: 1
3: 21
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902606507 Original CRISPR ATGGAGCAGGGGGCTGAGGA GGG (reversed) Intronic
900113698 1:1019978-1020000 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
900212304 1:1462148-1462170 ATGGAGCAGGCGGCAGTGGAGGG - Intronic
900323373 1:2095778-2095800 GGGGAGCAGAGGGCAGAGGAGGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900996967 1:6128002-6128024 ATGGAGGGCGGGGCTGCGGATGG + Intronic
901010997 1:6202000-6202022 ATGGAGGATGGGGGTGAGGCTGG - Intronic
901022704 1:6263086-6263108 GTGGAGCTGGGGGCCGAGGCTGG + Intergenic
901078894 1:6572610-6572632 TGGGGGCAGGGGGCTGAGGGGGG - Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901456097 1:9363662-9363684 ATGGAGCTGGGGGCTCATGTGGG + Intronic
902063109 1:13661780-13661802 TTTGAGCATGGGGGTGAGGAAGG - Intergenic
902079559 1:13811882-13811904 AGGGAGCTGTGGGCAGAGGAGGG + Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902729202 1:18357462-18357484 ATGGAGATGGGGGATGAGGTGGG + Intronic
902740889 1:18437167-18437189 GTGGAGGAGGGGGCTTAGGAGGG - Intergenic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902847268 1:19121625-19121647 AAGGAGCAGGGGGCTCTGGTCGG - Intronic
903342524 1:22663414-22663436 ATGGGTCAGGGGTCCGAGGAGGG - Intergenic
903365770 1:22804769-22804791 AAGGAGCAGGGGACAGAGGCGGG - Intronic
903435131 1:23343907-23343929 ATGGAGCAGCGAGCGGAGGCGGG + Intronic
903681961 1:25103246-25103268 AGGGAGCAGGGAGCTGGGGTAGG - Intergenic
903684354 1:25120097-25120119 GTGAGGCAGGGGGCTCAGGAGGG - Intergenic
904285229 1:29449660-29449682 ATGGAGTGAGGGGCTGTGGATGG + Intergenic
904332215 1:29767467-29767489 ATGGGGCACGAGGGTGAGGAAGG - Intergenic
904336151 1:29799679-29799701 ATGGGGCAGTGGGCTGGGGAAGG + Intergenic
904494545 1:30879238-30879260 CTGGAGCAGGTGGTTGAGGCTGG - Intronic
904534535 1:31190501-31190523 ATGGGACAGGTGGCTGAGAAAGG - Intronic
904762787 1:32817629-32817651 ATGGCGCAGGGGGCGGAGTGAGG + Exonic
904834363 1:33325240-33325262 ATGGAGCAGGGGTCTGAACAGGG - Intronic
905028227 1:34865601-34865623 AGTGGGCAGAGGGCTGAGGATGG + Exonic
905108675 1:35578672-35578694 AAGGAGGAGGGAGCTGGGGAGGG + Intronic
905199857 1:36308039-36308061 ATGGAGGTGGGGGCTGCTGATGG + Intronic
905203703 1:36330671-36330693 ATGGAGGAGATGGTTGAGGAAGG - Intergenic
905459520 1:38113541-38113563 GGGGAGTAGGGTGCTGAGGATGG + Intergenic
905509964 1:38511360-38511382 ATGCGGCACGGGGCTGAGGGGGG + Intergenic
905615306 1:39393320-39393342 GGGGAGCAGGGGGCAAAGGAGGG - Intronic
905796289 1:40818409-40818431 ATGTGGCAGGGGACTGGGGAGGG - Intronic
905863282 1:41363990-41364012 ATGGTGCAGGATGCTGAGGCAGG + Intronic
906296048 1:44649858-44649880 AGGGAGGAGGGGGCAGAGAAGGG - Intronic
906507933 1:46394033-46394055 GGGGTGCAGGGGGCAGAGGACGG + Intergenic
906651331 1:47515209-47515231 CTGGAGCAGAGGGCTGAGCAAGG - Intergenic
906708480 1:47912074-47912096 TTGGAGGAGGGGGCTGAGGGAGG + Intronic
906952857 1:50348784-50348806 CAGGATCAGGGGGCTGGGGAAGG - Intergenic
907455425 1:54572422-54572444 GTAGGGCAGGGGTCTGAGGAGGG + Intronic
907529725 1:55082671-55082693 AGCTACCAGGGGGCTGAGGAGGG + Intronic
907973170 1:59404611-59404633 TTGCAGCAGGGGGCTGAGGCTGG + Intronic
908079018 1:60554634-60554656 AGGGTGGAGGGGGCTGAGGTGGG + Intergenic
908195360 1:61742377-61742399 GTGGCGCAGGGGGCGGGGGAGGG - Intergenic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
909547358 1:76862765-76862787 AAGGATTAGGGGGCTGTGGAGGG - Intergenic
909816616 1:80002266-80002288 ATGGGGTGGGGGGCTGAGGGAGG + Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910428351 1:87137945-87137967 ATGGAACAGCGGGATGAGCATGG + Intronic
911207956 1:95111683-95111705 ATGGTGCAGTGGACTGTGGAAGG + Intergenic
911678162 1:100683026-100683048 ATGGAACGGGGGGCAGAGGGTGG - Intergenic
911936469 1:103981438-103981460 ATGGGGCATGGGGCGGAGGAGGG + Intergenic
912262217 1:108121628-108121650 CTGGAGCAGGAGCCTCAGGAAGG + Intergenic
912387450 1:109278898-109278920 TTGGAGCAGGGGGCTGGGTGCGG + Intergenic
912403658 1:109418100-109418122 CTGTAGCTGGGGGCTGAGGTGGG + Intronic
912544415 1:110440614-110440636 ACAGAGCAGGGGGCTGAGACTGG + Intergenic
912725717 1:112057431-112057453 AAGGAGGATGGGGCTGAGGAGGG - Intergenic
913431263 1:118794282-118794304 ATAGACCATGGGGATGAGGATGG + Intergenic
914003976 1:143716954-143716976 CTGGAGCAGGCGGCTGGGCACGG + Intergenic
914808444 1:151008702-151008724 ATGGAGCACGGGGTCCAGGAAGG + Intronic
914885727 1:151582853-151582875 ATGGAGCAAGGGGTTCAGAAGGG - Exonic
915278558 1:154806859-154806881 ATCGACCAGGGAGGTGAGGAAGG + Intronic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915840426 1:159208565-159208587 ATGTAGCAGGGGGCGGGGGTAGG - Intergenic
915978429 1:160405642-160405664 ATGAAGCTGGGGGCTGGGTAGGG + Intronic
916473968 1:165150627-165150649 GAGGGGCAGGGGGCTGAGGCAGG + Intergenic
916742608 1:167659724-167659746 ATGGGGGAGGGGGCTGACAAGGG - Intronic
917487663 1:175469506-175469528 ATCAAGCAGGGGACTGAGGTTGG + Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917927748 1:179803300-179803322 AAGGAGCAGGGGGCAGTCGATGG + Intronic
918535175 1:185565917-185565939 GTGGAGGAGGGGGGTGAGGGAGG - Intergenic
918750908 1:188268312-188268334 ATGGACCAGGGGGATGGGGGTGG + Intergenic
918983104 1:191588895-191588917 AAGAAGCAGGGGTCTGTGGATGG + Intergenic
919884233 1:201921112-201921134 ATGGAGCGGGGAGATGAGGGTGG + Intronic
919939965 1:202279302-202279324 ATGGAGCAGGTGGGTAAGGATGG + Intronic
920312729 1:205058158-205058180 CTGCAGCAGGGGACAGAGGAAGG - Intronic
920369522 1:205469304-205469326 ATGGGGCTGTGGGCTGGGGAAGG - Intergenic
921165281 1:212502508-212502530 ATGGAGGAGATGGCTGAGGCAGG + Intergenic
922483648 1:225956801-225956823 ATCTACTAGGGGGCTGAGGAAGG + Intergenic
922775804 1:228213784-228213806 AGGGAGCCGGGGGCGGGGGAGGG + Intronic
922809352 1:228407133-228407155 ATGGAGCAGGGGGCAGGGCAAGG + Intergenic
922824815 1:228510431-228510453 AGGGAGGAGGGGGCTGGAGATGG + Intergenic
923211927 1:231811263-231811285 AGGGAGAAGGGGGTTGGGGAGGG + Intronic
923512732 1:234666466-234666488 AGGCAGCAGGGAGCTGAGGCAGG + Intergenic
923816889 1:237389978-237390000 ATCAGGCAGGGGGCTGAGGATGG + Intronic
923825548 1:237495757-237495779 ATGGGGCATGGGGCTGAGGTAGG - Intronic
924306633 1:242696374-242696396 ATGGAGCAAGGAGCTAACGAGGG - Intergenic
924475845 1:244381175-244381197 AAGTTGCTGGGGGCTGAGGAGGG + Intronic
924476187 1:244383789-244383811 ATGGAGCAGGGTGCGGTGGAGGG + Intronic
924875621 1:248100208-248100230 ATTGAGCATGGGGGTAAGGATGG - Exonic
924904921 1:248442015-248442037 ATTGAGCATGGGAGTGAGGATGG - Exonic
924906062 1:248453636-248453658 GTTGAGCATGGGGGTGAGGATGG - Exonic
924921828 1:248638401-248638423 GTTGAGCATGGGGGTGAGGATGG + Exonic
1062886496 10:1020629-1020651 ATGAAGGATGGGGCTGTGGATGG - Intronic
1063132833 10:3193427-3193449 CTGGGGCAGGAGGCAGAGGAAGG - Intergenic
1064633967 10:17345088-17345110 CTGCAGCAGGGGGAGGAGGAGGG + Intronic
1065327609 10:24563064-24563086 ATGGAGAAGGGTGGGGAGGAGGG - Intergenic
1066367150 10:34788326-34788348 ATGGAGCAGAGTGCTGAGTTGGG - Intronic
1067288511 10:44924590-44924612 ACAGAGCAGGGGACAGAGGAGGG + Intronic
1067327833 10:45286723-45286745 ATGGAGCAGGGGGCAGTTGTTGG - Intergenic
1067427079 10:46218575-46218597 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427110 10:46218746-46218768 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427118 10:46218784-46218806 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427135 10:46218879-46218901 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427153 10:46218955-46218977 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427163 10:46218993-46219015 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067427172 10:46219031-46219053 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067435102 10:46271093-46271115 ATGGAGGAGGGGGCCAAGCAAGG + Intergenic
1067440645 10:46307631-46307653 ATGGTGCAGGTGGGTGAGGCTGG + Intronic
1067533321 10:47090440-47090462 ATGGAAGATGGGGCTGAGGAAGG - Intergenic
1067541157 10:47154602-47154624 ATGGAGCAGGGGTGTGTGAAGGG - Intergenic
1067582589 10:47454823-47454845 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067582592 10:47454842-47454864 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067692351 10:48509819-48509841 ATGGAGGAGGGGGCACAGGAAGG + Intronic
1067708988 10:48633833-48633855 AGGGAGCAGAGGGCTGGGCATGG + Intronic
1068765033 10:60753478-60753500 CTGGAGCAGGAGGCAGTGGAAGG - Intergenic
1068772895 10:60841703-60841725 AAGGAGCAGGGGGCGGGGGCGGG + Intergenic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1068985588 10:63104993-63105015 ATGGAGCTGGGGGCTGGGCGAGG + Intergenic
1069023961 10:63521085-63521107 GTGGGGCAGGAGGCTGAGGAAGG - Intergenic
1069304997 10:66957990-66958012 CTGGAGCAGGGTACAGAGGAAGG + Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1069772879 10:70910693-70910715 GTGGCGCAGGAGGCTGAGGCTGG + Intergenic
1069824057 10:71244556-71244578 AAGAAGCAGGGGCCTGAGTAGGG - Intronic
1070290755 10:75111797-75111819 ATGGAGCCGGGGGCTGCCGAGGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070519075 10:77236059-77236081 GGGGAGCAGGGGACTGAGGCTGG + Intronic
1070585230 10:77760418-77760440 ATGGTGTGGGGGGCAGAGGAAGG + Intergenic
1070688805 10:78509679-78509701 CTGGGGCTGGGGGATGAGGAGGG - Intergenic
1070959780 10:80490521-80490543 ATGGTGCAGGGAGGTGAAGAAGG + Intronic
1071304538 10:84286830-84286852 ATGGAGTAGGGGTGGGAGGAAGG + Intergenic
1071600407 10:86956135-86956157 GGGGAGCAGGGGGCGGGGGAGGG - Intronic
1072405003 10:95142806-95142828 TTGGAGCAGGGAGCTGGGGGAGG + Intergenic
1073077980 10:100836490-100836512 AGAGTGCAGGGGGCGGAGGAGGG + Intergenic
1073472779 10:103733417-103733439 ATGGAGGAGGGGGCATAGGGCGG - Intronic
1073540944 10:104315825-104315847 CTGGAGCAGGTGGCGGAGGAGGG - Exonic
1073614453 10:104978958-104978980 AGGGAGCAAGGGGCAGAGGTAGG - Intronic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1074146585 10:110721978-110722000 AAGGAGCAGGTGCCTAAGGAGGG - Intronic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074744182 10:116515044-116515066 AGAGAGCTGCGGGCTGAGGAAGG + Intergenic
1075087360 10:119422562-119422584 AGGGAGGAGGGTGGTGAGGAGGG - Intronic
1075683478 10:124348512-124348534 ATGGAGTGGGGGGTTGGGGAGGG + Intergenic
1075857769 10:125644947-125644969 ATGTAGCAAGGAGCTGAGAAGGG + Intronic
1075954446 10:126510036-126510058 ATGGAGCAGAGGACAGAGGGAGG - Intronic
1076365423 10:129918643-129918665 CTGGGGCAGGGAGCTGGGGAGGG - Intronic
1076413170 10:130265923-130265945 ATGGAGACGGGGCCGGAGGAAGG + Intergenic
1076558333 10:131344815-131344837 CTGGAGCCTGGTGCTGAGGAAGG + Intergenic
1076729188 10:132429765-132429787 GGAGAGCAGGGGGCTCAGGAAGG + Intergenic
1076764544 10:132625745-132625767 ACGGAGCAGGGGGTTCTGGAGGG + Intronic
1077134926 11:993744-993766 CTGGATCAGCGGGCTGGGGACGG - Exonic
1077529900 11:3090255-3090277 AAGGAGCAGAGGGCTGGGGCAGG + Intronic
1077535644 11:3122695-3122717 ATGGGGCAGGGTGGTCAGGAAGG + Intronic
1077919802 11:6633573-6633595 CTGGAGATCGGGGCTGAGGACGG - Exonic
1077921866 11:6647352-6647374 AAGGAGGAGGGGGCTCAGGAGGG + Intronic
1078387514 11:10905412-10905434 ACAGAGCAGGGGCATGAGGAGGG - Intergenic
1078427455 11:11263500-11263522 TGGGAGCTGGGGGATGAGGATGG - Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078776508 11:14398820-14398842 AGGAAGCTGGGGGCTGAGAAAGG + Intergenic
1078929291 11:15901133-15901155 CTGGGGCAGGGGCCTGGGGAAGG - Intergenic
1080033810 11:27689872-27689894 CTGGAGCAGGGGGCAGGGGAAGG - Intronic
1080156277 11:29115133-29115155 ATGAGTCAGTGGGCTGAGGAAGG - Intergenic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1081858034 11:46316276-46316298 CTGGAGCAGGGTCCTGAGGAGGG - Exonic
1081891185 11:46543416-46543438 ATGGGGCAGGGGGTAGAGCAAGG + Intronic
1082013480 11:47467095-47467117 ATGTAGCTAGGGGCTGGGGAGGG - Intronic
1082661270 11:55914187-55914209 ATAGAGCAGGGGGTTGATGATGG + Exonic
1082777027 11:57253590-57253612 ATGTAGCAAGGGCCTGAGGAAGG + Intergenic
1083036305 11:59640734-59640756 AATGAACAGGGGGCTGGGGATGG + Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083655561 11:64227516-64227538 ATGGGGCAGGGGGAAGAGGTGGG + Intronic
1083726541 11:64631301-64631323 GTGGAGCTAGGGGCTGGGGAAGG + Intronic
1083796793 11:65021605-65021627 ATGGAGCAGGGCCTTGAGGAAGG + Intronic
1084021518 11:66420810-66420832 GGGGAGCAGGAGGCTGCGGAGGG - Intergenic
1084086926 11:66859134-66859156 GGGGAGCAGAGGGCGGAGGAAGG - Intronic
1084639334 11:70415139-70415161 AGGGAGCAGGGAGCTGATGCTGG + Intronic
1084731342 11:71075611-71075633 GTGGAGCTGGGCACTGAGGATGG - Intronic
1084851450 11:71944541-71944563 AAGGAGCTGGGAGCAGAGGAAGG + Intronic
1084946010 11:72638919-72638941 ATGCAGCCTGGGGCTGAGGAAGG - Intronic
1085300374 11:75455059-75455081 AGGGGGCAGAGGGCAGAGGAAGG + Intronic
1085454743 11:76659456-76659478 ATGCAGCAGGCGGCAGAGAAAGG + Exonic
1085458487 11:76679100-76679122 CTGGAGTAGGGTGCAGAGGACGG - Intergenic
1085502722 11:77038125-77038147 AGGGAGGAGGGGGAGGAGGAGGG + Intronic
1086503323 11:87475756-87475778 ATGGAGCAGGGAGCTGACTACGG + Intergenic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087011393 11:93517241-93517263 ATGAAGCAGAGAGCTCAGGAAGG + Intronic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1088679288 11:112225720-112225742 AGGGAGTAGGGGGCTGGGGGAGG + Intergenic
1089260028 11:117217942-117217964 ATGGAGGCGGAGGCAGAGGATGG + Intronic
1089351365 11:117823450-117823472 AGGAAGCAGGGGGCTGAGAATGG + Intronic
1089496906 11:118912561-118912583 CTGGGGGAGGGAGCTGAGGAAGG + Intronic
1089733022 11:120531362-120531384 ATGGAGCAGGTGCCTGTGGCAGG - Intronic
1089743413 11:120600516-120600538 TTTGAACAGAGGGCTGAGGAGGG + Intronic
1089813742 11:121153507-121153529 ATGGAGCTGGAGGCTGAGTGGGG + Intronic
1090361406 11:126175312-126175334 ATGGGGCAGGGGGTAGAGGGTGG - Intergenic
1090442674 11:126737244-126737266 ATGGGGCCTGGGGCTCAGGAAGG + Intronic
1090687678 11:129141471-129141493 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1090839106 11:130473883-130473905 CTGGAGTAGCGGGCAGAGGACGG + Exonic
1091069371 11:132548832-132548854 ATGAAGCAGAGGGTTGAAGATGG - Intronic
1091234993 11:134015661-134015683 CTGGAGCAGGAGCCTGAGGTGGG + Intergenic
1091356081 11:134938627-134938649 CTGGAGCAAGGGGATGAGGATGG + Intergenic
1091587988 12:1827058-1827080 CTGGAGCAGTGGGCTGACGCAGG + Intronic
1091642111 12:2245288-2245310 ATGGAGAATGGAGCTGAGAATGG - Intronic
1091979329 12:4852929-4852951 ATCCAGCAGGGAGCTGAGGATGG + Intergenic
1092351941 12:7762779-7762801 CAGAAGCTGGGGGCTGAGGAGGG - Intergenic
1092532338 12:9354950-9354972 AGGGAGTGGGGGGCTGGGGAAGG - Intergenic
1092672610 12:10881179-10881201 AAGGAGAAGGGGGCTGTAGAAGG - Intronic
1092779897 12:11976412-11976434 ATGGAACAATGTGCTGAGGAGGG - Intergenic
1093551162 12:20413419-20413441 GTGGAAAAGTGGGCTGAGGAAGG + Intronic
1093991032 12:25590595-25590617 ATGCAGCCTGGGGCTAAGGAAGG - Intronic
1094203161 12:27813624-27813646 ATGTGGCAAGGGGCCGAGGATGG - Intergenic
1095652880 12:44634314-44634336 ATGGGGTGGGGGGCTGGGGAAGG - Intronic
1095956107 12:47807228-47807250 ATAGGGCAGGGGGCTGGGCACGG - Intronic
1096292944 12:50357738-50357760 ATGGATCTGGCGGTTGAGGATGG - Intronic
1096476885 12:51913914-51913936 ATAGAGAAGGGGGCTGTGGCTGG + Intronic
1096595017 12:52689490-52689512 AGGGAGTAGGGGGAGGAGGAGGG + Intergenic
1096782478 12:53999179-53999201 ATGGAGTTGGGGGCAAAGGAGGG + Intronic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1097034331 12:56112872-56112894 ATGAAGCTGGGGACTGAGGTGGG + Exonic
1097038641 12:56140847-56140869 ATGGAGCAGGTGGAGGAGCAAGG + Intronic
1097169892 12:57106698-57106720 CTGCAGAAGGGGGCTGAGGCTGG - Exonic
1097233607 12:57526129-57526151 CAGGAGCAGGGGCCCGAGGACGG - Exonic
1097691884 12:62741364-62741386 ATGAAGCACGGGGCAGAGGAGGG - Intronic
1097713333 12:62938406-62938428 AAGGAACAGGGGGCTGGGGGAGG + Intergenic
1097924229 12:65110237-65110259 AGGGGGCAGGGGGCAGGGGAGGG - Intronic
1098863548 12:75736430-75736452 ATGGACCAGGGAGGTGAGGCTGG - Intergenic
1099355817 12:81633831-81633853 TTGGAGCAGGGGGGAGAGGAAGG + Intronic
1100643219 12:96502703-96502725 GTGGGGGAGGGAGCTGAGGAAGG + Intronic
1100669034 12:96789475-96789497 TTGGAGTAGGGGGCAGAGGACGG + Intronic
1100725442 12:97403591-97403613 ATGCAGCAGGAGGCTGAGGCAGG + Intergenic
1100984328 12:100190022-100190044 TTAGAGTTGGGGGCTGAGGAGGG - Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101299979 12:103469157-103469179 AGGGAGCAGGGAGCTTGGGAAGG + Intronic
1101370746 12:104127786-104127808 AGGGGGCTGGGGGCTGAGGTGGG - Intronic
1101807513 12:108077307-108077329 ATGGAGCAGAGAGTTGAGGCTGG - Intergenic
1101877108 12:108603312-108603334 CTGGAGCTGGGGGCTGTGGTGGG - Intergenic
1101958753 12:109232498-109232520 CTGGGGCCGGGGCCTGAGGAGGG - Intronic
1102147934 12:110668912-110668934 ATGGTACAGGAAGCTGAGGAGGG - Intronic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102348973 12:112178499-112178521 ATGGAGCTGAGGACTGAGAAAGG + Intronic
1102433040 12:112898456-112898478 ATTGTGCAGGGAGCTGAGGGTGG - Exonic
1102549787 12:113683574-113683596 AGGGACCAGGGGGTGGAGGAAGG - Intergenic
1102810292 12:115818505-115818527 ATGGATCAGGGTGCAGAGGTAGG + Intergenic
1102893234 12:116578352-116578374 ATGGAGCAGGAGCCTGTTGAAGG - Intergenic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1103235352 12:119368078-119368100 AAGGAGGAGGGGGAGGAGGAGGG + Intronic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103359046 12:120342826-120342848 ATGGACCAGAGGGCTGGGGTGGG + Exonic
1103521356 12:121538263-121538285 ATGGAACACGGGGCTCAGGGGGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103590578 12:121989563-121989585 AGGGAGTAGTGGGCTGAGGAGGG - Intronic
1103736123 12:123061914-123061936 ATGGAGTTGGGTGCGGAGGAAGG + Intronic
1104057643 12:125242790-125242812 ATGGAGCAGTGGGCAGTGGGAGG - Intronic
1104152128 12:126093930-126093952 ATGCAGCAGGGAGCTGTGGGGGG + Intergenic
1104903015 12:132199217-132199239 CTGGACCAGGGAGCGGAGGACGG - Exonic
1104927638 12:132321939-132321961 GTGGTGCAGGGGGCCGAGGCGGG - Intronic
1104953085 12:132451194-132451216 CTGGAGCAGGGGGCTCAGCTGGG - Intergenic
1105384916 13:19920669-19920691 AAAGAGGAAGGGGCTGAGGAGGG + Intergenic
1105494128 13:20915611-20915633 ATGGACAAAGGGGCTGAGCACGG + Intergenic
1106467076 13:30023070-30023092 AAGGAGCAGGGGGCAGGAGATGG - Intergenic
1106569940 13:30917697-30917719 ATGGAGCAGGGGGAAGAGAGCGG + Intronic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1107384102 13:39889481-39889503 AGTGAGCAGTGGGTTGAGGAAGG - Intergenic
1107603940 13:42040539-42040561 AGGGCGCCGGGGGCGGAGGAAGG + Intronic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1109404644 13:61880959-61880981 AGGGAGCTGGGGCCTGAGTAGGG + Intergenic
1111220968 13:85205245-85205267 GCGGAGCAGGGGGCGGAGCAGGG - Intergenic
1112870860 13:103969047-103969069 AGGAAGCAGGAGGGTGAGGAGGG + Intergenic
1113164986 13:107430432-107430454 AGGGAGCAGGGGGAGGGGGAAGG - Intronic
1113350852 13:109527853-109527875 TGGGAGCAGAGGGCTGAGGAAGG - Intergenic
1113454719 13:110440103-110440125 ATGGAGGAGGGGTGTGAGGTTGG - Intronic
1113456653 13:110454286-110454308 GAGCAGCAGGGGGCAGAGGAAGG + Intronic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1113916546 13:113877381-113877403 AAGGAGGAAGGGGCTCAGGAGGG + Intergenic
1114317423 14:21521972-21521994 CTGGAGCAGGGGGAGGAAGAAGG + Exonic
1114318195 14:21525833-21525855 ATGGGGCAGGGGGGTGGGGAGGG + Intronic
1114796165 14:25717668-25717690 ATGGAGTAGGGGGATGGGGGAGG - Intergenic
1115410549 14:33069067-33069089 ATGCTTCAGGGGGCTGAGGGTGG + Intronic
1115885866 14:37970961-37970983 TTGGAGCAGTGAGATGAGGAAGG - Intronic
1115962524 14:38851767-38851789 ATGAAGCAGGGGGGTGGGGTGGG - Intergenic
1116403748 14:44542505-44542527 ATGGGGCGGGGGGCAGGGGAGGG + Intergenic
1116581134 14:46642950-46642972 CTGGAGCAGAGGGCTGAGAATGG + Intergenic
1116675133 14:47897204-47897226 AGGGAGCATGGCCCTGAGGAAGG - Intergenic
1116895330 14:50310589-50310611 TTGGGGAGGGGGGCTGAGGAGGG + Intronic
1117218632 14:53578703-53578725 ATGTGGCAGGGGGATGGGGAAGG + Intergenic
1117812991 14:59568196-59568218 AGGGAGCAGGGGTCTGAGGCTGG - Intronic
1117828535 14:59727481-59727503 GTGGTCCAGGGGGCTGGGGATGG + Exonic
1117893182 14:60449035-60449057 AGGGAGTAGGGGGCTGGGGGAGG + Intronic
1118152445 14:63204346-63204368 TAGGATCAGTGGGCTGAGGAAGG - Intronic
1118156284 14:63245544-63245566 ACCTGGCAGGGGGCTGAGGAGGG + Intronic
1118573675 14:67219767-67219789 ATGGCGTAGGGAGCTGAGAAGGG - Intronic
1118980079 14:70709323-70709345 ATTGAGCAAGGGTCTGAAGAAGG + Intergenic
1119113216 14:71994990-71995012 GTGGAACTGGGGGCTGAGGTGGG + Intronic
1119220285 14:72900960-72900982 AGGGAGAAGGGGGCTGGGGCTGG - Intergenic
1119264963 14:73259171-73259193 ATGGTCCAGGGGACGGAGGAAGG + Intronic
1119650578 14:76380181-76380203 ATTCAGCAGAGGGCTGAGGAAGG - Intronic
1119769430 14:77211172-77211194 GCTGAGCAGGGGGCAGAGGAAGG - Intronic
1119777534 14:77258193-77258215 TTGGGGGAGGGGGCTGAAGAGGG - Exonic
1120059085 14:79960519-79960541 ATGGAGCAGGGGGAGGAGACAGG + Intergenic
1120310987 14:82828255-82828277 CTGGATAAGGGGGCTGAAGATGG - Intergenic
1120425255 14:84339459-84339481 GAGGAGCAGGGGTATGAGGATGG - Intergenic
1120568282 14:86086228-86086250 AGGGAGTGGGGGGCTGGGGAGGG - Intergenic
1120879715 14:89405589-89405611 ATGAGGCAGGGGGCTCAGGATGG + Intronic
1121144130 14:91568809-91568831 ATGCTGCAGGGGGCAGAGGGTGG - Intergenic
1121303482 14:92890213-92890235 CTGAAGCTGGGTGCTGAGGAGGG - Intergenic
1121615646 14:95311809-95311831 ATGAAGAAGGTGGCAGAGGATGG - Intronic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121899529 14:97680697-97680719 AGGGAGTAGGGGGCTAGGGAAGG + Intergenic
1121920041 14:97872164-97872186 ATGGAACAGTGGGCTAAGGAAGG + Intergenic
1121956928 14:98222872-98222894 ATGGGGCTGGGGGATGTGGATGG - Intergenic
1122121144 14:99554133-99554155 ATGGGGCAGGGGACTGAAGCTGG - Intronic
1122253902 14:100462953-100462975 AAGGAGCAAGGGGGAGAGGAAGG - Intronic
1122253918 14:100463008-100463030 AAGGAGCAAGGGGGAGAGGAAGG - Intronic
1122329909 14:100904955-100904977 ATGGACCAGGGGGTAGAGGGAGG + Intergenic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1122785897 14:104163106-104163128 CTGGAACAGGAGGCTGAGGCTGG + Intronic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122802244 14:104237533-104237555 CTGGAGCAGGGCTCTGAGCATGG + Intergenic
1122803583 14:104245253-104245275 ACAGAGCAGGAGGCTGAGGCTGG + Intergenic
1122856038 14:104560730-104560752 CTGGGGCAGGGGGGTGAGGGCGG - Intronic
1122982035 14:105196361-105196383 ATCCAGCAGGGAGCAGAGGAAGG + Intergenic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1202835155 14_GL000009v2_random:72385-72407 ATGAATCTGGGGTCTGAGGATGG + Intergenic
1124140434 15:27072678-27072700 TGGGAGCCAGGGGCTGAGGAAGG - Intronic
1124168923 15:27354548-27354570 ATTCACCAGGGGCCTGAGGAAGG + Intronic
1124804475 15:32867616-32867638 GGGGGGCAGGGGGCTGAGGCAGG - Intronic
1124963190 15:34413377-34413399 ATTGATCAGGGGGCTGTGCAGGG + Intronic
1124979812 15:34559603-34559625 ATTGATCAGGGGGCTGTGCAGGG + Intronic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125758124 15:42079598-42079620 CTGGAGCTGCGGGCTGAGCAGGG - Exonic
1126097096 15:45097566-45097588 ATGGAGCAGGGAGCTCAGGATGG - Intronic
1126184473 15:45818614-45818636 ATGGGGCGGGGGGATGGGGAAGG - Intergenic
1126522042 15:49605919-49605941 CTGGAGCTTGGGGCTGTGGAGGG + Intronic
1128044032 15:64601223-64601245 ATGGACGATGAGGCTGAGGAAGG + Intronic
1128156888 15:65396761-65396783 ATAGAGCAGGGGGAGGTGGACGG - Intronic
1128367080 15:67012128-67012150 ATGCAGCAGGTAGCTGAGGGTGG - Intergenic
1128515223 15:68337815-68337837 CTGGAGCAGGGGGCAGAAGTGGG - Intronic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1128712020 15:69879105-69879127 ATTGCGGATGGGGCTGAGGAAGG - Intergenic
1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG + Intergenic
1128733294 15:70035075-70035097 AAGGATGAGGGGGATGAGGAAGG - Intergenic
1128735886 15:70053681-70053703 GTGGAGCTGGAGGCTCAGGAAGG + Intronic
1129145885 15:73646811-73646833 ATGGAGGAGGGGGAGGGGGAGGG + Intergenic
1129675889 15:77632391-77632413 ACGGAGGAGGGGGCTGGGCAGGG - Exonic
1129712100 15:77825672-77825694 ATGGAGCCTGGACCTGAGGAAGG + Intergenic
1129748047 15:78038668-78038690 TTAGAGTTGGGGGCTGAGGAAGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1129953774 15:79614824-79614846 AGAGAGAAGGCGGCTGAGGATGG + Intergenic
1130927583 15:88396940-88396962 ATGCAGCTGGGGACTGAGGCAGG - Intergenic
1130959836 15:88652411-88652433 AAGGAGGAGGGGGAGGAGGAGGG - Intronic
1130959861 15:88652472-88652494 AAGGAGGAGGGGGAGGAGGAGGG - Intronic
1131092146 15:89631341-89631363 GTGGAGGTGGGGGCTGGGGAGGG - Intronic
1131108424 15:89749967-89749989 ATGGAGGGAGGGGCTGAGAAGGG + Exonic
1131252110 15:90837720-90837742 AGAGAGAAGGGGGCTGAGAAGGG - Intergenic
1131571173 15:93538045-93538067 GTGGATCAGGGGGTTGGGGAAGG - Intergenic
1131765711 15:95673665-95673687 ATGTTGCTGTGGGCTGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132036411 15:98488530-98488552 TTGGGTCAGGGGGCTGGGGAAGG + Intronic
1132217929 15:100081069-100081091 TTGGGTCAGGGGGCTGGGGAAGG + Intronic
1132236246 15:100224096-100224118 TTGGGTCAGGGGGCTGGGGAAGG - Intronic
1132327906 15:100987160-100987182 ATGTAGCATAGGGCTGAGGCTGG - Intronic
1132467437 16:83912-83934 ATGGAGCAGTGGGCACAGCAGGG + Intronic
1132495504 16:261429-261451 CTGCAGCAGAGGGCTCAGGATGG - Exonic
1132572182 16:648982-649004 GTGGAGCAGGGGCCTCTGGACGG + Intronic
1132574921 16:659834-659856 CCGGTGCAGGGGCCTGAGGACGG + Intronic
1132628822 16:906343-906365 TTGGGTCAGGGGGCTGGGGAAGG + Intronic
1132657953 16:1049127-1049149 GTGCAGCAGGCGGCCGAGGAGGG - Intergenic
1132689608 16:1176658-1176680 AGTGAGCAGGGGGCTGATGGGGG + Intronic
1132709159 16:1258841-1258863 ATGGAGGAGGGGGCTCAGGATGG - Exonic
1132756834 16:1489505-1489527 AGGAGGCAGGAGGCTGAGGAAGG - Intergenic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1132880396 16:2159538-2159560 TTGGGCCAGGGGGCTGAGGCAGG + Intronic
1132986098 16:2768410-2768432 CTGGGGCAGGGGGCGGAGGGAGG + Intronic
1132989798 16:2786859-2786881 ATGGGGGAGGGGGATGAGGGAGG - Intronic
1132989827 16:2786932-2786954 GAGGAGGAGGGGGGTGAGGATGG - Intronic
1132989907 16:2787190-2787212 GAGGAGGAGGGGGCTGAGGATGG - Intronic
1133084004 16:3347281-3347303 GTGGCTCAGGAGGCTGAGGAGGG + Intergenic
1133095670 16:3443517-3443539 ATGGCGGAGAGGGCTGAGGGCGG - Exonic
1133143318 16:3764386-3764408 ATGGCTCAGGAGGCTGAGGTGGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1134455573 16:14392926-14392948 GTGGTGCAGGAGGCTGAGGAGGG + Intergenic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135554137 16:23421737-23421759 ATGTGTCAGGAGGCTGAGGAAGG + Intronic
1136240041 16:28937973-28937995 ATGGGGGATGGGGCTCAGGATGG - Intronic
1136403613 16:30031123-30031145 AGGGGGCAGGGGGCTGGGCACGG - Exonic
1136539928 16:30923583-30923605 AAGGAGGAAGGAGCTGAGGAGGG + Intronic
1136591350 16:31219543-31219565 CCTGAGCAGGGGGCTGAGGCAGG - Intronic
1136776180 16:32873011-32873033 CTGGGGCAGGGGGCTGGAGATGG + Intergenic
1136894435 16:33988501-33988523 CTGGGGCAGGGGGCTGGAGATGG - Intergenic
1137030107 16:35515412-35515434 ATACAACAGGAGGCTGAGGATGG + Intergenic
1137270424 16:46899425-46899447 CTGGGGCAGAGGGCTGGGGAGGG + Intronic
1137557030 16:49477239-49477261 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1137557041 16:49477263-49477285 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1137717795 16:50609477-50609499 ATGGTGCAAGGGTCTGCGGAGGG + Intronic
1137824479 16:51479401-51479423 AGGGAGCAGAGGGCTGAAGGAGG - Intergenic
1137933438 16:52610177-52610199 ATGGGGCAGGGGGCCAAGCATGG + Intergenic
1138252174 16:55509522-55509544 AGGGGGCATGGGTCTGAGGAGGG + Intronic
1138475827 16:57270259-57270281 ATGGACTCGGGGGCTGGGGATGG - Intronic
1138538150 16:57670940-57670962 GTGGTGCTGGGGGCTGAGGCGGG - Intronic
1138578481 16:57923915-57923937 AGGGAGCCTGGGGCTCAGGAGGG - Intronic
1138624260 16:58236658-58236680 ATGGGGAAGGGGGTTGAGGGAGG + Intronic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1139656855 16:68393112-68393134 ATGGACCAGGAGGCTGGGCATGG + Intronic
1139898500 16:70308363-70308385 GTGGCGCAGGAGGCTGAGGCAGG - Intronic
1140411766 16:74745402-74745424 CTGGGGCAGGGGGTTGGGGAGGG - Intronic
1140602819 16:76499177-76499199 ATTGTGCAGGAGGCTGAGGCAGG - Intronic
1140725565 16:77808465-77808487 ATGGAGCAGGGGTGGGAGGATGG - Intronic
1140869410 16:79092848-79092870 ATGGAGCTGGGGGGTTATGAGGG - Intronic
1140913830 16:79477292-79477314 CTGGAGCATGGGTTTGAGGATGG + Intergenic
1141151045 16:81564988-81565010 ATGGAGCAGGGGTCTCCAGAGGG + Intronic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141647799 16:85376766-85376788 AGAGAGCAGGGGGCTGGGGCTGG + Intergenic
1141647808 16:85376792-85376814 ATGGAGGTGGGGGCTGTGAAGGG + Intergenic
1141657522 16:85423995-85424017 ATGCAGGTGAGGGCTGAGGAGGG - Intergenic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1141700541 16:85640140-85640162 ATGGTGCAGGGAGCTGGGGTTGG + Intronic
1142191752 16:88721345-88721367 GAGGAGCAGGGAGCCGAGGAGGG - Exonic
1142212198 16:88813482-88813504 CTGGAGGAGGGGCCTGGGGAGGG + Intergenic
1142256463 16:89015920-89015942 CAGGAGCAGGGGGCTGAGGAGGG + Intergenic
1142341478 16:89525813-89525835 CTGCAGCACGGGACTGAGGATGG - Intronic
1203078596 16_KI270728v1_random:1135120-1135142 CTGGGGCAGGGGGCTGGAGATGG + Intergenic
1142611641 17:1111738-1111760 AGGGAGCAGAGGGCTGAGGCTGG - Intronic
1142738206 17:1915077-1915099 AGAAAGCAGGGGGCTGGGGACGG - Intergenic
1142968330 17:3594801-3594823 AGGGGGCAGGGTGCTGAAGAGGG + Intronic
1143015573 17:3889676-3889698 TTGGAGCTGGGGGCAGAGGTGGG - Intronic
1143108093 17:4539379-4539401 ATGGAGGCAGGGGCTGAGGGGGG + Intronic
1143139575 17:4733737-4733759 ATGCAGGAGAGGGCTGAGGTGGG + Exonic
1143275965 17:5710992-5711014 AGGAAGCAGGGTGCTGGGGATGG - Intergenic
1143335813 17:6170800-6170822 ATGGGGCAGCCGGCTGGGGAAGG - Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143380563 17:6493575-6493597 ACGTAGCAGGGTGCTGGGGAGGG + Intronic
1143513478 17:7408114-7408136 AGGGAGGAGGGGGTTGGGGAGGG - Intronic
1143651066 17:8264615-8264637 AGGAGGCAGGGGGCAGAGGAAGG - Intronic
1143778945 17:9219377-9219399 ATGGAGCAGGGGTGTCATGAAGG + Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1143994808 17:10997229-10997251 CTGGGGCAGAGGGCTGGGGAAGG - Intergenic
1144004970 17:11091384-11091406 GTGGTGCTGGGGGCTGAGGAGGG + Intergenic
1144131513 17:12251191-12251213 ATAGAGGAGGTGGCTGGGGATGG + Intergenic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144317969 17:14081998-14082020 GTGGGGCAGGGGGCTGTGAAAGG + Intronic
1144321630 17:14128680-14128702 AGGGAGCAGGGTGCTTAAGAAGG + Intronic
1144419869 17:15086719-15086741 AAGGAGGAGGGGGTTGAGGGAGG + Intergenic
1144524361 17:15977870-15977892 TTGGAGCCGTGGGCTGTGGAGGG - Exonic
1144625179 17:16840796-16840818 CTGAAGCAGGGGGCTGAGGGTGG + Intergenic
1144881252 17:18431925-18431947 CTGAAGCAGGGGGCTGAGGGTGG - Intergenic
1145150980 17:20512461-20512483 CTGAAGCAGGGGGCTGAGGGTGG + Intergenic
1145374887 17:22338120-22338142 ATGGAGGAGGGGGCTGATGCAGG + Intergenic
1146009060 17:29179877-29179899 AGAGAGCGGGGCGCTGAGGAAGG - Intronic
1146453783 17:32994380-32994402 ATGGAGCAAGGAGCAGAGGGGGG + Intronic
1146535453 17:33646903-33646925 ATGGCGCAGGGGGCAGAGCTGGG + Intronic
1146750559 17:35374276-35374298 ATGGAGCCTGCGGCTGAGGCAGG + Intergenic
1146862919 17:36320892-36320914 ATGGGGTAGGGGGCTGGGGGAGG - Intronic
1147093248 17:38124975-38124997 ATGGGGTAGGGGGCTGGGGGAGG - Intergenic
1147103959 17:38195513-38195535 ATGGGGTAGGGGGCTGGGGGAGG + Intergenic
1147160891 17:38568925-38568947 ATGGGGCAGGGGTCGGAGGAGGG + Intronic
1147579333 17:41619495-41619517 CTGAAGCAGGGGGCTGAGGCTGG + Exonic
1147614471 17:41820084-41820106 CTGGGGCAGGGGGCAGGGGAAGG - Intronic
1147657496 17:42098968-42098990 CTGGCGCTGGGGGCGGAGGAGGG - Intergenic
1147996058 17:44361064-44361086 ATTGTGGAGGGGGCTGGGGAGGG + Intronic
1148425532 17:47592896-47592918 ATGGGGTAGGGGGCTGGGGGAGG - Intronic
1148456335 17:47813419-47813441 AAGGTGCAGGGTACTGAGGACGG + Intronic
1148792036 17:50178575-50178597 GTGCAGCAGGGGGCTGAGGCCGG - Intergenic
1148844203 17:50519131-50519153 ATGGAGGAGGGGGCGGGGGCAGG + Intronic
1148885107 17:50766809-50766831 ATGGGACAGGGGGCTGGGGAAGG - Intergenic
1149131705 17:53309971-53309993 ATGGAGTGGGGGGCTGGGGTAGG + Intergenic
1149584224 17:57774568-57774590 ATTGAGCATTGGGCTCAGGAGGG - Intergenic
1149772705 17:59333265-59333287 ATGGAGCTGGGGACAGGGGATGG - Intronic
1149868180 17:60162034-60162056 AGGGACCAGGGGGATGGGGAGGG - Intronic
1149893693 17:60412421-60412443 GGGGAGCAGGTGGCTGAGGCAGG + Intronic
1150531190 17:65983594-65983616 ACGGAGCAGGAGGGAGAGGAAGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151328333 17:73392180-73392202 ATGGGGCAGGGGGTGGGGGAGGG + Intronic
1151431458 17:74066300-74066322 TTGAAGCAGGGAGCTGAGGAAGG + Intergenic
1151438719 17:74114645-74114667 ATTGAGCCTGGGGCAGAGGAGGG - Intergenic
1151479099 17:74359912-74359934 GAGGAGCCGGGGGCTGAGGAAGG + Intronic
1151516409 17:74599014-74599036 AGGGAGCAGGTGACAGAGGAGGG + Intergenic
1151678968 17:75614105-75614127 AGGGGGCAGGGGGCTGAGGAAGG - Intergenic
1151815118 17:76467997-76468019 AGGGAGCCGGGGGCTGCAGAGGG - Intronic
1151928317 17:77214627-77214649 GTGGGGCCGGGGGCTCAGGAGGG + Intronic
1152169875 17:78738353-78738375 AGAGAGCAGGGTGCGGAGGATGG - Intronic
1152221762 17:79072636-79072658 ATGAAGGAGGAGGCAGAGGAAGG + Intergenic
1152237634 17:79146846-79146868 AGGGGGCAGAGGCCTGAGGAGGG + Intronic
1152238377 17:79149958-79149980 ATGGGGATGGGGGCTGAGGGTGG + Intronic
1152380246 17:79938578-79938600 CTGGAGCAGGCGGGTGGGGAAGG + Exonic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1152829198 17:82486695-82486717 GTGGAGCTGGGGCCTGAGGAAGG + Intronic
1153451376 18:5233286-5233308 ATGGACCAGGCAACTGAGGATGG + Intergenic
1154309141 18:13254141-13254163 ATGGAGCTGAGGGCTGAACACGG + Intronic
1154334516 18:13455083-13455105 CAGGAGCTGGGGGCTGGGGAGGG + Intronic
1154498534 18:14980677-14980699 CTGGAGCAAGGGGATGAGGATGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155299983 18:24420237-24420259 AGGGTGCATGGTGCTGAGGAAGG + Intergenic
1155738269 18:29251801-29251823 AAGGAGCAAGGAACTGAGGAAGG + Intergenic
1156472007 18:37383264-37383286 GTGAAGCAGGAGGCTCAGGAAGG + Intronic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157287299 18:46385709-46385731 TTGGAGCAAGAGGCTGGGGAGGG - Intronic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1157616920 18:48992499-48992521 ATGAGGCAGGAGGCAGAGGAGGG - Intergenic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1158406592 18:57165452-57165474 ATGGAGGAGGGAGGTGAGGTGGG - Intergenic
1158416944 18:57256971-57256993 AGGGAGCAGGAGGCTGGGCAGGG + Intergenic
1158488976 18:57893178-57893200 AAGGAGCAAGGGGCTGGAGATGG + Intergenic
1159000596 18:62971548-62971570 ATGGAGCTGGGGGCTGAAGGAGG - Intronic
1159797543 18:72863186-72863208 ATACAGCAGGAGGCTGAAGAGGG - Intronic
1160583750 18:79901570-79901592 AGGAAGCAGGAGGCCGAGGAGGG - Intergenic
1160587984 18:79923195-79923217 ATGGACAGGGGGGCTGTGGACGG + Intronic
1160659793 19:292536-292558 CTGGGGCAGGGGGCTGATGGTGG - Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1160972231 19:1774726-1774748 ATGGAGAAGGGGGCTGGAGGGGG + Intronic
1161310766 19:3592916-3592938 ATGGGCCTGGGGGCTGAGGTTGG - Exonic
1161497962 19:4597857-4597879 AGAGAGGAGGGGGCTGAGGAAGG + Intergenic
1161507390 19:4651133-4651155 ATGGAGCTGTGGGGTGAGGGTGG + Intronic
1161560741 19:4971283-4971305 ACAGGGCAGGAGGCTGAGGAAGG - Intronic
1161605809 19:5214326-5214348 CTGGGGCTGGGGGCTGAGGGTGG - Intronic
1161619647 19:5291335-5291357 ATGGAGGAGGGGGCTGGGCTGGG + Intronic
1161688817 19:5718946-5718968 ATGGGACAGGAGGCTTAGGAGGG - Intronic
1161770837 19:6229999-6230021 ATGGAGGAGGGGGGCGTGGAGGG - Intronic
1162145970 19:8612076-8612098 CTGGAGTAGGGGGTGGAGGAGGG + Intergenic
1162149351 19:8633751-8633773 AGGGAGCAGGGTCCTGGGGAGGG + Intergenic
1162441159 19:10692936-10692958 ATTCAGCTGGGGGATGAGGATGG + Intergenic
1162490448 19:10988056-10988078 TGGGAGCAGGGAGGTGAGGAAGG - Intronic
1162565922 19:11445893-11445915 AAGGAGCAGGGGGCTTCAGAGGG + Intronic
1162947023 19:14050209-14050231 ATGAAGCAAGGGGCTGGGCAAGG + Intronic
1162971616 19:14184147-14184169 AGGAAGCAGGGGGCTGGGGGCGG - Intronic
1163118553 19:15202097-15202119 GTGGGGGTGGGGGCTGAGGAAGG - Intergenic
1163124309 19:15236513-15236535 ATGGAGTAGGGGGGACAGGATGG + Exonic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163493170 19:17629189-17629211 ATGCTGAATGGGGCTGAGGAGGG + Intronic
1163560191 19:18014401-18014423 GGGGAGCAGGGGGCTGGGGCTGG + Intergenic
1163636106 19:18437837-18437859 GTGGACCAGGGGGCTGAGGAAGG - Intronic
1164137655 19:22428392-22428414 AGGGACCAGCGGGCGGAGGAGGG - Intronic
1164752225 19:30665501-30665523 ATGGCCCTGTGGGCTGAGGAGGG + Intronic
1165166857 19:33863190-33863212 CTGGAGCAGGGGCCTGGAGAGGG + Intergenic
1165221954 19:34323737-34323759 ATGGAGCAGGGGACCAAGGCAGG - Intronic
1165352708 19:35284867-35284889 AGGGAGCAGGGGGCTAGGAAAGG - Intronic
1165421476 19:35724108-35724130 ATAGAGAAGGTGGCTGAGGGCGG + Intronic
1165455718 19:35909435-35909457 CTGGAGCCTGGGGCTGGGGAAGG + Intergenic
1165757957 19:38305038-38305060 AGGGGGCAGGGAGCTGGGGACGG - Intergenic
1166074443 19:40405495-40405517 AGGGACTAGGGGGCTGAGCAGGG + Intronic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166366108 19:42279310-42279332 CTGGGGCAGGTGGGTGAGGAAGG + Intronic
1166379676 19:42349428-42349450 AGGTATCAGGGGTCTGAGGAAGG + Intronic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1166695897 19:44851304-44851326 AGGGAGCAGGGGACTGAGGCTGG - Intronic
1166827140 19:45616627-45616649 ATGGAGCTGGGGACTGTTGAGGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167004621 19:46767340-46767362 TTGGAGGAGGTGGCAGAGGAGGG + Intronic
1167209252 19:48122790-48122812 TTGCAGCAGGGGGCTGGGGTGGG + Intronic
1167357337 19:49012017-49012039 AGGAAGCAGGGGGATGTGGAGGG + Intronic
1167466077 19:49651682-49651704 GCGGAGCGGGAGGCTGAGGAAGG - Exonic
1167560278 19:50222904-50222926 AGCGAGCAGGGGGCTGAGCTGGG + Intronic
1167642027 19:50687280-50687302 ATGGGGCTGGGGGGTGAGGTGGG + Intronic
1167725934 19:51212486-51212508 ATGGCCATGGGGGCTGAGGATGG - Intergenic
1167736728 19:51299153-51299175 GTGGCGCGGGGGGGTGAGGAAGG - Intergenic
1167767830 19:51496009-51496031 ATGGAGCATGGAGCAGAGGCAGG + Intronic
1168020145 19:53603285-53603307 ATGCGGCAGGGGGCCGAGTAGGG - Intronic
1168289091 19:55348262-55348284 ATGGACTAGGGGACTGAGGCTGG + Intergenic
1168354515 19:55692888-55692910 CTGGAGGTGGGGGCTGAGGCGGG + Intronic
1168384688 19:55953407-55953429 ATGGACCAGGTGGCGGGGGATGG - Intronic
1168465370 19:56597030-56597052 ATGGAGCAAGGGGCCCATGAAGG - Intronic
1168517112 19:57017662-57017684 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168517152 19:57017763-57017785 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1202637471 1_KI270706v1_random:54964-54986 ATGAATCTGGGGTCTGAGGATGG - Intergenic
924992798 2:328445-328467 AGGTAGCAGGGGGCTGAAGTGGG + Intergenic
925336896 2:3105274-3105296 AGGGAGCAGGGGGTTGGGGGTGG + Intergenic
925339377 2:3125739-3125761 AGGGCCCAGGGGGCTGAGGCAGG - Intergenic
925663295 2:6225199-6225221 ACGGAGCAGGGGGCACAGGGCGG - Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
925894416 2:8460322-8460344 ATGGAGCAGCGGGGGGTGGAGGG - Intergenic
926152526 2:10432884-10432906 CTGGGGCAGGAGGCTGGGGAGGG + Intergenic
926382072 2:12300978-12301000 GTGGAGCTGGGGGTGGAGGAAGG + Intergenic
926723911 2:15982874-15982896 GGGGAGCAGGGAGCTGAGGAGGG + Intergenic
927650349 2:24909220-24909242 ATGGTGCAGGAGGCTGGTGAGGG - Intronic
927654691 2:24935345-24935367 AGGGGGCAGGGGGCAGAGCAGGG + Intergenic
927683310 2:25154363-25154385 AAGGAGATGGGGTCTGAGGAGGG + Exonic
927699602 2:25259396-25259418 ACTGAGCAGGGCGCTGAGCAGGG + Intronic
928260083 2:29758620-29758642 AGGGAGGAGGGAGCCGAGGAGGG - Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928584955 2:32750174-32750196 ATGAAGCAGGGGCTTGTGGAGGG + Intronic
929090298 2:38209963-38209985 ATGGGGTGGGGGGCTGGGGAGGG + Intergenic
929119869 2:38475898-38475920 ATGGTGGAGGGGGCTGGGCATGG - Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929526365 2:42706972-42706994 GAGGAGGAGGGGGCTGGGGAGGG - Intronic
929762180 2:44815551-44815573 AGGAGGCAGGGGGCTGAGGAAGG + Intergenic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
930721393 2:54641667-54641689 ATGGGGCAGGGGGCGGGGGTGGG - Intronic
930846905 2:55916398-55916420 ATGAAGCAAGGGGCTGGGCACGG - Intronic
931177742 2:59870637-59870659 AAGGAGGAGGGTGCTGAGGAGGG - Intergenic
931339889 2:61390284-61390306 AAAGAGCTGAGGGCTGAGGAAGG + Intronic
931494470 2:62787399-62787421 ATGGAGCAAGGGGGTGGGGGGGG - Intronic
931806752 2:65814561-65814583 AAAGAGCAGGAGGCCGAGGAGGG + Intergenic
932438882 2:71719326-71719348 ACAGGGCAGGGGGCTGAGGAAGG - Intergenic
932446541 2:71785303-71785325 ATGGTGCAGGGTGGGGAGGACGG + Intergenic
933043588 2:77503318-77503340 ATGGAGTATGAGGGTGAGGATGG + Intronic
933302644 2:80559828-80559850 TTGCTGCAGGAGGCTGAGGAGGG + Intronic
934038831 2:88110855-88110877 ATGGAGGAGGGTGCAGAGGAGGG + Exonic
934045512 2:88170258-88170280 ATGGGGCGGGGGGCGGGGGACGG - Intergenic
934567676 2:95349593-95349615 ATGGACAAGGGGGCTGAGCCCGG + Intronic
934650661 2:96089657-96089679 AGGAGGCAGGGGGCGGAGGAAGG - Intergenic
934767053 2:96885504-96885526 ATGGCGCATGGGGCTGGGGAGGG + Intronic
934991088 2:98921938-98921960 GTGGAGCAAGGGGCATAGGAGGG - Intronic
935543161 2:104373417-104373439 ATGAAGCTTGGGCCTGAGGATGG - Intergenic
935831050 2:107000731-107000753 AAGGAGCAGGGGGCCAGGGAGGG + Intergenic
936373080 2:111919252-111919274 GTGGGCCAGGGGGCTGCGGAAGG - Intronic
936461984 2:112721026-112721048 AGTGTGCAGGAGGCTGAGGAAGG + Intergenic
937138565 2:119577277-119577299 ATGGAGGTGGGGACTTAGGAAGG - Intronic
938073961 2:128322332-128322354 CTGGAGGAGGCGGCTGCGGACGG - Intergenic
938198590 2:129354633-129354655 ATGGAAAAGGGAGCTGAGTAAGG - Intergenic
938289660 2:130142552-130142574 ATGGAGAATGGGGTTGAGGGAGG - Intronic
938291524 2:130153253-130153275 AGGGAGGAGGGAGCTGGGGACGG + Intronic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938811920 2:134861801-134861823 CTGGGGCTGGGGGCTGAGGGGGG + Intronic
939056111 2:137366240-137366262 ATGGGGTGGGGGGATGAGGATGG + Intronic
939251303 2:139684607-139684629 ATAGAGCTGGAGCCTGAGGAGGG + Intergenic
939934526 2:148274370-148274392 ATGGGGTGGGGGGCTGGGGAGGG - Intronic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
940192695 2:151059277-151059299 ATTGCTCAGGAGGCTGAGGAGGG - Intergenic
941153172 2:161940473-161940495 TAGGAGCAGGGAGCTGAGCATGG - Intronic
942115672 2:172726695-172726717 AGGGAGCAAGTGGCCGAGGAAGG + Intergenic
944256662 2:197629444-197629466 ATGGGGCAGGGGGATGGGGGAGG + Intronic
944307287 2:198193220-198193242 ATAGAGCAGGCGCCTTAGGAAGG - Intronic
944528366 2:200642974-200642996 TTGGAGCAGGAGTCTGAGTAAGG - Intronic
945582606 2:211614276-211614298 AGGTAGTAGGGGGCTGGGGATGG + Intronic
945975182 2:216264943-216264965 GTAGAGCAGGGAGCAGAGGAAGG - Intronic
946006470 2:216529493-216529515 CTGGAGCTGGGGGCTGGGGCAGG - Intronic
946022751 2:216652664-216652686 AGAGAGCAGGGGGAGGAGGATGG + Intronic
946073434 2:217053820-217053842 GTGGAGGAGGGGGCTGTGGGTGG - Intergenic
946370517 2:219279018-219279040 CTGGAGCTGGGAGCTGAAGAAGG + Intergenic
946422844 2:219574729-219574751 CTGGCCCAGGAGGCTGAGGAGGG + Exonic
946435436 2:219648889-219648911 AGGAAGCAGGGGGTTCAGGAGGG + Intergenic
946757990 2:222965739-222965761 ATCCTGCAGGGGGCTGTGGAAGG + Intergenic
947372762 2:229465418-229465440 TGGGACCAGGGGGCTGAGGGAGG + Intronic
947811156 2:233004713-233004735 AGGGAGCAGGGGGAAGGGGAGGG - Intronic
947891154 2:233621872-233621894 ATGGGGTGGGGGGCTGAGGAAGG - Intronic
948091938 2:235302199-235302221 AGGGGGGAGGGGGATGAGGAGGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948262242 2:236613015-236613037 ATGGAGCAGAGGGAGGAGGGCGG - Intergenic
948359762 2:237412001-237412023 GTGGAGCAGAGGGCTTGGGAAGG - Intronic
948428327 2:237902324-237902346 AGGGATCAGGGGGTGGAGGAGGG + Intronic
948607725 2:239146729-239146751 GTGGAGCAGAGGCCTGTGGAAGG - Intronic
949062639 2:241969994-241970016 ATGGGGCATGGGGTTGATGACGG + Intergenic
949062698 2:241970207-241970229 ACGGAGCTTGGGGCTGATGATGG + Intergenic
1168765548 20:379923-379945 ATGGAGCAGGAAGTTGAGGCAGG + Intronic
1168819873 20:765589-765611 ATGGAGCAGGGTGACCAGGAGGG + Exonic
1169038088 20:2470199-2470221 ATGGAGAGGAGGGCGGAGGAGGG - Intronic
1169704619 20:8488367-8488389 ATGTAGGATGGGGCAGAGGAAGG - Intronic
1170733525 20:18994028-18994050 ATGTAGCAGGGGACTGTGGCTGG + Intergenic
1170787345 20:19479039-19479061 ATGTAGCAGGTCTCTGAGGATGG + Intronic
1171323403 20:24267301-24267323 AGTGTGGAGGGGGCTGAGGAAGG - Intergenic
1171406379 20:24914858-24914880 AGGGAGCTGAGGCCTGAGGATGG - Intergenic
1171406392 20:24914899-24914921 AGGGAGCTGAGGCCTGAGGACGG - Intergenic
1171411517 20:24951349-24951371 ACAGAGCAGGGGGCTGAGGCTGG - Intronic
1171414016 20:24965429-24965451 CAGGAGCATGGGGCTGAGCAGGG + Intronic
1171466129 20:25329172-25329194 ATGAAGCAGGGGCCTGGGCAGGG - Intronic
1171527912 20:25830291-25830313 ATGGAGGAGGGGGCAGGTGAAGG - Intronic
1171548914 20:26025589-26025611 ATGGAGGAGGGGGCAGGTGAAGG + Intergenic
1171884050 20:30639055-30639077 ATGAATCTGGGGTCTGAGGATGG - Intergenic
1171958695 20:31478014-31478036 TTGGGGGAGGGTGCTGAGGATGG - Intronic
1171973908 20:31581700-31581722 AGGAAACAGGGTGCTGAGGATGG - Intergenic
1172125914 20:32625239-32625261 ATGGAGGAGGGTTCTGAGAAAGG - Intergenic
1172225523 20:33302810-33302832 AGGGAGCAGGGAGCCCAGGAAGG + Intronic
1172425400 20:34852267-34852289 AGGGAGCTGGGGGCCGAGGTGGG + Exonic
1172620640 20:36316300-36316322 AAGCAGGAGGGGGCTGTGGAAGG - Intronic
1172946475 20:38693328-38693350 GTGGTGCAGGGAGCTGGGGAGGG - Intergenic
1173143719 20:40506796-40506818 ATGCAGCCGGGCGCTGTGGATGG + Intergenic
1173337999 20:42128719-42128741 ATGGGGCTGGGGGCTGGGGCTGG - Intronic
1173396219 20:42682631-42682653 ATGGAGCTGAGGGCTGAGCTGGG + Intronic
1173613824 20:44389912-44389934 AAGCTGCAGGGGGCTGGGGAGGG + Intronic
1173615426 20:44400340-44400362 AGGGAGGAGGGGGAAGAGGATGG + Intronic
1173790431 20:45824494-45824516 ATCGAGGAGGTGGATGAGGACGG - Exonic
1174098278 20:48106895-48106917 ATTGAGCAGGGGAGTGAGAAGGG - Intergenic
1174149387 20:48475476-48475498 ATGGAGCTGGAGACTCAGGAAGG - Intergenic
1174260074 20:49287687-49287709 ATGTAACAAGGAGCTGAGGATGG - Intergenic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1175058663 20:56221349-56221371 ATGGAGCAGGTGACTCAGGAAGG - Intergenic
1175254196 20:57629109-57629131 ATGGAGCAGGGGGCGGCGCTCGG - Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175829081 20:61952268-61952290 ACGGCACAGGGGGCTGAGCAGGG - Intergenic
1176059776 20:63167530-63167552 GCGGAGGTGGGGGCTGAGGAGGG - Intergenic
1176304111 21:5114424-5114446 GTGGAGCAGGGGACTGAGTGTGG + Intergenic
1176892362 21:14333165-14333187 GTGGAGCGGGGGGCGGTGGAGGG - Intergenic
1177122721 21:17157745-17157767 ATGGGGTAGGGGGCTGGGGGAGG + Intergenic
1177153940 21:17482607-17482629 ATGAAGCAGGGGGCCCAGGGTGG + Intergenic
1177390653 21:20465848-20465870 CAGGAGCTGGGGGTTGAGGATGG - Intergenic
1177911123 21:27033656-27033678 ATGCAGCAAGGAACTGAGGATGG + Intergenic
1178842690 21:36150619-36150641 AGGAAGCAGGGGGCAGGGGAGGG - Intergenic
1179251939 21:39677934-39677956 CTGAAGCAGGGGGCGGGGGAAGG + Intergenic
1179548014 21:42125205-42125227 ATGGACCTTGGGGCTGAGTAAGG + Intronic
1179557390 21:42188527-42188549 AGGGAGAAGGGGGCTGGGCAAGG + Intergenic
1179816694 21:43910553-43910575 GTGGAGCGGAGGGCCGAGGAGGG + Intronic
1179852945 21:44147606-44147628 GTGGAGCAGGGGACTGAGTGTGG - Intergenic
1179890738 21:44333971-44333993 ATGGGGAGGGGGGCTCAGGACGG - Intronic
1179942827 21:44650765-44650787 ATGGGGCTGGGGGCTGGGAAAGG + Intronic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180059106 21:45375545-45375567 ATGGAGGAGGGGGAGGAGCAGGG + Intergenic
1180090461 21:45531279-45531301 ATGGGGCAGGGGGCGGGAGAGGG + Intronic
1180101459 21:45589638-45589660 AGGGTGCAGGAGGCTGAGGCAGG + Intergenic
1180144986 21:45913848-45913870 CTGGTGCAGGGGGCTGAGTGGGG + Intronic
1180676601 22:17590764-17590786 ATGGCTGAGGGGGCTGAGGCCGG + Exonic
1180956551 22:19743835-19743857 CTGGGCCAGGGGGCTGGGGATGG - Intergenic
1181001214 22:19988619-19988641 AGGTAGCTGGGGGCTGAGGCTGG - Intronic
1181431126 22:22882493-22882515 ATGGAGCAGGGGGAGGAGCCAGG - Intronic
1181455594 22:23058640-23058662 ATGGGGCATGGGGCTGAGGTTGG - Intergenic
1181645765 22:24231269-24231291 ATGGAGGAGGAGGCTGAGCTGGG + Intronic
1181863244 22:25835447-25835469 AGGAAGCAGGGGGCTGGGGATGG + Intronic
1181905652 22:26193596-26193618 TTGGTGCAGTGGGATGAGGATGG - Intronic
1182069902 22:27456192-27456214 ATGGAGCAGGGAGTTGAAGCTGG + Intergenic
1182126663 22:27821046-27821068 GTGGAGCAGGGAGCAGGGGATGG - Intergenic
1182293816 22:29301476-29301498 ATGGAGGTGGGGGCTGTGGGTGG - Intergenic
1182422036 22:30253427-30253449 GTGGAGCGGGGGGCTGGGGCGGG - Intergenic
1182550873 22:31100167-31100189 AGGGAGAAGGGGGCAGAGGGAGG - Intronic
1183064623 22:35354451-35354473 ACGGTGCAGGGTGCTGGGGAGGG - Intergenic
1183299482 22:37051903-37051925 CTGGCACAGGCGGCTGAGGAAGG - Exonic
1183374620 22:37456092-37456114 ATGCAGCAGGGGGCGGGGGTGGG - Intergenic
1183581536 22:38729373-38729395 TGGGAGAAGGGGGCTGAGGGTGG + Intronic
1183613085 22:38923787-38923809 AAGGAGGAGGGAGCAGAGGAAGG - Intergenic
1183613098 22:38923836-38923858 AAGGAGGAGGGAGCAGAGGAAGG - Intergenic
1184245595 22:43234441-43234463 ATGGGGCTGGGGGCTCTGGAAGG - Intronic
1184332063 22:43833524-43833546 GAGGAGGAGGGGTCTGAGGAGGG - Intronic
1184366801 22:44056943-44056965 GTGGAGCTGGGGGCTGAGCTGGG + Intronic
1184366810 22:44056967-44056989 GTGGAGCTGGGGGCTGAGCTGGG + Intronic
1184366819 22:44056991-44057013 GTGGAGCTGGGGGCTGAGCTGGG + Intronic
1184366828 22:44057015-44057037 GTGGAGCTGGGGGCTGAGCTGGG + Intronic
1184368418 22:44067564-44067586 ATGGAGCACTGGGCTGGCGAGGG + Intronic
1184533522 22:45071516-45071538 AGGGAGCAGGGGGCACCGGAAGG + Intergenic
1184561823 22:45268281-45268303 AAGGGGCAGGGGGTGGAGGATGG - Intergenic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
1184814980 22:46862433-46862455 AAGCAAGAGGGGGCTGAGGAAGG - Intronic
1185080100 22:48704948-48704970 ATGGTGCAGGGGGCTGGGGAGGG + Intronic
1185133621 22:49055871-49055893 AGGGTGGAGGGGGCAGAGGAAGG - Intergenic
1185220527 22:49627225-49627247 ATGGAGCATGGGTCTGTGGATGG - Intronic
1185346611 22:50313351-50313373 CTGGAGCAGGAGGCTGTGGCTGG - Intronic
1185360428 22:50403588-50403610 CTGGCGCAGGGGGCTGGGGCAGG - Intronic
1185415075 22:50705333-50705355 AGGGGGCAGGGATCTGAGGAGGG - Intergenic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950212042 3:11130851-11130873 CTGGAGGAGGGGGCTGGGCAAGG - Intergenic
950580417 3:13858334-13858356 AAGGGGCAGGAGGCAGAGGAGGG + Intronic
950694857 3:14690960-14690982 ATGGAGGTGAGGGCTGAGGAAGG - Intronic
950967585 3:17156630-17156652 TTGGACCAGTGGGCTGAGCAGGG + Intergenic
951537694 3:23754678-23754700 GGGGACCAGGGGGCTGAGGTGGG - Intergenic
951611259 3:24494881-24494903 CGGGAGGAGGGGGCGGAGGAGGG - Intronic
951813379 3:26726509-26726531 AAGGAGTAGAGAGCTGAGGAGGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952924808 3:38313147-38313169 CCGGAGCAGTGGGCTGTGGAAGG + Intronic
953097050 3:39788417-39788439 TTGCAGCAGGAGGCTGTGGATGG - Intergenic
953128255 3:40112250-40112272 GTGGAGGCGGGGGCGGAGGAGGG + Intronic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953929326 3:46998118-46998140 ATGGAGCAGGTGGCAGCTGAGGG + Exonic
953980454 3:47410669-47410691 GTGAAGGATGGGGCTGAGGATGG - Exonic
954697510 3:52435586-52435608 ACGTAGAAGGGGGCAGAGGAGGG - Exonic
954782848 3:53073515-53073537 ATGGAGCCACGGGCTGAGGCTGG + Intronic
955496138 3:59534755-59534777 ATGGAGCAGTGTGCCCAGGATGG + Intergenic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
956067191 3:65409347-65409369 ATGAAGAAGGGGGCAGAGGGAGG + Intronic
956409716 3:68966967-68966989 ATGGGGTGGGGGGCAGAGGAAGG + Intergenic
956751921 3:72350428-72350450 AGGGGACAGGAGGCTGAGGAAGG - Intergenic
956796282 3:72721759-72721781 ATGGGGCTGGGGACCGAGGAAGG - Intergenic
956869935 3:73406953-73406975 AGGGAGCATTGGGGTGAGGATGG - Intronic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
958770213 3:98417153-98417175 ATGGAGTAGGGGGATGGGGGAGG - Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959394465 3:105819918-105819940 ATGGACCAGGGGCATGGGGATGG + Intronic
959856184 3:111161686-111161708 ATGGAGCAGGGTACAGGGGATGG - Intronic
960034234 3:113086691-113086713 ATGGGGCATGGGGGTGTGGAGGG + Intergenic
960044873 3:113186902-113186924 GAGGAGCAGGAGGCTGAGGGCGG + Intergenic
960305184 3:116051818-116051840 ATGGTGCAGGGGGCTGGGGAGGG + Intronic
960518397 3:118627645-118627667 ATGCAGCCTGGGGCTGAGCATGG + Intergenic
961118554 3:124352863-124352885 GTGGGGTAGGGGGCTGAGGGAGG + Intronic
961260160 3:125595561-125595583 AGGGAGCAGGGGGCGGGGGGTGG - Intergenic
961392283 3:126559241-126559263 AGGTTGCAGGGGGTTGAGGAAGG + Intergenic
961432764 3:126894689-126894711 ACGGAGCAGGAGGCTGGTGAAGG + Intronic
961670462 3:128524566-128524588 AGGGAGAAGTGGGCTGAGCACGG + Intergenic
961687044 3:128640766-128640788 ATGGAGGAGGAGGCAAAGGAAGG - Intronic
961788101 3:129359434-129359456 CTGGGGCAGGGGGCAGAGGGGGG + Intergenic
961795245 3:129404203-129404225 ATGGAGCAGGAGGCCAAGGCAGG + Intronic
962060961 3:131926906-131926928 AAGGAGTAGGGGTCTGAGGATGG + Intronic
962274566 3:134002278-134002300 AGGCAGGAGGGTGCTGAGGACGG - Intronic
963074668 3:141334690-141334712 GTGGTGCCGGGGGCTGGGGAAGG - Intronic
963866365 3:150366430-150366452 CTGGAGGAGGGGGTTGAGGTGGG - Intergenic
964371877 3:156008681-156008703 AGGGGGTAGGGGGCTGGGGAAGG - Intergenic
965034966 3:163426160-163426182 ATGAAGCAGTGGGCTGGGAAAGG - Intergenic
966524929 3:180910384-180910406 GTGGGGCAGGGGGTTGAGGCGGG + Intronic
966711750 3:182979969-182979991 TTGGAGCCGGGAGCGGAGGAGGG + Intronic
966911941 3:184564660-184564682 TTGGTGCAGGGGGCTGGGGGTGG + Intronic
967240157 3:187430872-187430894 AGGAAGCAGGGGGCAGAGGTGGG + Intergenic
967751781 3:193123398-193123420 ACGCAGCTGGGAGCTGAGGAGGG + Intergenic
967914608 3:194569345-194569367 GTGGTGCAGGAGGCTGAGGTGGG + Intergenic
968312327 3:197694377-197694399 ATGTACCAGGAGGCTGAGCACGG - Exonic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
968518781 4:1026435-1026457 ATGGAGGCGGGGACTGAGGCGGG - Exonic
968523470 4:1045004-1045026 ATGGGGCAGGGGTCTGAGGCTGG - Intergenic
968593298 4:1470410-1470432 CTGGAGGAGGGGGCTGCGGCTGG + Intergenic
968750618 4:2387088-2387110 CTGGAGGAGGGGGCTGAGCCAGG + Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968919771 4:3516507-3516529 CTGAAGCAGGAGGCAGAGGATGG + Intronic
969285295 4:6199180-6199202 ATGGGGCGGGCGGCGGAGGAGGG + Intronic
969301367 4:6299268-6299290 GAGGAGCAGAGGGCTGAGGGAGG - Intronic
969306416 4:6328601-6328623 ATGGACAAGGGGGCTGTGGCAGG - Intronic
969464731 4:7349504-7349526 ATGGGGCAGGGGGCTGGGTGAGG + Intronic
969513473 4:7632860-7632882 ATGCTGGAGGGGGCAGAGGAAGG + Intronic
969711812 4:8849052-8849074 ATGGAGCAGCGGGCAGGGGGAGG - Intronic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
970779919 4:19724526-19724548 GGGGAGTGGGGGGCTGAGGAGGG - Intergenic
971190299 4:24421686-24421708 ATGGAGGCAGTGGCTGAGGAAGG - Intergenic
971358140 4:25913377-25913399 GTGGTGCAGAGGGCGGAGGATGG + Intronic
972179429 4:36445112-36445134 ATGGAATAGGGGGTTGAGTATGG + Intergenic
973112219 4:46410646-46410668 ATGGGGTGGGGGGCTGAGGGAGG + Intronic
973367716 4:49221329-49221351 ATGAATCTGGGGTCTGAGGATGG - Intergenic
973393339 4:49574100-49574122 ATGAATCTGGGGTCTGAGGATGG + Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
974710740 4:65591017-65591039 CTGGAGTAGGGGGTTGGGGAAGG - Intronic
974839292 4:67282863-67282885 ATGGAGCAGGGGGCAGTGCCTGG + Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975075768 4:70207357-70207379 GTGGGGTAGGGGGCTGAGGGAGG - Intergenic
975723287 4:77268744-77268766 ATGGAGGAGGGAGGTGAGCAGGG + Intronic
976938341 4:90667484-90667506 AGGGAGTGGGGGGCTGGGGAGGG - Intronic
977032043 4:91895651-91895673 AAGGGGCAGGGTGCTGTGGAAGG - Intergenic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977672253 4:99709383-99709405 AGGGACCAGGGGCCTGAGCAAGG - Intergenic
978245580 4:106568574-106568596 TTGGAGTAGGGGGCAGGGGAGGG - Intergenic
979472539 4:121117655-121117677 AAGGAGCAGAAGGCTGAGGCAGG - Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
981240562 4:142471843-142471865 ATGGAGGAAGGGGCTGGTGAAGG - Intronic
981920134 4:150078235-150078257 GCGGAGGAGGGGGCGGAGGAGGG - Intergenic
981920140 4:150078247-150078269 GGGGAGGAGGGGGCGGAGGAGGG - Intergenic
981932910 4:150209646-150209668 ATGGAGGAGGCAGCAGAGGAGGG - Intronic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982351714 4:154422719-154422741 ATGGAGCATGGGGCTGAGGGAGG - Intronic
983257536 4:165417125-165417147 ATGGATTAGGGGGCAGAAGAAGG + Intronic
983885456 4:172975687-172975709 CTGAGGCAAGGGGCTGAGGATGG - Intronic
984644652 4:182206407-182206429 ATGGGCCAGGGGGCTGCTGATGG + Intronic
984919221 4:184749265-184749287 AGGGGGCTGGAGGCTGAGGAAGG + Intergenic
1202764788 4_GL000008v2_random:140818-140840 ATGAATCTGGGGTCTGAGGATGG - Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985857959 5:2445617-2445639 ATGGAGCAGGATGCTCAGAAAGG - Intergenic
985939340 5:3121947-3121969 AGGGAGGAAGGGGCTGAGAAAGG - Intergenic
985966365 5:3341631-3341653 TGGGAGCAGGAGGCTGTGGAGGG - Intergenic
986007356 5:3678902-3678924 GTGTAGCACGGGGCTGGGGAGGG - Intergenic
986191470 5:5500319-5500341 ATGGACCAGCGTCCTGAGGAAGG + Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
986631607 5:9779197-9779219 ATGGAGCAAGGGAGAGAGGAAGG - Intergenic
987206415 5:15631558-15631580 ATGGGACAGGAGGCTGAGGAAGG + Intronic
988418765 5:30979371-30979393 AAGGATCTGGGGGGTGAGGAGGG - Intergenic
988830083 5:34978543-34978565 CTGGGGCTGGGGGCAGAGGAAGG + Intergenic
989149301 5:38282954-38282976 AGGGGGCTGGGGGCTGAGGTGGG - Intronic
989756199 5:44958680-44958702 AAGGAGGAGGAGGCAGAGGAGGG - Intergenic
990470658 5:56112213-56112235 ATGGAGGAGGTTGCTGAGGTGGG + Intronic
990479004 5:56189197-56189219 ATTGTGCAGGAGGCTGAGGCAGG + Intronic
990857455 5:60285702-60285724 TTGTAGCAGGGAGCTGAGGCTGG - Intronic
991312880 5:65264284-65264306 AGAGAGAATGGGGCTGAGGAAGG - Intronic
992080432 5:73231010-73231032 ATTGAGAAGGGGGCTGGGGCGGG - Intergenic
992263217 5:74991293-74991315 TTGGAGCAGAGGGTTAAGGAAGG - Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
993713571 5:91251916-91251938 ATGGCCCAGGGGGCTGGGCATGG - Intergenic
993813403 5:92510651-92510673 ATGGACCAGGGTTCTGTGGAAGG - Intergenic
993885167 5:93407587-93407609 ATGTGGCAGGAGGCTGAGGGTGG - Intergenic
994043586 5:95284572-95284594 GAGGAGCAGGGGGTGGAGGATGG - Exonic
996016696 5:118546962-118546984 TGGGAGCAGTGGGCTAAGGAGGG + Intergenic
996182117 5:120432088-120432110 ATGGTGGAGTGGGCTCAGGAGGG + Intergenic
997042846 5:130278097-130278119 ACTGAGTAGGGGGCTGAGGGCGG - Intergenic
997361410 5:133297636-133297658 AGGGAGCAGGAGGCTGTGGCTGG - Intronic
997443488 5:133925304-133925326 TTGGAGGTGGGGGCTGAGGTAGG - Intergenic
997444124 5:133928902-133928924 AGGGAGCAGCTGGCTGAGGGAGG - Intergenic
997528510 5:134568436-134568458 GTGGAGCCTGGGGCTGAGGTTGG + Intronic
997694688 5:135851864-135851886 AGGCTGCAGGAGGCTGAGGAGGG - Intronic
998001656 5:138630650-138630672 CTGGGGCAGGGGGCTGTGGTGGG - Intronic
998218357 5:140254633-140254655 ATGGACCAGGTGGCTGAGGTGGG - Intronic
998386492 5:141760150-141760172 AGGTGGCAGGGGGCTGAGGAGGG + Intergenic
998389428 5:141778129-141778151 ACTGAGCAGGGGGCTGAGCAGGG - Intergenic
998583442 5:143403586-143403608 ATGGAGGAGGCGGCGGCGGAGGG + Exonic
998604388 5:143618697-143618719 AAGGAGAAGGGGGCTGATGGTGG + Intergenic
999182671 5:149681109-149681131 GTGGAGCAGGGGAGGGAGGAGGG - Intergenic
999510086 5:152240964-152240986 ATGGGGCAGGGGGCTAGGGGAGG + Intergenic
999765531 5:154737876-154737898 ATGAAGGGGAGGGCTGAGGAGGG - Intronic
1000046460 5:157525617-157525639 ATAGAGTAGGGGCCTGTGGAGGG + Intronic
1000102187 5:158026623-158026645 ATGGAGCAGGAGGGAGAAGAGGG - Intergenic
1000209391 5:159096561-159096583 CAGGAACAGGGGGCGGAGGAGGG - Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1001332574 5:170772677-170772699 AGGGAGTATGGGGCTGAGGCAGG + Intronic
1001400730 5:171444997-171445019 ATGGAGCAGGGGAATGGGGTAGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1002018429 5:176345297-176345319 CTGGATCAGGCGGCTGCGGAAGG - Exonic
1002076684 5:176712626-176712648 ATGGAGCAGGGACCTGGGGCAGG + Intergenic
1002189294 5:177470430-177470452 GGGGAGCCAGGGGCTGAGGATGG - Intronic
1003098146 6:3157780-3157802 ATCGGGCAGGGGGCTGCGGCTGG - Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003146955 6:3517092-3517114 ATGGAGAGTGGGGCTGATGATGG - Intergenic
1003147011 6:3517260-3517282 ATGGAGAGTGGGGCTGATGATGG - Intergenic
1003296112 6:4830397-4830419 ATATAGCAGGGGGCTGGGGAAGG - Intronic
1003389825 6:5703977-5703999 AGGGAGGAGGCGGCAGAGGAAGG - Intronic
1003423036 6:5975081-5975103 GTGGAGCATGGGGGTGGGGAGGG - Intergenic
1003990705 6:11483575-11483597 CAGGAGGAGGGGGCTGAAGAAGG - Intergenic
1004460381 6:15829681-15829703 ATGTTGAAGGGGGTTGAGGAAGG + Intergenic
1004896208 6:20150389-20150411 ATGGTGCAGGGAGCTGTGGAAGG - Intronic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006088854 6:31616035-31616057 TTTCAGCAGGGGACTGAGGAAGG - Intronic
1006217690 6:32459552-32459574 GTGGTGCAGGGGGCTGGAGAAGG - Intergenic
1006252357 6:32798426-32798448 ATGAAGCAGAGGGCTAGGGATGG + Intergenic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006670781 6:35728593-35728615 GTGGAGTAGGGAGCCGAGGAAGG + Intergenic
1006911520 6:37566474-37566496 ATGGCGCAGAGGGGCGAGGAGGG - Intergenic
1006941213 6:37753510-37753532 CTGGAGCAGAGGTCTGAAGAAGG + Intergenic
1007014607 6:38452046-38452068 ATGGAACAGGGAGTAGAGGATGG - Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007372084 6:41432555-41432577 GTGGAGCAGGAGGCTGGGGTGGG - Intergenic
1007406840 6:41640222-41640244 GGAGAGCAGGAGGCTGAGGAAGG - Intronic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007694659 6:43724677-43724699 AAGGAGCAGGAGGCAGGGGATGG - Intergenic
1007725361 6:43912825-43912847 ATGGAGCATGGAGCCTAGGAGGG - Intergenic
1007784106 6:44270563-44270585 AAGGGGCTGGGGGCTGAGGGTGG - Exonic
1008073381 6:47119956-47119978 AAGGAGGAGGGGGAGGAGGAGGG + Intergenic
1008811137 6:55500774-55500796 CTGGAGAAGGTGGCTAAGGATGG + Intronic
1009978550 6:70700152-70700174 AAGGAGCAAGGGGCAGAGGGAGG - Intronic
1010390778 6:75334726-75334748 GTGGAGTAGGGGGCTGAGCAAGG - Intronic
1010428034 6:75748634-75748656 TTGGAGGAGGGGGCTTGGGATGG - Intergenic
1010451800 6:76012437-76012459 GTGAAGCAGGAGGCTGAAGATGG - Intronic
1010773039 6:79854423-79854445 GTGGGGCAGGGAGGTGAGGATGG + Intergenic
1011932255 6:92729065-92729087 ATGGGGTTGGGGGCTGGGGAAGG - Intergenic
1012180768 6:96149979-96150001 ATGGAGAAGGGGGGTAAAGAGGG - Intronic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013443152 6:110191772-110191794 TAGGGGCAGGGGGCTGATGATGG + Intronic
1013688882 6:112616697-112616719 ATGAAGCTGGGGACTGAGGTGGG - Intergenic
1014448425 6:121555924-121555946 TTGGTGCAGGAGGCAGAGGAGGG + Intergenic
1014574233 6:123050651-123050673 ATGGAGTAGGTGGTAGAGGATGG + Intronic
1015166491 6:130205592-130205614 ATGGAACTTGGGGCTGAGCATGG - Intronic
1015885201 6:137910686-137910708 AAGGAGGAAGGGACTGAGGATGG + Intergenic
1015891462 6:137973763-137973785 TTGGAGCAGGGGGTGGAGGATGG + Intergenic
1016199738 6:141394050-141394072 ATGGAGCTGGGGGCGGGGGGAGG + Intergenic
1016390042 6:143565645-143565667 ATGGAGCAGGGGCATTAGGTGGG + Intronic
1016750501 6:147626036-147626058 ATGGGGCAGGGAGTTGAGGGAGG + Intronic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017521944 6:155210133-155210155 TTGGAGAAGAGTGCTGAGGATGG + Intronic
1017641073 6:156494461-156494483 ATGGAGCTAGGGCCAGAGGACGG + Intergenic
1018005753 6:159620135-159620157 ATGTAGGAGGGGCCTAAGGATGG - Intergenic
1018068632 6:160141863-160141885 TGGGAGGAGGGGGCTGGGGAGGG - Intronic
1018746277 6:166764584-166764606 AAGGAGCAGGGGGTTGGGAAGGG + Intronic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1018926930 6:168213017-168213039 TTGGAGCAGGAGGCTGAGATAGG + Intergenic
1019075769 6:169387116-169387138 AAGGAGCCAGGGGCTGAGAACGG + Intergenic
1019287273 7:229983-230005 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1019604534 7:1901874-1901896 GTGGAGGAGGGGCCCGAGGAGGG - Intronic
1019779298 7:2930111-2930133 AAGGAGAAGGGGGCCGGGGAGGG + Intronic
1019783470 7:2958656-2958678 TTGGAGCAGGAGGCGGAGGATGG + Intronic
1019794758 7:3041478-3041500 GTGCCGCAGGGGGCTCAGGAGGG - Intronic
1020006764 7:4787571-4787593 GTGGAGCAGGCGGCAGAGGGAGG - Intronic
1021410387 7:20323564-20323586 TTGGAGAAGGGGGCTGAGAATGG + Intergenic
1021820384 7:24492289-24492311 GTGGGGCAGGGGGCACAGGATGG + Intergenic
1021918108 7:25455698-25455720 ATGCAGAAGGGGGCAGAGGTGGG - Intergenic
1022470179 7:30677159-30677181 ATGGAGTCGGGGGATGAAGAAGG + Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1022474533 7:30701346-30701368 CTGGAGGAAGGGGCTGAGGGTGG - Intronic
1022529871 7:31060094-31060116 ATGAAGCAGAGGGCTGGGGGTGG + Intronic
1023013575 7:35944027-35944049 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1023040775 7:36171211-36171233 ATGAAGCATGGGGCTGGGCATGG - Intronic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1023444986 7:40222122-40222144 ATGGTGACTGGGGCTGAGGAGGG + Intronic
1023522281 7:41060495-41060517 ATTGAGGAGGGAGGTGAGGAAGG - Intergenic
1023637075 7:42222984-42223006 ATGGAGCAGGGGCGGGGGGACGG - Intronic
1023863129 7:44227177-44227199 AGGGTGCAGGGGACAGAGGAGGG + Intronic
1023982092 7:45076211-45076233 AAGGAGCAGGGAGCTGCCGAGGG + Exonic
1024077553 7:45829807-45829829 CTGCAGAAGGGGCCTGAGGAGGG - Intergenic
1024177340 7:46854450-46854472 GTTGTGTAGGGGGCTGAGGAGGG + Intergenic
1024261741 7:47578545-47578567 ATGGGGCAGGGGGTTGGGGGGGG + Intronic
1024311614 7:47974674-47974696 AGGGAGCAGGGGGAGGAGGGAGG + Intronic
1024458238 7:49632789-49632811 AGGGAGCAGGTGGGTGAGGGAGG - Intergenic
1024572640 7:50736500-50736522 ATGGTTCTGGGGGCTGAGTATGG + Intronic
1024965326 7:55018951-55018973 AGGGACCAGGCGGCGGAGGAGGG - Intergenic
1024969149 7:55052777-55052799 ATGGAGCTGGGGGCTGATGCTGG + Intronic
1025126857 7:56351605-56351627 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1025296958 7:57782979-57783001 ATGGAGGAGGGGGCAGATGCAGG + Intergenic
1026256294 7:68715079-68715101 CTGCAGCAGGGGGCTCAAGAGGG - Intergenic
1026380207 7:69791964-69791986 CTGGAGTAGGAGGCTGGGGAAGG + Intronic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1026840812 7:73669035-73669057 ATGGAAAATGGGGCAGAGGAGGG + Intronic
1026875584 7:73877287-73877309 CTGGGGCAGGGGGCAGAGGCAGG + Intergenic
1026965251 7:74435298-74435320 AAGGGGCTGGGGGCTCAGGAGGG - Intergenic
1027056445 7:75053049-75053071 ATGGGGCAGGGGGCAGTGCACGG + Intronic
1027056460 7:75053087-75053109 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027056477 7:75053132-75053154 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027056494 7:75053177-75053199 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027056526 7:75053267-75053289 ATGGAGCTGGGGTCTGGGGGTGG + Intronic
1027227319 7:76251957-76251979 CTGGAGCTGGGAGCTGAGGTGGG + Intronic
1027230221 7:76267954-76267976 ATGGGGGAGGGGGCTGAGGGAGG - Intronic
1027397160 7:77767805-77767827 AGGGGGGAGGGGGCAGAGGAAGG - Intronic
1029163654 7:98570760-98570782 GTGGCTCAGGAGGCTGAGGAAGG + Intergenic
1029220863 7:98989234-98989256 ACGAAACAGAGGGCTGAGGAGGG + Intronic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029354105 7:100038354-100038376 ACGGAGCAGCGGGGAGAGGAAGG + Exonic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029375114 7:100172398-100172420 ATGGAGGAGGGTCCTGAGTAAGG - Intronic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029846719 7:103419357-103419379 AGGGAGCAGGGGGCAGTGGCAGG - Intronic
1029932370 7:104386078-104386100 ACGGAGCTGGGGGAGGAGGATGG - Intronic
1030015282 7:105213204-105213226 ATAGAGCAGGTGGATGAAGAAGG + Intronic
1031072668 7:117179634-117179656 TTAGAGCAGAGGGATGAGGAGGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031864729 7:127025993-127026015 AGGGGGCAGGGGGCTGGGGGAGG - Intronic
1032081026 7:128858541-128858563 CTGGAGGTGGGGGCTGAGGCTGG - Exonic
1032091223 7:128912620-128912642 CTGGAGGTGGGGGCTGAGGCTGG + Intergenic
1032191969 7:129770670-129770692 GGAGAGGAGGGGGCTGAGGAGGG - Intergenic
1032486026 7:132288070-132288092 TTGGAGGAGGGGGCTGGGAAAGG + Intronic
1032504339 7:132424348-132424370 ATGGCTGAAGGGGCTGAGGAGGG + Intronic
1032666562 7:134042927-134042949 CTGGTGCCGGGGGCTGAGGCAGG + Intronic
1033131249 7:138747552-138747574 ATGGTGTAGGGGGCTGCGGAGGG + Exonic
1033332685 7:140429314-140429336 GTGGAGCAGGGGGCTGGGCGCGG - Intergenic
1033959932 7:146902172-146902194 ATGGAGCATATGGCTGAGCACGG - Intronic
1034275737 7:149823086-149823108 CTGGAGGAGGCAGCTGAGGAGGG - Intergenic
1034405331 7:150899020-150899042 ATGGAGGAGGGGACAGAGAAGGG + Intergenic
1034429606 7:151034578-151034600 CCGGAGCAGGGAGCTGAAGAGGG - Exonic
1034431691 7:151044240-151044262 GTGGATCAGTGGGTTGAGGATGG + Intronic
1034678103 7:152906851-152906873 TTGGATCAGTGGGCTGAGTAAGG + Intergenic
1034822516 7:154230124-154230146 TTGGAGGAGGGTGCGGAGGAGGG - Intronic
1035609080 8:948441-948463 ATGGAGGCCGGGCCTGAGGAAGG - Intergenic
1035673070 8:1434854-1434876 ATGGAGGAGGGAGGGGAGGAAGG - Intergenic
1036221081 8:6922150-6922172 ATGGAGCAGGTGCCTGGGGGAGG - Intergenic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1036635874 8:10549177-10549199 ATGGAGGCGGGGGCAGATGAAGG + Intronic
1036776469 8:11616262-11616284 ATGGGGCAGGGGGCTGGAGCTGG + Intergenic
1037497639 8:19455717-19455739 CTGGAGCAGGAGGCTGAGTAGGG - Intronic
1037583608 8:20261540-20261562 ATGCAGAAGGGGGCTGGGGATGG - Intronic
1037654161 8:20868579-20868601 CTGAACCATGGGGCTGAGGAGGG - Intergenic
1037744284 8:21630676-21630698 GGGCAGCTGGGGGCTGAGGAAGG - Intergenic
1037753238 8:21696095-21696117 AAGGAGGAGGGGACAGAGGAGGG - Intronic
1037760410 8:21738159-21738181 ACGGGGGAGGGGGATGAGGAGGG - Intronic
1037817225 8:22118629-22118651 ATGGGGCGGGGGGCTGAGACGGG + Intronic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038210709 8:25516969-25516991 ATGGAGGCGGTGGCTGAGGCAGG - Intergenic
1038613444 8:29073054-29073076 AGGCAGCAGGGGGACGAGGAGGG + Intronic
1039405569 8:37309658-37309680 TTGGAGCAGGGGGGTGAAGCAGG - Intergenic
1039750990 8:40478689-40478711 AAGGAGCATGGGGCTCAGGTAGG - Intergenic
1039783759 8:40813995-40814017 GGGGAGCAGGGGGCTGGGGACGG + Intronic
1041000602 8:53446669-53446691 ATGGAGTAGGGGGAGGGGGAGGG + Intergenic
1041370484 8:57154616-57154638 ATGGGGCAGTGGGATAAGGAGGG - Intergenic
1041401360 8:57448738-57448760 AAGGAGGAGGGGGAGGAGGAGGG - Intergenic
1041636653 8:60153092-60153114 AGGGAGGAGGGGACAGAGGAGGG + Intergenic
1041725465 8:61013403-61013425 ATGCAGCTGGGAGCTGGGGAAGG - Intergenic
1042228189 8:66531269-66531291 GTGGAGTAGGGGGCTGGGGTAGG + Intergenic
1042302715 8:67302981-67303003 GTGGGGCAGGGGGTTGAGGTGGG + Intronic
1042888125 8:73574756-73574778 ATGGGGTAGGGGGCTGAGGGAGG + Intronic
1043149385 8:76694670-76694692 CGGGAGCAGGGGGCGGAGGGTGG - Intronic
1043544726 8:81302419-81302441 ATGGAGAGGTGGGTTGAGGAGGG - Intergenic
1044893530 8:96863213-96863235 TTGGAGCAGGGGGAGGATGATGG + Intronic
1045112487 8:98948173-98948195 ATGGGGCTGAGGGCAGAGGAAGG + Exonic
1045296007 8:100872159-100872181 CTGGAGAAGGGGGCTGGGGGTGG - Intergenic
1045479946 8:102583760-102583782 ATGCAGCAAGGGGTTGAGGAAGG - Intergenic
1045905373 8:107338447-107338469 GTGGAACAGGAGGGTGAGGAGGG + Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046055362 8:109071891-109071913 ACTGAGCAGGGGGCTGAGAAGGG + Intergenic
1046097623 8:109579534-109579556 AGGCAGCAGGAGGCTGAGGCAGG - Intronic
1046598446 8:116288798-116288820 ATGCAGAACTGGGCTGAGGACGG + Intergenic
1046666952 8:117014789-117014811 ATATAGCAGGGAACTGAGGAAGG - Intronic
1046876859 8:119264422-119264444 ATGAAGCAGGGGGTTGAGGGTGG + Intergenic
1047192987 8:122695467-122695489 AGGGAGCAGGAGGATGAGGGGGG + Intergenic
1048320182 8:133393545-133393567 AAGGAGCATGGGTCTGAGGATGG + Intergenic
1048327679 8:133451690-133451712 ATGGAGTAGCGGGCTGCAGATGG - Intergenic
1048853921 8:138670298-138670320 GTGAAGGAGGAGGCTGAGGAAGG - Intronic
1048930526 8:139311843-139311865 ATGGAGCAGAGGGCTGTGTCTGG - Intergenic
1049088473 8:140495716-140495738 ATGGGGCAGGGGGCTGGGGCCGG - Intergenic
1049108768 8:140629870-140629892 GGGGAGCAGGGGGAAGAGGAGGG + Intronic
1049326625 8:142024889-142024911 CTGGAGCATGGAGCTGAGGATGG - Intergenic
1049440877 8:142609172-142609194 ATGGCGCAGGGCGCTGAGCAGGG - Intergenic
1049480646 8:142820932-142820954 ATGGGGCAGGGGGGAGGGGAGGG - Intergenic
1050611113 9:7354859-7354881 AAGGAGATGGGGGCAGAGGATGG - Intergenic
1051295095 9:15587101-15587123 AGGAAGCTGGGGGCTGAGCATGG - Intronic
1051582598 9:18694175-18694197 TTGGAGGAGGGGGCTGGGGAAGG - Intronic
1052020557 9:23520683-23520705 AGGGAGTAGGGGGCTGGGGGAGG + Intergenic
1052283800 9:26761959-26761981 AGGGAGCAGGGGATGGAGGAGGG + Intergenic
1053183632 9:35995652-35995674 ATGGTGAGGGGGGCTGAGGGAGG - Intergenic
1053282215 9:36827793-36827815 GAGGAGCAGGGGGCTGAGCTGGG + Intergenic
1053416327 9:37949059-37949081 ATGGAGCTGGGGGCTGGTGAGGG + Intronic
1053461507 9:38274819-38274841 AAGGAGCAGGAGGCTAAGGATGG + Intergenic
1053517910 9:38747186-38747208 ATGGAGCAGGGGGCCGTGGCTGG + Intergenic
1054340845 9:63860143-63860165 ATGGAGCCGGCATCTGAGGAGGG + Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1056798802 9:89677228-89677250 ATGGAGCAGTGTGCTGTGGAGGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057222903 9:93267409-93267431 AGGATGCAGGGGGCCGAGGACGG - Intronic
1057387136 9:94614183-94614205 GAGGAGCAGGGGGAGGAGGAGGG + Intronic
1057497430 9:95572002-95572024 AGGGAGGAGAGGGCGGAGGAGGG + Intergenic
1057842975 9:98501133-98501155 AAGGAGCAGGGGGCGGGGAAGGG - Intronic
1058530487 9:105901109-105901131 ATGGTGCATGGGGCAGAGGTGGG - Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1059338570 9:113584173-113584195 ACGGGCCAGGGGGCTGAGGGTGG + Exonic
1059693540 9:116709239-116709261 ATTTAGCAAGGGGCTGAGGGTGG - Intronic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1060300720 9:122373165-122373187 GTGGAGCAGGAGGCTGAGGTTGG + Intronic
1060531042 9:124347132-124347154 GGGGAGCAGGGGGTTCAGGAGGG - Intronic
1060584510 9:124777576-124777598 AGGGACCCGGGGCCTGAGGAAGG + Intronic
1060757473 9:126223791-126223813 ATGCAGCATGGAGCTAAGGAAGG - Intergenic
1061203624 9:129150828-129150850 ACGGGGCAGGTGGCTGAGGCAGG + Intergenic
1061255672 9:129453395-129453417 ATGGAGTAGAGGGATGGGGATGG + Intergenic
1061405978 9:130393312-130393334 ATGGAGCAGGGGGTGGGGCAAGG + Intronic
1061530978 9:131212600-131212622 AAGTAACAGAGGGCTGAGGATGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061844309 9:133378355-133378377 ATGGGGCAGGGGGCTGGGCCGGG - Intronic
1061882117 9:133573780-133573802 ATGGGGCAGGGGCCTGGGCAGGG - Intronic
1061912309 9:133731656-133731678 AAGGAGCAGGGCACTGAGGCAGG + Intronic
1061989789 9:134152666-134152688 AGGGAGCTGGGTGGTGAGGATGG + Intronic
1062018366 9:134303813-134303835 ATGGGGAGGGGGGCTGAGGACGG - Intergenic
1062037363 9:134388765-134388787 AAGGAGGAGGAGGCAGAGGAAGG - Intronic
1062124783 9:134854265-134854287 ATGGAGCAGGTGGCTGTGCTGGG - Intergenic
1062151066 9:135019308-135019330 ATAGACCAGGGAGCTGAGGATGG + Intergenic
1062174111 9:135151489-135151511 AGGGAGCATGGGGTGGAGGAAGG - Intergenic
1062181861 9:135195231-135195253 AGAGAGCAGGGGTCTGAGCAGGG + Intergenic
1062238782 9:135525050-135525072 GTGGAGCTGGTGGCTGATGAGGG + Intronic
1062579365 9:137222602-137222624 ATGGGGCGGGGGGCCGGGGACGG - Intergenic
1062633865 9:137479649-137479671 ACAGAGCAGGGAGCAGAGGAGGG + Intronic
1203545537 Un_KI270743v1:125706-125728 ATGAATCTGGGGTCTGAGGATGG - Intergenic
1185432709 X:18893-18915 AAGGAGCGGGGGTCTGAGGGTGG - Intergenic
1185442060 X:231715-231737 AAGGAGCGGGGGTCTGAGGGTGG - Intergenic
1185478719 X:430491-430513 TGGGTGCCGGGGGCTGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1186214436 X:7283759-7283781 ATGGTGGTGGGGGATGAGGAAGG + Intronic
1186761742 X:12730211-12730233 ATGGGGCAGGAGGATGAGGTGGG + Intergenic
1187045733 X:15646513-15646535 CTGGACCTGGGAGCTGAGGAAGG - Intronic
1187051734 X:15702882-15702904 CTGGACCTGGGAGCTGAGGAAGG - Intronic
1187622704 X:21076234-21076256 AAGGAGGAGGGGGCGGAAGAAGG - Intergenic
1187697664 X:21937900-21937922 CTGGTGCAGGGGGCTGGGGTGGG + Intergenic
1188702095 X:33277663-33277685 AAGGAGTAGGAGGCTGAGGGTGG - Intronic
1189315927 X:40056491-40056513 ATGGAGCTGGGGGTTGGGGTTGG + Intronic
1189619841 X:42824447-42824469 ATAGAGTATGGGGATGAGGAAGG - Intergenic
1189763396 X:44344800-44344822 ATGGAGGAGGGGGCAAAGAAAGG - Intergenic
1190050880 X:47147427-47147449 ACGGAGCCAGCGGCTGAGGAGGG + Exonic
1190520428 X:51273725-51273747 ATATAGCATGGGGCTTAGGAGGG + Intergenic
1191752279 X:64555880-64555902 ATGGAGCTAGAGGCTGAGGTGGG + Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1192176159 X:68886816-68886838 ATGAAGCAGGGAGGTGGGGAAGG - Intergenic
1192214599 X:69149998-69150020 ATGGAGGAGGGCGCTGTGAATGG + Intergenic
1192224980 X:69221765-69221787 ATGGAGGAGGGCGCTGTGAATGG - Intergenic
1192268449 X:69556295-69556317 ATGGTGGTGGGGGCCGAGGAGGG + Intergenic
1193221764 X:78934970-78934992 ATGGAGGAAGGGGCTGCGGGAGG + Intergenic
1194314394 X:92357010-92357032 CAAGAGCAGGTGGCTGAGGATGG + Intronic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195343467 X:103926510-103926532 ATGGAGCAGGGGGGATAGGATGG + Intronic
1195379539 X:104257264-104257286 ATGGAGGAAGGGGCCCAGGAAGG - Intergenic
1196688130 X:118529898-118529920 ATGGGGCTGGAGGCTGAAGATGG + Intronic
1196950127 X:120868599-120868621 ATGAAGCTGGGGACTGAGGTGGG - Intergenic
1196995760 X:121381897-121381919 CTGGGGTGGGGGGCTGAGGAAGG - Intergenic
1198323687 X:135545073-135545095 ATGGAGTAAGGGGCAGAGGAAGG - Intronic
1198803036 X:140467078-140467100 ATGGGGCAGAGGGCTGAGATGGG - Intergenic
1199399318 X:147378036-147378058 AAGGAGCAAGGGGCTAAGCATGG - Intergenic
1199700739 X:150373745-150373767 AAGGTACAGCGGGCTGAGGATGG - Intronic
1200622455 Y:5468540-5468562 CAAGAGCAGGTGGCTGAGGATGG + Intronic