ID: 902608917

View in Genome Browser
Species Human (GRCh38)
Location 1:17585678-17585700
Sequence ACTCCCCTACAATGACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902608917_902608920 9 Left 902608917 1:17585678-17585700 CCTCCAGGTCATTGTAGGGGAGT 0: 1
1: 0
2: 0
3: 12
4: 76
Right 902608920 1:17585710-17585732 TTTCTAGTCCAAGAGACTGTTGG 0: 1
1: 0
2: 3
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902608917 Original CRISPR ACTCCCCTACAATGACCTGG AGG (reversed) Intronic