ID: 902608917 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:17585678-17585700 |
| Sequence | ACTCCCCTACAATGACCTGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 89 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 76} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 902608917_902608920 | 9 | Left | 902608917 | 1:17585678-17585700 | CCTCCAGGTCATTGTAGGGGAGT | 0: 1 1: 0 2: 0 3: 12 4: 76 |
||
| Right | 902608920 | 1:17585710-17585732 | TTTCTAGTCCAAGAGACTGTTGG | 0: 1 1: 0 2: 3 3: 11 4: 147 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 902608917 | Original CRISPR | ACTCCCCTACAATGACCTGG AGG (reversed) | Intronic | ||