ID: 902606517

View in Genome Browser
Species Human (GRCh38)
Location 1:17572281-17572303
Sequence CCCACAAGGCCCCATGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902606517_902606524 8 Left 902606517 1:17572281-17572303 CCTGCTCCATGGGGCCTTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 273
Right 902606524 1:17572312-17572334 GGTAGAAAACTCTGCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 176
902606517_902606525 23 Left 902606517 1:17572281-17572303 CCTGCTCCATGGGGCCTTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 273
Right 902606525 1:17572327-17572349 AGGCATGGAGAGTTTAGCTGTGG 0: 1
1: 0
2: 0
3: 17
4: 179
902606517_902606523 3 Left 902606517 1:17572281-17572303 CCTGCTCCATGGGGCCTTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 273
Right 902606523 1:17572307-17572329 ATCAGGGTAGAAAACTCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 164
902606517_902606526 24 Left 902606517 1:17572281-17572303 CCTGCTCCATGGGGCCTTGTGGG 0: 1
1: 0
2: 3
3: 32
4: 273
Right 902606526 1:17572328-17572350 GGCATGGAGAGTTTAGCTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902606517 Original CRISPR CCCACAAGGCCCCATGGAGC AGG (reversed) Intronic
900580594 1:3406784-3406806 CCCACAAGGCCCCTTGGACCCGG - Intronic
900779168 1:4606391-4606413 CCCACAAGACCCCATGTGGATGG + Intergenic
901181716 1:7346701-7346723 CCTGCCAGGCCCCATGGAGCTGG - Intronic
902176284 1:14653378-14653400 CCCAACACGCCCCAGGGAGCTGG - Intronic
902297702 1:15479735-15479757 CACAGAAGGCCTCATGGAGAAGG + Intronic
902606517 1:17572281-17572303 CCCACAAGGCCCCATGGAGCAGG - Intronic
903006566 1:20302738-20302760 CCGAGAAGGCTCCATGGAGGTGG + Intronic
903356310 1:22750039-22750061 CCCCCAAGGCCCCCTGAAGAAGG + Intronic
903581185 1:24372331-24372353 GCTCCAAAGCCCCATGGAGCAGG - Intronic
903969817 1:27111251-27111273 ACCACATGGGCCCATGGAGTCGG + Intronic
905246476 1:36618031-36618053 CCCAGAAGGCCCCAAAGATCTGG - Intergenic
905317772 1:37094561-37094583 CCCACCAGCCCCCAGGGAACAGG + Intergenic
905358314 1:37400542-37400564 CCCTCAAGGCCCCCTCCAGCTGG + Intergenic
905395391 1:37663387-37663409 CCCACCAGCCACCATGGGGCTGG - Intergenic
905469851 1:38183364-38183386 CCCGCCTGGCCCCATGCAGCCGG - Intergenic
905872942 1:41415441-41415463 CCCACAAGGGCACCTGGTGCTGG - Intergenic
907474292 1:54695317-54695339 CCCACAGGTCCCCCTGGGGCTGG + Intronic
907496049 1:54845495-54845517 CCCACAAGGGCTGAGGGAGCTGG - Intergenic
915588905 1:156859796-156859818 CAGGCAAGGCCCCAGGGAGCGGG - Intronic
915690178 1:157680999-157681021 ACCACTAGCCCCAATGGAGCTGG - Exonic
916082261 1:161241818-161241840 TTCCCAGGGCCCCATGGAGCTGG - Intergenic
916361255 1:163971882-163971904 TCCACAGAGCCCCATGAAGCAGG - Intergenic
919448498 1:197740351-197740373 CCCACAAGGCTCCATATAACTGG - Intronic
922176292 1:223200547-223200569 GCCACAAGGCCCCCGGCAGCTGG + Intergenic
922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG + Intronic
924747704 1:246852578-246852600 CCCACAAGGATGCATGGGGCGGG + Intronic
924812561 1:247416200-247416222 CCCACACTGCCCCGCGGAGCTGG - Intronic
1063554927 10:7069331-7069353 CTCACAAAGCCCCAGAGAGCGGG + Intergenic
1069060812 10:63892619-63892641 CCCACACAGCCCCATGAGGCTGG + Intergenic
1069859204 10:71460017-71460039 CTCACAACGCCCCATGAAGGAGG + Intronic
1072770616 10:98134590-98134612 CCCAGAAGGCCCCACGGCGTTGG + Intergenic
1073473531 10:103738599-103738621 CCCACAAACCTGCATGGAGCAGG + Intronic
1073851943 10:107631811-107631833 CCCAGTAGGGCCCATGTAGCAGG - Intergenic
1074186471 10:111103046-111103068 CCCACAAGGACCCAGCAAGCAGG - Intergenic
1074770591 10:116731045-116731067 TCCACAAGGGCCCATGCAGCAGG - Intronic
1076124315 10:127962342-127962364 CTCTCAAGGCCCCATGAGGCAGG + Intronic
1076321409 10:129584731-129584753 CACAAAAGGCCACATGGTGCAGG - Intronic
1076997798 11:307404-307426 CCCCCAAACCCGCATGGAGCAGG + Intergenic
1077240473 11:1508015-1508037 ACCCCACGGCCCCCTGGAGCTGG + Intergenic
1077289422 11:1782050-1782072 CCCCCCAGGCCCCAGGGAGCAGG + Intergenic
1077419553 11:2444184-2444206 CCCACCAGGGCCCTTGGACCGGG - Intergenic
1077516452 11:3004698-3004720 CCCACAACGCCCCCAGGATCAGG - Intronic
1077540274 11:3143302-3143324 CCCCCATGGGCCCCTGGAGCCGG - Intronic
1079300874 11:19277901-19277923 GCCACAAGGTGCCATTGAGCTGG + Intergenic
1079322600 11:19463905-19463927 CTCACCATGCCCCAGGGAGCAGG + Intronic
1081934309 11:46894562-46894584 GGAACAAGGCCCCATGGAGAGGG - Intronic
1083175681 11:60948711-60948733 GCCACAAGGCCTCATGAAGTCGG - Intronic
1083655043 11:64225520-64225542 GCTTCAAGGCCCCATGGCGCAGG + Exonic
1085284824 11:75352543-75352565 CCCACAGCGAGCCATGGAGCTGG - Intergenic
1086559929 11:88155445-88155467 ACCAAAAGACCCCATGGAGCAGG + Intronic
1087156249 11:94907784-94907806 TCGACAAGGTCCCAGGGAGCGGG - Intergenic
1090229264 11:125089779-125089801 CCCACAGGAGCCCATGGAGCGGG - Intronic
1090347387 11:126082504-126082526 TCCAGAATGCCCCATTGAGCTGG - Intergenic
1090361321 11:126174943-126174965 CCCACAAGGGGCCCTGGAGCTGG - Intergenic
1091387671 12:105102-105124 CCCCACAGGCCCCATGGGGCAGG + Intronic
1091721934 12:2820244-2820266 GGAACAAGGCCCCAGGGAGCTGG + Intronic
1093189443 12:16057657-16057679 CGCACATGAGCCCATGGAGCGGG - Intergenic
1093418796 12:18950955-18950977 CCCACAATGCCTCATGGTGATGG + Intergenic
1096229451 12:49889068-49889090 CCCAGCAGGCCCCATGGGGAGGG - Intronic
1097620604 12:61934305-61934327 CCCACAAAGTCCCCAGGAGCTGG + Intronic
1098040867 12:66353019-66353041 CCTACAAGGCCCCAGGGATTTGG - Intronic
1098172298 12:67759194-67759216 CACACCTGGCCTCATGGAGCTGG + Intergenic
1101333055 12:103772686-103772708 CCCACAAGGGGCTCTGGAGCTGG + Exonic
1102347692 12:112170095-112170117 CCCACCTGACCCCATGCAGCTGG + Intronic
1102784410 12:115592569-115592591 CCCACAGGGCCTCATGGCCCTGG - Intergenic
1103320609 12:120090770-120090792 CTCCCAGGGCCCCATGGGGCTGG + Intronic
1103995760 12:124828979-124829001 ATCTTAAGGCCCCATGGAGCTGG - Intronic
1104670226 12:130675316-130675338 CACACAGCGCCCCGTGGAGCAGG + Intronic
1104992904 12:132636206-132636228 CCCACCAGGCCCCTGGGAGCTGG + Intronic
1105896164 13:24718746-24718768 CTCACAAGCCCCCCAGGAGCTGG - Intergenic
1106221287 13:27748392-27748414 CGCACAAGAGCCCATGGAGCGGG + Intergenic
1109272945 13:60274323-60274345 ACCTCAAGGCCTCATGGAGAAGG + Intergenic
1110162994 13:72401839-72401861 CCCATGAGCCCCCATGCAGCTGG - Intergenic
1110666491 13:78123655-78123677 CAGGCAAGGCTCCATGGAGCAGG + Intergenic
1112589637 13:100751328-100751350 GCCCCCAGGCCCCATGGAGCAGG - Intergenic
1116624050 14:47242726-47242748 CGCACAGGGGCCCATGGAGTGGG - Intronic
1117507707 14:56419089-56419111 CCTGCAAGCCCCCATGGAGTGGG + Intergenic
1117529790 14:56648974-56648996 CCAACAAAGCCCCATGGATCAGG - Exonic
1118625383 14:67654216-67654238 CCCACATGTCCCCAAGTAGCTGG + Intronic
1118726136 14:68630371-68630393 CCCACTAGTCCCCCTGCAGCAGG + Intronic
1121010815 14:90519072-90519094 CCCACACTGCCCCCTGGAGGAGG + Intergenic
1121988195 14:98528735-98528757 CCCAGCTGGCCCCATGGAGGTGG + Intergenic
1122178684 14:99939133-99939155 GCCACAGGGCCACATGGCGCAGG - Intronic
1122357166 14:101130774-101130796 CCCACATGGCCCCCGAGAGCTGG + Intergenic
1122630589 14:103105978-103106000 CCCACACCACCCCAGGGAGCAGG - Intronic
1123767801 15:23499180-23499202 CCCATTAGGCCCCAGGAAGCTGG - Intergenic
1123799181 15:23803196-23803218 CCCACAGGAGCCCACGGAGCGGG - Intergenic
1124241208 15:28029155-28029177 ATCACAATGCCCCATTGAGCTGG - Intronic
1125574889 15:40748496-40748518 CTCCCAAGGCCACAAGGAGCAGG - Intronic
1125785737 15:42316196-42316218 CCCACTAAGCCCCATAGGGCTGG - Intronic
1127708044 15:61566708-61566730 CCCACAAGGAGCTATGAAGCTGG + Intergenic
1128120830 15:65144857-65144879 CCCAGAAGGCCACAGTGAGCTGG - Intergenic
1129193491 15:73951273-73951295 CCCACAGGCCCCCGGGGAGCTGG - Intronic
1129769401 15:78193800-78193822 ACCAGAAGGCCCCAGGGAGGAGG + Intronic
1129865220 15:78902321-78902343 CCCCCTAAGCCCCATGGGGCTGG - Intergenic
1129912786 15:79242033-79242055 GTCACAGGGCCCCATGGACCAGG + Intergenic
1131089965 15:89616536-89616558 CCCACAAGGCCGCTTTGAGGTGG - Intronic
1132675121 16:1118283-1118305 CCCACATGGGCCTGTGGAGCCGG - Intergenic
1132746171 16:1437211-1437233 CGCACGAGGCCCCGAGGAGCGGG + Intronic
1134133466 16:11665270-11665292 CCCAGCAAGCCCCAGGGAGCTGG + Intergenic
1135170834 16:20181868-20181890 CCCACCAGGCTCCATGAAGTTGG - Intergenic
1135254077 16:20926606-20926628 CCCCCAAGGCCTCAGGCAGCTGG + Intergenic
1136535395 16:30896455-30896477 CCCACTAGGCCCCACGGACGAGG + Intergenic
1137909649 16:52363686-52363708 CCCAGAAGACCCCAAGAAGCTGG + Intergenic
1138029948 16:53552096-53552118 CCCACCAGCCCCCATGGCCCTGG + Intergenic
1138352884 16:56355821-56355843 CCCACATGCCCTCTTGGAGCGGG - Intronic
1140407409 16:74719884-74719906 CCCACCAGGGACCATGGGGCAGG + Intronic
1140929720 16:79616110-79616132 TTCACAAGGCCTCATGGTGCTGG + Intergenic
1140929775 16:79616810-79616832 TTCACAAGGCCTCATGGTGCTGG + Intergenic
1141379751 16:83565646-83565668 CCCAGAGGTCCCCATGCAGCAGG - Intronic
1141629549 16:85279695-85279717 CTCAGGAGGCCCCATGGAGCAGG - Intergenic
1142144951 16:88489068-88489090 CCCAGGAGGCCCCAAGGAGCTGG + Exonic
1142187019 16:88699417-88699439 CCCACCAGGCCCCCTGGGGTAGG - Intronic
1142393778 16:89819564-89819586 CCCACTAAGCCCCATAGGGCTGG + Intronic
1142546565 17:708064-708086 CCCACAAGGCCCCGTAGGGCTGG - Intronic
1142894403 17:2964549-2964571 CCCACAAGGACTCATGGCACTGG - Intronic
1143090487 17:4446790-4446812 CCCCCCACGCCCCAGGGAGCTGG - Intronic
1144467188 17:15505971-15505993 CGCACAGGAGCCCATGGAGCGGG - Intronic
1145013230 17:19381676-19381698 CCCACAAGGCACCTCTGAGCCGG - Exonic
1147673670 17:42190977-42190999 CCCATAGGGCCCCAGGTAGCAGG + Intronic
1147699985 17:42387949-42387971 TCCCCAGGGCCCCAGGGAGCAGG + Intronic
1147959719 17:44159425-44159447 CCCACAAGGCCCAGTAGGGCTGG - Intronic
1148577951 17:48724604-48724626 CCCACGAGGCCCCAGGCCGCTGG + Exonic
1148695254 17:49554953-49554975 TCCACAAGGGCCCAGGGTGCTGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149492749 17:57096799-57096821 CCCAGAAGGCCCCAATGAACAGG - Intronic
1150922529 17:69498488-69498510 CCCAAAAGGACCCATGCAGGTGG - Intronic
1151268179 17:72972739-72972761 CTCACTAGGCCTCTTGGAGCCGG + Intronic
1152011587 17:77722175-77722197 TCCTCAAGGCCCCATGGAATAGG + Intergenic
1160174699 18:76583361-76583383 ACCACAGGGCTCCAAGGAGCCGG - Intergenic
1161170015 19:2807901-2807923 TCCCCGAGGCCCCATGGAGCAGG - Intronic
1162524728 19:11200807-11200829 CCCACAGGGTCCCCTGGAGGTGG - Exonic
1163157674 19:15448344-15448366 CCCACAATGCCCCGCTGAGCCGG - Exonic
1163528556 19:17836037-17836059 CCAACCAGGCACCATGGTGCAGG - Exonic
1164627978 19:29742016-29742038 GCCAGAGGGCTCCATGGAGCCGG + Intergenic
1164651703 19:29895425-29895447 CTCAGAAGGCCCCGTGGAGCGGG - Intergenic
1166405784 19:42521009-42521031 CCCAGAAAGCCCCGTGTAGCAGG - Intronic
1166743752 19:45130110-45130132 CCCACAACCCCTCTTGGAGCTGG + Intronic
1166827590 19:45619069-45619091 CCCACCAGCCCCTGTGGAGCAGG - Exonic
1167069151 19:47209573-47209595 CCCACAATGCCCCAGAGGGCTGG - Exonic
1167318492 19:48780683-48780705 CCCACAAGGCCCTGTAGGGCTGG - Intergenic
1167424263 19:49422022-49422044 ACCACAAGGACCCAGGGAGACGG + Intergenic
1167677533 19:50896661-50896683 CTCCCAAGGCCCCAGTGAGCAGG + Intergenic
925503163 2:4529790-4529812 GCCACAAAGCCCCATGGAAGTGG - Intergenic
926141430 2:10370760-10370782 CCCCCAAGACCCCCAGGAGCAGG - Intronic
926239232 2:11072160-11072182 ACCACAAAGCCCCTTAGAGCGGG - Intergenic
927075872 2:19576780-19576802 CCCAGAAGGCTCCCTGGAGAAGG + Intergenic
927691277 2:25209910-25209932 CCAACAAGGCGCCATAGGGCTGG - Intergenic
928104258 2:28457600-28457622 CCCACCTGGCCCAAGGGAGCAGG - Intronic
930021892 2:47006699-47006721 CCCACAAGCCACCATGGAGAGGG - Exonic
932139777 2:69264994-69265016 CCCACAAGGAGCCCTGGAGCTGG - Intergenic
935671065 2:105557637-105557659 CCCACAGGGCCGCCTGGAGAGGG - Intergenic
936292402 2:111236249-111236271 TCCAGAAGGGCCAATGGAGCTGG - Intergenic
936494695 2:113008201-113008223 TCCACATGGCCCCAGGGAGAGGG - Intergenic
938279295 2:130052985-130053007 CTGACAAGGCCTCATGGACCAGG + Intergenic
938330264 2:130443803-130443825 CTGACAAGGCCTCATGGACCAGG + Intergenic
938359681 2:130677700-130677722 CTGACAAGGCCTCATGGACCAGG - Intergenic
938436098 2:131284450-131284472 CTGACAAGGCCTCATGGACCAGG - Intronic
939281786 2:140074062-140074084 CGCACAGGAGCCCATGGAGCGGG - Intergenic
940974347 2:159926775-159926797 CCCACCCAGCTCCATGGAGCAGG + Intergenic
941236598 2:162983127-162983149 CTCACATGGTCCCATGGAGCAGG + Intergenic
944440033 2:199733008-199733030 CCTACAAAGCACCATAGAGCTGG + Intergenic
944728638 2:202497192-202497214 CGCACAGGGGCCCATGGAGGGGG - Intronic
944729672 2:202503653-202503675 CGCACAGGGGCCCATGGAGGGGG - Intronic
945014283 2:205498795-205498817 CACAGAAGGCTCCATGGAGGAGG - Intronic
947528581 2:230894345-230894367 CACCCAAGACCCCAAGGAGCGGG - Intergenic
947715542 2:232337281-232337303 CCCACCAGGCCCTGCGGAGCTGG - Intronic
947734571 2:232448030-232448052 CCCACCAGGCCCTGCGGAGCTGG - Intergenic
947952680 2:234161613-234161635 CGCACAAGGCCCTATGTGGCGGG + Intergenic
948772578 2:240259100-240259122 CCTTTGAGGCCCCATGGAGCTGG + Intergenic
949051742 2:241901282-241901304 CCCTCCAGGCCTCAGGGAGCCGG + Intronic
1168830650 20:843668-843690 CCCACAAGGCCCCTTGGAGATGG - Intronic
1170989923 20:21292154-21292176 CGCACAGGAGCCCATGGAGCGGG - Intergenic
1172011051 20:31845718-31845740 CCCACAAGGCCCAAAAGAGGCGG + Intergenic
1172075093 20:32290004-32290026 CTCACACGGCCCCAAGCAGCAGG + Intronic
1172278372 20:33693784-33693806 CCCAGCAGGCCTCCTGGAGCTGG + Intergenic
1172901978 20:38341906-38341928 ACCAGGAGCCCCCATGGAGCAGG - Intergenic
1173443098 20:43095479-43095501 ACCAGAAGGCCCCATGTGGCTGG + Intronic
1174062069 20:47839843-47839865 CACACCAGGCCTCAGGGAGCAGG + Intergenic
1174359703 20:50020342-50020364 CTCACACAGCCCCATGGAGCTGG - Intergenic
1174588449 20:51626372-51626394 CCCTCAAGCCCCCAAGTAGCTGG - Intronic
1175995093 20:62808444-62808466 CCCACAGTGCCCCCTGGAGGCGG + Intronic
1176232653 20:64040055-64040077 CCCACTGGCCCCCACGGAGCAGG - Intronic
1176309040 21:5140107-5140129 CCCACAAAGGCCGATGGAGGGGG + Intronic
1179848021 21:44121926-44121948 CCCACAAAGGCCGATGGAGGGGG - Intronic
1179916050 21:44478983-44479005 CCCAGAAGAGCCCATGGTGCAGG + Intergenic
1180595124 22:16967981-16968003 CCCATGAGGTCCCCTGGAGCAGG - Intronic
1180730021 22:17974176-17974198 CTCACAAAGCCCTAGGGAGCTGG - Intronic
1181051143 22:20238837-20238859 TCCACAGGGCCCCCTGGGGCTGG + Intergenic
1181313029 22:21955783-21955805 CCCACAGGGCCCAGTGGACCTGG - Intergenic
1181346136 22:22221855-22221877 CCCACAGGGCCCAGTGGACCTGG - Intergenic
1181468987 22:23126596-23126618 CAAACAATGCCCCATGGAGAAGG + Intronic
1181694221 22:24584973-24584995 CCCCCAAGGCCCCCTGCTGCTGG + Intronic
1181986999 22:26806775-26806797 CCTACAAGGCCCCAAGGGGGTGG + Intergenic
1182294031 22:29302719-29302741 CCCACGAGGCCACATGGCACAGG + Intergenic
1183474427 22:38028074-38028096 CCCAGAAAGCTCCAGGGAGCAGG - Intronic
1184115028 22:42417338-42417360 CCCTCTAGGCCCCTTGGTGCTGG - Intronic
1184221572 22:43103936-43103958 CCCACAAGGCCCAGTAGGGCTGG - Intergenic
1185244981 22:49768754-49768776 CCCACCATGCCCCCTGGAGGGGG + Intergenic
1185385246 22:50528921-50528943 CAGACCAGGCCCCTTGGAGCAGG - Intronic
949848624 3:8398387-8398409 CCTACAGGGACCCCTGGAGCTGG - Intergenic
950893261 3:16424003-16424025 CCCAAATGGCCCCATTCAGCAGG - Intronic
956752488 3:72354393-72354415 CTCAGATGGCTCCATGGAGCTGG + Intergenic
958779432 3:98523001-98523023 CCCACAAGGCCCCTCGGCCCCGG - Intronic
961357657 3:126349283-126349305 CCCCCAAGGTCCCCTGGAGTGGG - Intronic
961406208 3:126681609-126681631 CCCACAAACCACCATGGGGCTGG - Intergenic
961624568 3:128252994-128253016 TCCCCAGGGCTCCATGGAGCTGG + Intronic
962435666 3:135364288-135364310 CCCTGAAGCCCCCATGGAGAAGG + Intergenic
962477660 3:135770526-135770548 CCCACAAGATTCCAGGGAGCAGG - Intergenic
966725390 3:183103824-183103846 CGCACAAGAGCCCACGGAGCGGG + Intronic
966910519 3:184557127-184557149 CCCTCCAGGCCCCAGGCAGCTGG - Intronic
967854381 3:194105489-194105511 CCCACAAGGTCCCTGAGAGCCGG - Intergenic
968037309 3:195558778-195558800 TCCAGAAGGCCCCCTGGAGCTGG + Intergenic
968504324 4:964898-964920 CCCACGGTGCCCCACGGAGCTGG + Intronic
968569020 4:1329675-1329697 CCCACAAGGCACACGGGAGCTGG + Intronic
968934599 4:3603405-3603427 CAGACAGGGACCCATGGAGCAGG + Intergenic
969370229 4:6727286-6727308 CTAAGAAGGCCCCAAGGAGCAGG - Intergenic
969479566 4:7440783-7440805 CCCTCGAGGCCCCATGTGGCCGG - Intronic
973543750 4:51959757-51959779 CCCTCAAGGCCCGAAGGGGCAGG + Intergenic
974084218 4:57242261-57242283 CTCCCAAGGCCCCATGGGTCTGG - Intergenic
976720678 4:88166018-88166040 ACCACAAGGCCCCAAGGAAATGG + Intronic
980187117 4:129475857-129475879 CTCACAAGGGCCCATGGGGAAGG - Intergenic
981792886 4:148560106-148560128 CCTACAGGGCCACATGGAGAAGG + Intergenic
983854972 4:172632815-172632837 GCCCCAAGGCTGCATGGAGCAGG - Intronic
984770604 4:183433428-183433450 CGCACAGGAGCCCATGGAGCGGG - Intergenic
985495023 5:199485-199507 CCCACACGGCCCCATGGGTGGGG + Exonic
985543875 5:499689-499711 CCCACGTGTCCCCAGGGAGCAGG - Intronic
985970919 5:3377708-3377730 ACCACAGGGTCCTATGGAGCTGG + Intergenic
989091380 5:37736688-37736710 CCCACAAAGCCCCCTTGAGTTGG - Intronic
989212407 5:38868833-38868855 CCAAAAAGGTCCCATGGGGCAGG + Intronic
990687719 5:58325531-58325553 ACCCCAAGGCCTCATAGAGCAGG - Intergenic
992073820 5:73173231-73173253 CCCACAAGGAGCAATGGAGCAGG + Exonic
992643989 5:78795288-78795310 CCCCCTAGGGTCCATGGAGCTGG - Intronic
995782450 5:115792821-115792843 CCCACCAGGCTCCAAGGAGAAGG - Intergenic
999179656 5:149660396-149660418 CCCAGAAGGCAACATGGAGCAGG - Intergenic
999299584 5:150482926-150482948 CTCACAGGGCCTCATGCAGCTGG + Intergenic
999395269 5:151223227-151223249 CCCCCAAGGGGCCTTGGAGCTGG - Intronic
999724970 5:154429604-154429626 CCCACAAGGGCCTATGGTGCTGG - Intergenic
1001296618 5:170503519-170503541 CCCTCAAGGACCCGCGGAGCAGG + Intronic
1001935091 5:175697942-175697964 CACAAGAGGCTCCATGGAGCAGG - Intergenic
1002074229 5:176698518-176698540 GCCCCAGGGCCCCTTGGAGCTGG - Intergenic
1002356965 5:178637830-178637852 CCAACACTGCACCATGGAGCTGG + Intergenic
1002399770 5:178985132-178985154 TCCACACTGCCCCAGGGAGCAGG + Intronic
1006092153 6:31634496-31634518 CATCCAAGGCTCCATGGAGCTGG - Exonic
1006748860 6:36364308-36364330 CGCACAGGAGCCCATGGAGCGGG + Intronic
1006786662 6:36672322-36672344 CCCACCAGGAGCCCTGGAGCTGG - Intergenic
1007074318 6:39057203-39057225 CCCACAAAACCCTATGGGGCTGG + Intronic
1007169112 6:39850037-39850059 CCCACCAGGTCCCCTGGGGCTGG - Intronic
1008210045 6:48711148-48711170 CCCACTATGCCCCATGGTTCTGG - Intergenic
1008430091 6:51406157-51406179 CCCATAAGCCCCACTGGAGCAGG - Intergenic
1011925890 6:92644590-92644612 CCCACGAGGCCCCAGGCTGCTGG - Intergenic
1015803074 6:137080364-137080386 CCCAGAAGGGGCCCTGGAGCTGG + Intergenic
1015867266 6:137739891-137739913 ACCTGAAGGCACCATGGAGCAGG + Intergenic
1017822527 6:158059949-158059971 CCCTCAAAGCCCCATGGGGAGGG - Intronic
1018393419 6:163358425-163358447 CCCACAAGGCCCCATAGGAGAGG - Intergenic
1019553580 7:1617278-1617300 CCCACATGGCCCCCGGGATCTGG + Intergenic
1019698172 7:2459580-2459602 CCCACCAGGCCCCAGGGAGGTGG - Intergenic
1019901205 7:4021980-4022002 CCCAAACAGCCCCATGGAGCTGG - Intronic
1021439427 7:20661197-20661219 AGCACAAGGCTCTATGGAGCTGG + Intronic
1021951229 7:25776878-25776900 GCCAAGAGGCCACATGGAGCAGG - Intergenic
1022545915 7:31188808-31188830 TCCACAAGGCCCCATGCTCCTGG + Intergenic
1026442973 7:70459987-70460009 CAAGCAAGGCCCCATGGACCAGG + Intronic
1026837815 7:73649894-73649916 CCCACACGGCCCCTTGAAGCTGG - Intergenic
1026969205 7:74457753-74457775 CTCTGCAGGCCCCATGGAGCTGG - Intronic
1027975576 7:85150003-85150025 CCCAAAAGTCCTCATGGAACAGG + Intronic
1028511180 7:91627469-91627491 CGCACAGGAGCCCATGGAGCGGG + Intergenic
1029563193 7:101317680-101317702 CCCACCAGGCACCATGAAGTTGG - Intronic
1029597903 7:101547293-101547315 CCCTCAAGGCCCCATGGCTCAGG - Intronic
1034490806 7:151392252-151392274 CCCACATGCCCCCATCCAGCTGG + Intronic
1034688782 7:152997351-152997373 CACAGGAGGCCCAATGGAGCTGG - Intergenic
1034971056 7:155419296-155419318 CCCATATGGACCCATGGAGCAGG + Intergenic
1035048314 7:155983549-155983571 CTAAGAAGGCCCCGTGGAGCTGG + Intergenic
1038540130 8:28385203-28385225 CCTCCAAGGCCACAGGGAGCTGG + Intronic
1039996700 8:42541099-42541121 CCCACCAGGCGCAATGTAGCCGG - Intronic
1042183404 8:66113758-66113780 CCCGCCTGGCCCCCTGGAGCCGG - Intergenic
1043129898 8:76447690-76447712 CTCACAGGAGCCCATGGAGCGGG + Intergenic
1045016180 8:98003565-98003587 CCCATGAGCCCCCATGGAGAGGG - Intronic
1045307343 8:100969560-100969582 CCCACAAAGCCCCGTAGGGCTGG + Intergenic
1045359098 8:101415353-101415375 CCCAGCAGGCCCCATGCAGGTGG - Intergenic
1045411590 8:101926030-101926052 CCACCAAAGCCACATGGAGCTGG - Intronic
1045806328 8:106166863-106166885 AGCATAAGGCCCCATTGAGCTGG + Intergenic
1047400157 8:124539322-124539344 CCCTCGGGGCCCCATGGAGGTGG + Intronic
1047718742 8:127619508-127619530 CCCACCAGGACCCATGGGCCAGG + Intergenic
1048170408 8:132100698-132100720 CACAGGAGGCCCCATGGAGCTGG - Intronic
1048292451 8:133191269-133191291 CCCACCAGCCCCCATGTAGCAGG - Intronic
1049399236 8:142417482-142417504 CCCATAACGGCCCCTGGAGCTGG - Intergenic
1049402507 8:142435872-142435894 CCCACCAGCCCCCAGGCAGCAGG + Intergenic
1049924470 9:395147-395169 CCCACAAGGCCGCATGCACCTGG - Intronic
1052985311 9:34482841-34482863 CGCACAAGAGCCCATGGAGTGGG + Intronic
1053353646 9:37429525-37429547 CCCACACTGCCCCAGGGATCTGG - Intronic
1053432791 9:38054264-38054286 CCCACAAGGGGCCAAGAAGCAGG + Intronic
1054951378 9:70855812-70855834 AGCACAAGGCCCCATGGACTTGG - Intronic
1056303701 9:85268738-85268760 TCCACAAGGTCCCAGGGACCTGG + Intergenic
1056552438 9:87663375-87663397 CCCCAAAGGCCCCATGAACCTGG + Intronic
1056743785 9:89282708-89282730 CCCACAGGAGCCCATGGAGGGGG - Intergenic
1057279952 9:93702043-93702065 CACAAAAGGCCCCATCCAGCGGG - Intergenic
1057499814 9:95587733-95587755 CCCAGAAGGCTCCCTGGAGGAGG + Intergenic
1057705728 9:97393622-97393644 CACACAAGTCCCCAAGGAGTTGG - Intergenic
1060180424 9:121529846-121529868 CCCACAAGGCCCCATCCAGCTGG - Intergenic
1060748188 9:126151578-126151600 CCCACAAGGCCCCTGGGGCCAGG - Intergenic
1060994974 9:127870785-127870807 CCCAGAAGGCCCTACGGAGACGG + Intronic
1061665918 9:132161214-132161236 CCCAGAAGGCCCCAAGCAGTGGG - Intergenic
1061877839 9:133553834-133553856 CCCACAGGGAGCCCTGGAGCGGG + Intronic
1062082672 9:134632642-134632664 TCCCCAAGGCCCCATGGATGGGG + Intergenic
1062430897 9:136526467-136526489 CCCTCGAGGCTCCAAGGAGCGGG + Intronic
1062715408 9:138007755-138007777 CCCACAGGGCCCCGAGGAGCTGG + Intronic
1185745897 X:2573145-2573167 CCAACATGGCTCCAGGGAGCAGG + Intergenic
1192476784 X:71450956-71450978 CCCACAAGGCACCAATGGGCTGG - Intronic
1197700386 X:129595201-129595223 CTCCCCAGGCCCCGTGGAGCAGG - Intergenic