ID: 902608920

View in Genome Browser
Species Human (GRCh38)
Location 1:17585710-17585732
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902608917_902608920 9 Left 902608917 1:17585678-17585700 CCTCCAGGTCATTGTAGGGGAGT 0: 1
1: 0
2: 0
3: 12
4: 76
Right 902608920 1:17585710-17585732 TTTCTAGTCCAAGAGACTGTTGG 0: 1
1: 0
2: 3
3: 11
4: 147
902608918_902608920 6 Left 902608918 1:17585681-17585703 CCAGGTCATTGTAGGGGAGTGAC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 902608920 1:17585710-17585732 TTTCTAGTCCAAGAGACTGTTGG 0: 1
1: 0
2: 3
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type