ID: 902607215

View in Genome Browser
Species Human (GRCh38)
Location 1:17575371-17575393
Sequence GGTCTAAGGAAGCTTTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902607213_902607215 -8 Left 902607213 1:17575356-17575378 CCACTGTGTGAAATGGGTCTAAG 0: 1
1: 0
2: 1
3: 19
4: 155
Right 902607215 1:17575371-17575393 GGTCTAAGGAAGCTTTGCAGAGG 0: 1
1: 0
2: 3
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902607215 Original CRISPR GGTCTAAGGAAGCTTTGCAG AGG Intronic
900764734 1:4497126-4497148 GGTTTCAGGAAGCTTTGCTGAGG - Intergenic
902556673 1:17250849-17250871 CCTCTAAGGAAGCTCTGCGGGGG - Intronic
902607215 1:17575371-17575393 GGTCTAAGGAAGCTTTGCAGAGG + Intronic
903927326 1:26839920-26839942 GGACAAAGGAGGCTCTGCAGGGG - Intronic
905469724 1:38182784-38182806 GGCCTAAATAAGCTTTGCAGGGG - Intergenic
905591598 1:39168577-39168599 GCTCTCAGGGAGCTCTGCAGAGG - Intronic
908382625 1:63611206-63611228 GGTCAGAGGAAGCTTCCCAGGGG + Intronic
908525062 1:64980084-64980106 GTACTAAGTAAGCTTTGGAGGGG + Intergenic
908740555 1:67322965-67322987 GTTCCAAGGAAGCTTTGGCGTGG + Intronic
910482726 1:87676054-87676076 GGTCAAAGGTAGCTCTGCAAAGG - Intergenic
912935858 1:114003211-114003233 GGTCAAAGGAAGCCTTGCAGGGG - Intergenic
913069761 1:115287962-115287984 GATCTATGGAAGCTTTACAGAGG - Intronic
913137621 1:115908090-115908112 GGTCTGAGGCAGCTTTCTAGGGG - Intergenic
913462215 1:119099503-119099525 GTTCTTAGGAATCTTCGCAGTGG - Intronic
915661074 1:157405511-157405533 GGTCTAAGGATGAGTTTCAGAGG - Intergenic
919567396 1:199206126-199206148 GGTCTTAGGAAAATTTGCAGTGG - Intergenic
920696597 1:208185553-208185575 GATTCAAGGGAGCTTTGCAGAGG - Intronic
921247140 1:213256419-213256441 AATGTAAGTAAGCTTTGCAGGGG + Intronic
922732804 1:227960303-227960325 GGTGTGAGTCAGCTTTGCAGTGG + Intergenic
923201625 1:231718191-231718213 GATCGAAGGATGCTTTGGAGGGG - Intronic
923548483 1:234942334-234942356 GCTGTATGGCAGCTTTGCAGTGG + Intergenic
924590419 1:245398411-245398433 GGTCAAAGCAAGCTTTACGGTGG - Intronic
924848519 1:247798912-247798934 GCTGTGAGGAAGCTTTGCATAGG - Intergenic
1063104928 10:2984735-2984757 GGTCAATGGAAGCCCTGCAGTGG - Intergenic
1063484183 10:6403596-6403618 GGCCTGAGGAAGCTTTGGAAAGG + Intergenic
1065162098 10:22933160-22933182 GGTCCAGGAAGGCTTTGCAGGGG + Intronic
1068704020 10:60053163-60053185 TGTGGAAGGAAGCTTTGCAAAGG + Intronic
1070924306 10:80207945-80207967 GGACTGAGGAGGCTCTGCAGAGG + Intergenic
1074271534 10:111958538-111958560 GGTCTAAAGAAACTTTGCTGAGG - Intergenic
1077327790 11:1971204-1971226 GGGCTAAGGCAGGCTTGCAGGGG - Intronic
1077874125 11:6289266-6289288 GGTCTGAGAAAGCTTTGTGGAGG + Intergenic
1084760593 11:71268231-71268253 GGGCTGAGGGAGCTGTGCAGGGG - Intergenic
1087535294 11:99436423-99436445 GATGTAAGGAAGCTATGTAGTGG - Intronic
1090153540 11:124411612-124411634 GGTAAAAGAAAGCTTTCCAGGGG - Intergenic
1202810770 11_KI270721v1_random:26384-26406 GGGCTAAGGCAGGCTTGCAGGGG - Intergenic
1095681043 12:44976436-44976458 GGATCAAGGAACCTTTGCAGTGG - Intergenic
1099874918 12:88392711-88392733 GCTCTAGGGAATGTTTGCAGGGG - Intergenic
1100574304 12:95875227-95875249 GGTGTGAGGGAGGTTTGCAGGGG + Intronic
1104904492 12:132205955-132205977 GAACGAAGGAAGCTCTGCAGGGG + Exonic
1105413345 13:20189959-20189981 GACCCAAGGAAGCTCTGCAGAGG - Intronic
1106727751 13:32503733-32503755 GTTCTAAGGAAGCTTTACCTTGG - Intronic
1108227264 13:48303105-48303127 CGTCTGAGGAAGATTTTCAGGGG - Intergenic
1112236335 13:97641249-97641271 GGTCACAGAAAGCTTTCCAGAGG - Intergenic
1117055405 14:51907150-51907172 GGTCCAAGGAGACTTGGCAGTGG - Intronic
1118853906 14:69606432-69606454 GGTCGGAGGGAGCTTTGTAGAGG - Intergenic
1119850128 14:77861147-77861169 GGTCTAAAGAAGCATTGTGGGGG - Intronic
1122919281 14:104873428-104873450 GGGGTAAGGAAGGTTTGGAGAGG + Intronic
1123695758 15:22878053-22878075 GGTCTCTGGTAGCTTTGCAAAGG - Intronic
1125340606 15:38671885-38671907 GCACTAAGGCAGCTTTGAAGGGG + Intergenic
1125602040 15:40920765-40920787 GGTCACAGGAGGCTTTGTAGGGG - Intergenic
1125893892 15:43286214-43286236 GGCCATAGGAAGCTTGGCAGGGG + Intronic
1126120454 15:45246850-45246872 GATCCAAGGCAGTTTTGCAGGGG + Intergenic
1129362627 15:75033869-75033891 GGTCTAGGGAGGCTCTGCACAGG - Intronic
1130315292 15:82790267-82790289 GGTCTAAGAAAGCCTTGGTGAGG - Intronic
1131349180 15:91681262-91681284 GGGCTTAGGAGGCTTTTCAGGGG - Intergenic
1131788695 15:95940706-95940728 GGCCTCAGCAAACTTTGCAGTGG + Intergenic
1132244269 15:100281795-100281817 GGACCAAGGAAGCTGGGCAGAGG + Intronic
1132358659 15:101193373-101193395 GGGCCAGGGAAGCTTTCCAGAGG + Intronic
1135714384 16:24749058-24749080 GCCCTGAGGAAGCTTTCCAGAGG - Intronic
1136454904 16:30374880-30374902 GGTCTAAGGGATCTGGGCAGGGG - Intronic
1139123462 16:64048387-64048409 AGTCAAAGGTAGCTTTGCAAAGG + Intergenic
1140102224 16:71927635-71927657 TCTGGAAGGAAGCTTTGCAGAGG - Exonic
1140143324 16:72281113-72281135 GGTCTATGGCAGATTGGCAGTGG + Intergenic
1140893459 16:79305152-79305174 GGTCCCAGGGAGCATTGCAGGGG + Intergenic
1142808912 17:2386200-2386222 GGGCACAGGAAGCTTGGCAGTGG + Exonic
1147391598 17:40112633-40112655 GGTCAAAGGAAGCCATGCAGAGG - Intergenic
1147465650 17:40608721-40608743 ACTCTTAGGAAGCTTAGCAGGGG + Intergenic
1148271432 17:46265085-46265107 GGTGTACCCAAGCTTTGCAGTGG + Intergenic
1149226772 17:54480626-54480648 TGTCTAAGAGAGCTGTGCAGGGG + Intergenic
1150765475 17:67998544-67998566 GGTATACCCAAGCTTTGCAGGGG - Intergenic
1155226837 18:23736810-23736832 GGTCCAAGGAAGGTGTGCAGGGG + Intronic
1156069819 18:33193311-33193333 GGTCTGAGGAAGCCTTTGAGGGG + Intronic
1157044723 18:44087518-44087540 GGGCTAAGTAAGCTGTGCGGTGG - Intergenic
1157423609 18:47566430-47566452 GGTCAGAGGAGGCTTTGCAGAGG + Intergenic
1158626657 18:59077570-59077592 GGACTAAGGAAGCTTAAAAGAGG + Intergenic
1161864625 19:6825065-6825087 GGTTTCAGGAACCGTTGCAGGGG - Exonic
1162178425 19:8848868-8848890 GGTCCAAAGAAGCTTGGCTGGGG - Exonic
1162733378 19:12732251-12732273 TGTCTAAGGATGCTGTCCAGAGG - Intronic
1164754144 19:30677750-30677772 GGTCTTAGGAGGCTTTTAAGTGG - Intronic
1165348887 19:35266224-35266246 TGTCCAAGGAAGCTCTACAGCGG + Intronic
1166347197 19:42173998-42174020 GGTCCAGGGAAGCTTTTCATGGG + Intronic
925680616 2:6417218-6417240 GGTCTCAAGAAGCTTTGGCGTGG + Intergenic
926798255 2:16636644-16636666 GTTCTGAGTAAGCCTTGCAGAGG - Intronic
927858468 2:26542525-26542547 GGATTAAGGAGGCATTGCAGAGG + Intronic
928308260 2:30189255-30189277 GGTCAAAGAAAGCCTTTCAGAGG + Intergenic
932824112 2:74924722-74924744 TGTCTAAGGAAGCCATGCACTGG + Intergenic
934093889 2:88580409-88580431 GGTCTAAGAAAGCCTTACAGAGG - Intronic
935716863 2:105947081-105947103 GGTCAAAGGAAGATTTTCAAGGG + Intergenic
938830936 2:135049751-135049773 GCTCTAAGGAAGCATGGAAGGGG + Intergenic
941629102 2:167864671-167864693 GGCCTTAGGAAGCTTGGAAGTGG + Intergenic
942542884 2:177033015-177033037 GGAATCAGGAAGGTTTGCAGAGG - Intergenic
942997782 2:182285498-182285520 TGTCTAAGGACACTTAGCAGAGG + Intronic
945463386 2:210138552-210138574 TGTCTAAGGAAGCTTAACATTGG + Intronic
1169254461 20:4086315-4086337 GTTCTGAAGAAGCTTTGCTGAGG - Intergenic
1172198434 20:33108217-33108239 GGGCTAAGAGAGCTTTGCAAGGG - Intronic
1172288293 20:33756976-33756998 GTTCTAAGGGAGCTTGGGAGTGG + Intronic
1173277824 20:41599694-41599716 AGACGAAGGAAGCTTTGAAGAGG - Intronic
1173900172 20:46581935-46581957 GGTCTAAGGAGGCTTAGCTGTGG - Intronic
1174185413 20:48702786-48702808 GCTGTAAGGAAGCGATGCAGCGG - Intronic
1174735792 20:52964553-52964575 GGTCTAAGGAGGCTTCTGAGAGG - Intergenic
1183324880 22:37185775-37185797 GATCCCAGGAAGCTTTGCTGGGG + Intronic
1183712991 22:39517388-39517410 AGTTTAAAGAAGCGTTGCAGAGG + Exonic
1185414884 22:50704529-50704551 GGGCAAAGGGAGTTTTGCAGAGG + Intergenic
952621323 3:35346762-35346784 GGTCTAAGCATGCTTTTCAAGGG - Intergenic
953989391 3:47472574-47472596 ATCATAAGGAAGCTTTGCAGTGG - Intronic
962207290 3:133445364-133445386 TGTCTCAGCAAGCTTTCCAGGGG - Intronic
962905092 3:139794143-139794165 GGTCCAGGGCATCTTTGCAGAGG - Intergenic
963277210 3:143344304-143344326 ATTCTCAGGAGGCTTTGCAGAGG + Intronic
964452353 3:156824481-156824503 GGTCTAAGGGAAATTTACAGTGG + Intergenic
964739684 3:159952213-159952235 GGTCAAAGAATGCTTTACAGAGG + Intergenic
967111887 3:186301216-186301238 GGGTTAAGGAAGCCTTGGAGAGG - Intronic
967697317 3:192547094-192547116 GGTCTAAGGAACATTTGTGGAGG - Intronic
967863446 3:194170648-194170670 GGTCTAAGGTAGCCCTGCTGGGG - Intergenic
970050605 4:11910412-11910434 GGCCTAAGAAAGCTTGACAGGGG + Intergenic
972305612 4:37826958-37826980 GGTCGAAGGAAGCCTAGCAGCGG - Intronic
972425090 4:38925403-38925425 GTCGTAAGGAATCTTTGCAGTGG + Intronic
977058251 4:92220615-92220637 AGTCTAAGAAAGATTTGCAGAGG - Intergenic
979908930 4:126335183-126335205 CATCTAAGGTAGCATTGCAGTGG + Intergenic
980738445 4:136919349-136919371 GTTCTAAGGAAACTTGCCAGTGG + Intergenic
981489627 4:145325792-145325814 GTTTTCAGGCAGCTTTGCAGTGG + Intergenic
982378416 4:154720984-154721006 GCTCTAAAGAATCTTTGCTGGGG - Intronic
982736287 4:159010231-159010253 GTTCTAAGGGAGCTTTGGATAGG + Intronic
987665642 5:20935530-20935552 CTTCCAAGGAAGCTTTGAAGGGG - Intergenic
988757054 5:34266640-34266662 CTTCCAAGGAAGCTTTGAAGGGG + Intergenic
990076101 5:51847661-51847683 GGTGGAAGGGAGCATTGCAGCGG - Intergenic
990725067 5:58744319-58744341 GGTCCCAGGAACCTTTGCAGAGG - Intronic
993522075 5:88915227-88915249 GATCCAAGGAAACTTAGCAGAGG - Intergenic
997451688 5:133988830-133988852 GACCTTAGGGAGCTTTGCAGAGG - Intronic
997712542 5:136017995-136018017 GCTCCAAGGAAGCTTCGGAGAGG - Intergenic
998510688 5:142711707-142711729 GGTCTCATGAAGCTTTGGCGTGG - Intergenic
998930672 5:147177666-147177688 GGGAGAGGGAAGCTTTGCAGGGG - Intergenic
1002308975 5:178302811-178302833 GTTCTAAGCAAGCTGTGCATAGG + Intronic
1003674189 6:8188122-8188144 GCTCTAAGAAAGCTCTGCACAGG - Intergenic
1004958539 6:20758036-20758058 AGACTAAGGAAGCTTTGCCATGG - Intronic
1011494868 6:87927674-87927696 GGACCAGGAAAGCTTTGCAGAGG - Intergenic
1012227941 6:96726323-96726345 TGTCCAAGGAAGCATTGCTGAGG - Intergenic
1014291284 6:119561624-119561646 GGTCTTAGGAAGCATTCCCGTGG + Intergenic
1015750522 6:136553910-136553932 GGTCAAGGAAAGCTTTCCAGAGG - Intergenic
1017248029 6:152248767-152248789 GGATTAGGGAAGCTTTGTAGAGG - Intronic
1018369823 6:163157345-163157367 GGTCCTGGGAGGCTTTGCAGAGG - Intronic
1019736166 7:2650770-2650792 GGCCTGAGGAAGCTTTGAAAGGG - Intronic
1023265691 7:38403549-38403571 GTTCTAAGGTATGTTTGCAGGGG - Intronic
1024044514 7:45577691-45577713 GAACGAAGGAATCTTTGCAGGGG + Intronic
1026093757 7:67324090-67324112 GATCCAAGGAAACTTAGCAGAGG + Intergenic
1031226244 7:119041661-119041683 GCTCTTTGGAGGCTTTGCAGTGG - Intergenic
1033278251 7:139988650-139988672 GGTCAAAGGAGGCTTTGGAGGGG - Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034397153 7:150835886-150835908 GGTCTTTGGGGGCTTTGCAGGGG + Intronic
1037132644 8:15425089-15425111 GGATTGAGTAAGCTTTGCAGAGG + Intronic
1037292596 8:17367096-17367118 TGTTTAAGCAATCTTTGCAGTGG - Intronic
1037482351 8:19316067-19316089 GGTCTGAGAAAGCCTTGGAGCGG + Intronic
1037685697 8:21137725-21137747 GGTCCCAGGAAGCTATGCTGGGG + Intergenic
1037737228 8:21577507-21577529 GGGCAAATGGAGCTTTGCAGAGG - Intergenic
1037800732 8:22033882-22033904 GGTCTAGGAAAGCCCTGCAGAGG - Intronic
1037912824 8:22754173-22754195 GGTCTAGGGCAGCTTCCCAGAGG - Intronic
1039043872 8:33432856-33432878 GGTCTAAGTAAGCTCTTCAAAGG + Intronic
1039906318 8:41789047-41789069 GTGCCAGGGAAGCTTTGCAGAGG - Intronic
1043832745 8:85009473-85009495 GGTGTAGGGAGTCTTTGCAGAGG - Intergenic
1044368650 8:91381723-91381745 GGACTGAGGAAACTTTGGAGGGG - Intronic
1045550227 8:103164747-103164769 GGCCTAGGGAGGCTTTGCAGAGG - Intronic
1046183581 8:110684364-110684386 GGTCTGAGGAATATTTGCATAGG - Intergenic
1048329186 8:133460750-133460772 GGTCAGAGGAAGCTCTTCAGAGG + Intronic
1048447342 8:134501651-134501673 AGTCAAAGGAGGCTTTGAAGGGG + Intronic
1049195443 8:141313212-141313234 TCTCTAAGGAAGCTGGGCAGGGG - Intergenic
1057504805 9:95625442-95625464 GGGGTGAGGGAGCTTTGCAGAGG + Intergenic
1058569469 9:106324953-106324975 GCTCGAAGGAAGCTTTGGGGTGG + Intergenic
1186572275 X:10727780-10727802 GATCTAAAGAACCCTTGCAGGGG + Intronic
1189321328 X:40089419-40089441 GGCCTAAGGAAGCTTTTCAGAGG - Intronic
1190939263 X:55025125-55025147 GGTCTAAGCAGGCTTTGCAGAGG + Intronic
1194494723 X:94600263-94600285 GGTCTCAGGAAGCTTTGGCGTGG + Intergenic
1198493370 X:137165962-137165984 GGTCTATTGAAGTTTTGAAGTGG + Intergenic