ID: 902609707

View in Genome Browser
Species Human (GRCh38)
Location 1:17589796-17589818
Sequence GTGGAGAAACTCAGTCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902609704_902609707 -9 Left 902609704 1:17589782-17589804 CCAGGGGTGAAGTTGTGGAGAAA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 902609707 1:17589796-17589818 GTGGAGAAACTCAGTCTGGTGGG 0: 1
1: 0
2: 2
3: 16
4: 220
902609696_902609707 17 Left 902609696 1:17589756-17589778 CCAAGGGTTTATATCTCCAGGGT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 902609707 1:17589796-17589818 GTGGAGAAACTCAGTCTGGTGGG 0: 1
1: 0
2: 2
3: 16
4: 220
902609702_902609707 1 Left 902609702 1:17589772-17589794 CCAGGGTGGGCCAGGGGTGAAGT 0: 1
1: 0
2: 1
3: 33
4: 266
Right 902609707 1:17589796-17589818 GTGGAGAAACTCAGTCTGGTGGG 0: 1
1: 0
2: 2
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902609707 Original CRISPR GTGGAGAAACTCAGTCTGGT GGG Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
901055091 1:6445591-6445613 GTGGAGAGTCTCAGTCTTGGGGG + Intronic
901225410 1:7610481-7610503 GAGGAGAAACTGAGGCTGGGGGG - Intronic
902067081 1:13697610-13697632 GAGGAGACACCCAGTGTGGTAGG + Intergenic
902609707 1:17589796-17589818 GTGGAGAAACTCAGTCTGGTGGG + Intronic
903066030 1:20700015-20700037 GTGCAGAAACTCAGTCTGGAGGG + Intronic
904638765 1:31905466-31905488 TTGGAGTACCTCAGTCTGGAGGG - Intergenic
904707433 1:32402001-32402023 GGGGAGATTCTCAGTGTGGTGGG + Intergenic
904894608 1:33805029-33805051 CTTTAGAAACTCAGGCTGGTGGG + Intronic
905317639 1:37093749-37093771 GTGGAGCAACCCAGCCTGCTGGG + Intergenic
905988335 1:42309264-42309286 GTGGAGGAGGTCAGTGTGGTTGG - Intronic
906109407 1:43312977-43312999 GGAGAGGAATTCAGTCTGGTGGG + Intronic
906384030 1:45351896-45351918 CTTGAGAAACTCATGCTGGTGGG + Intronic
906792046 1:48667759-48667781 GTGGAGAATCTCAATCTATTTGG + Intronic
907695191 1:56718294-56718316 GTGTAGAATGTCTGTCTGGTGGG - Intergenic
907739458 1:57150634-57150656 GTGGAGAAACTGTATTTGGTAGG + Intronic
908314802 1:62922256-62922278 GGGGAGAGACTCTGTCTTGTTGG + Intergenic
908414451 1:63899202-63899224 GTGGAGAAACTCAGTGAGTTAGG - Intronic
910159620 1:84259279-84259301 GTGGAGAAACCCAGTGTGCTAGG - Intergenic
910773287 1:90851198-90851220 GTGGAGAGACCCAGTCTGGAGGG - Intergenic
911415035 1:97561152-97561174 GTTTAGAAGCTCATTCTGGTAGG + Intronic
913082700 1:115403566-115403588 ATGGAGGAGCTCAGTCTGGAGGG - Intergenic
913510639 1:119558647-119558669 GGGGAGATTCTCAGTGTGGTGGG + Intergenic
913514854 1:119596060-119596082 GGGGAGAATCTCAGTGTGGTGGG + Intergenic
914419516 1:147516517-147516539 CTCAGGAAACTCAGTCTGGTTGG - Intergenic
914523259 1:148437751-148437773 ATGGAAAAACTCTCTCTGGTTGG + Intergenic
915030629 1:152877796-152877818 GTGGAAAAGCTCAGTGTGGCTGG - Intergenic
915215129 1:154335191-154335213 GTGCGGAAACCCAGCCTGGTGGG + Intronic
918453826 1:184686780-184686802 GTGGAGGAACTCAGGCTGTAAGG + Intergenic
920527108 1:206675261-206675283 ATGGAGGAACCTAGTCTGGTTGG - Intronic
920536493 1:206740104-206740126 GACGAGAAATTCAGTCTGATCGG + Intergenic
921080938 1:211737915-211737937 GTGGGAAAACCCACTCTGGTTGG - Intergenic
921414658 1:214871805-214871827 GGGGAGATTCTCAGTGTGGTGGG - Intergenic
921807248 1:219470118-219470140 CTGGAGAAATTAAGGCTGGTAGG + Intergenic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923660378 1:235952068-235952090 GTGCAGCAGGTCAGTCTGGTGGG - Intergenic
1063384118 10:5605261-5605283 GGAGTGAAACTCAGTCTGGCTGG - Intergenic
1065239383 10:23690212-23690234 GTGGAGAGACCAAGTCTGATAGG + Intergenic
1068338298 10:55667233-55667255 GGGGAGATTCTCAGTGTGGTGGG + Intergenic
1069792086 10:71029346-71029368 GTAGAGAAAGTCTGTCTGGCAGG - Intergenic
1070400283 10:76047215-76047237 CTGGAGTACCTCAGTCTGCTGGG + Exonic
1072046940 10:91666673-91666695 GGGGAGATTCTCAGTGTGGTGGG + Intergenic
1072971634 10:100022394-100022416 ATGGACAAAATGAGTCTGGTTGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074156292 10:110802775-110802797 GGCGAGGAGCTCAGTCTGGTGGG + Intronic
1074234587 10:111572674-111572696 CTGGATAAACTCAATCTGCTTGG + Intergenic
1075680384 10:124326969-124326991 AAGGAGAAGCTCACTCTGGTCGG - Intergenic
1076000848 10:126911970-126911992 GTGAAGAAACACAGTCCTGTTGG - Intronic
1079901095 11:26185798-26185820 GTGGAGATACTCTGGTTGGTAGG + Intergenic
1080156148 11:29113560-29113582 GAGGAGAAAGCCAGCCTGGTGGG + Intergenic
1081846878 11:46247085-46247107 GAAGAAAACCTCAGTCTGGTGGG - Intergenic
1083047427 11:59749369-59749391 GAGGAGAACCACAGTCAGGTGGG - Intronic
1083951242 11:65957657-65957679 GTGGAAAAACTCAGCCTTGCTGG - Intronic
1084095695 11:66909685-66909707 GAGGAGAAACCAAGTGTGGTGGG + Intronic
1084293927 11:68197796-68197818 GTGGAGAATCTCTCTCTGCTAGG - Intronic
1084887244 11:72218783-72218805 GAGGAGAAAGTCAGGATGGTGGG + Intronic
1085564542 11:77501342-77501364 GTGGAGAGACTGAGTCCGGGTGG - Intergenic
1086581746 11:88408072-88408094 GGGGAGATTCTCAGTGTGGTGGG + Intergenic
1087607410 11:100393535-100393557 CTGAAGAAACTCAGTATGTTTGG - Intergenic
1088350029 11:108875819-108875841 CTGGAGATACTCAGTGAGGTTGG + Intronic
1089195172 11:116690056-116690078 GTGGGGACACTCAGGCTGCTAGG - Intergenic
1089455156 11:118621585-118621607 TTGGAGAAGCTCAGACTGGGAGG + Intronic
1090978274 11:131694419-131694441 GTCTAGAAGCTGAGTCTGGTGGG + Intronic
1091332736 11:134743445-134743467 GAGGAGAAACACAGTCAGGAGGG - Intergenic
1091620302 12:2082621-2082643 GTGGAGCATCTCAGTGTGGCAGG - Intronic
1093061515 12:14612134-14612156 GTGAAGATTCTCAGACTGGTGGG + Intergenic
1096009320 12:48199483-48199505 TTTGAGAATCTCAGTCTAGTAGG - Intergenic
1100130126 12:91482195-91482217 GTGGAGAAACAAAGTCTGAGAGG + Intergenic
1101758224 12:107638286-107638308 GTGAAGAGAATCAGTCTGGAAGG + Intronic
1103016868 12:117501558-117501580 GTGGGGATACTGAGTCTGGTGGG + Intronic
1103172337 12:118832433-118832455 GTCCATAAACTCAGTGTGGTAGG + Intergenic
1104831939 12:131758264-131758286 GTGGAGAAGGTCACGCTGGTTGG - Intronic
1105057329 12:133114258-133114280 GTGCAGAAACTAAGACTGTTAGG - Exonic
1107400077 13:40060985-40061007 ATGGGGAAACTGAGTCTGGGAGG + Intergenic
1109187216 13:59284435-59284457 GAAGTGAAAATCAGTCTGGTTGG + Intergenic
1110585154 13:77181696-77181718 ATGGAAAAACTCAGCCAGGTAGG - Exonic
1112116568 13:96361733-96361755 ATGGAGAAACTGAGTTTTGTTGG - Intronic
1112229419 13:97573050-97573072 GTGGAGATACTTGGTGTGGTGGG - Intergenic
1114005735 14:18311514-18311536 GTGGAGAAATTCCTTCTGTTGGG - Intergenic
1114556886 14:23567336-23567358 GTGGAGAAACACTCTCTGGTCGG + Exonic
1116529703 14:45954844-45954866 GAGGAGAAAGTCAGTCTGCAAGG - Intergenic
1118777965 14:68985602-68985624 GTGGAGGAATTCATCCTGGTGGG - Intergenic
1119577084 14:75734496-75734518 GTGGAGATGCGCAGTCAGGTGGG + Intronic
1121797302 14:96745856-96745878 GAGGAGACACTCAGTCTGTGGGG - Intergenic
1122289166 14:100670512-100670534 GTTGGGAAACTGAGTCTGGGTGG - Intergenic
1124106931 15:26747133-26747155 GAGGAGAATCCCAGTCTGGGAGG - Intronic
1126302542 15:47214346-47214368 GTGGAAAAGCACAGTCTGGAAGG + Intronic
1126317941 15:47390827-47390849 GAAGAAAAACTCAGTCTAGTAGG - Intronic
1128357167 15:66936314-66936336 GTGGAGAAAGTCAGCCTGCAAGG + Intergenic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1130197754 15:81796689-81796711 GGGGAGGAGCTCAGGCTGGTAGG - Intergenic
1130773890 15:86955903-86955925 ATGGAGAAACTCCTGCTGGTGGG + Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1133896005 16:9929578-9929600 GTGTAGAAACATAGGCTGGTTGG - Intronic
1135955166 16:26950543-26950565 CTGAAGAAATTCAGTGTGGTTGG + Intergenic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1139605361 16:68014330-68014352 GTGGAGAAACTCAGGTAGGCTGG - Intronic
1139685432 16:68599606-68599628 ATGGAGAAACTGAGTCCTGTGGG + Intergenic
1140857244 16:78988870-78988892 GTGGAGAAACGAGCTCTGGTGGG + Intronic
1142996287 17:3762317-3762339 GTGGAGAAGCACTGCCTGGTGGG + Intronic
1143236450 17:5405400-5405422 GTTGAGAAACACAGAGTGGTGGG - Intronic
1143291888 17:5837759-5837781 GAGCAGGAACTCAGTCCGGTGGG + Intronic
1146800864 17:35820231-35820253 ATGGACAAAGTCAGTCAGGTTGG + Exonic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1146928094 17:36758687-36758709 GGGGAGAATCACAGTCTGGAGGG + Intergenic
1148495416 17:48050811-48050833 GTGGAGAAAGTAAGTCACGTGGG + Exonic
1150106783 17:62468010-62468032 ATGGAGAAACTGAGTCTTGGAGG - Intronic
1152371852 17:79893162-79893184 GAGGATAAAATCAGTTTGGTGGG + Intergenic
1152471164 17:80490782-80490804 GTGGAGAAACCAAGACTGGAGGG - Intergenic
1153676916 18:7464038-7464060 GTGGAGAAAGTCATTCAGGTTGG + Intergenic
1154531692 18:15352367-15352389 GTGGAGAAATTCCTTCTGATGGG + Intergenic
1154999380 18:21671609-21671631 GTGGTGAAACTCCTTCTGGGTGG + Intronic
1165129808 19:33624603-33624625 GTTGAGAAAGTGTGTCTGGTGGG + Intronic
1165279390 19:34783520-34783542 GAGTAGGAACTCAGACTGGTTGG + Intergenic
1166354810 19:42220618-42220640 GCCGAGGAGCTCAGTCTGGTAGG + Intronic
1166783026 19:45352159-45352181 GAGGAGAAGCTCAGCCTGGGAGG + Intronic
1166938526 19:46349495-46349517 GTGGAGAAGCTCGATCCGGTGGG + Intronic
1167505968 19:49871240-49871262 GTGGAGAAACTGAGGCTTGGAGG - Intronic
1167791917 19:51688561-51688583 GTGGAGATACTAAAGCTGGTGGG + Intergenic
925418118 2:3687880-3687902 GGGGAGATTCTCAGTATGGTGGG + Intronic
926559799 2:14403476-14403498 GAGGAAAAACCCAGTCTAGTGGG - Intergenic
929098502 2:38286478-38286500 GGGGAGATTCTCAGTGTGGTAGG - Intergenic
930281068 2:49370438-49370460 AAGGAGAAACTCTGTCTTGTTGG - Intergenic
931542800 2:63348033-63348055 CTTAAGAAACTCAGTCTAGTAGG + Intronic
931555799 2:63502866-63502888 GTGAAGAACCACAGTCTGGCTGG - Intronic
933500829 2:83109138-83109160 GGGAAAAAAATCAGTCTGGTGGG + Intergenic
933723843 2:85415006-85415028 TCAGAGAAACTCATTCTGGTTGG - Intronic
934150811 2:89145966-89145988 ATGGAGCAACTCAGTTTGGCGGG - Intergenic
934216466 2:90036059-90036081 ATGGAGCAACTCAGTTTGGCGGG + Intergenic
934557370 2:95294582-95294604 GGGGAGAAACTGAGGCTGGGGGG - Intergenic
935186858 2:100742553-100742575 CTGTAGAAACTCAGTCAGGATGG - Intergenic
936284041 2:111167335-111167357 AGTGAGAAACTCAGTCTGGCAGG + Exonic
938530787 2:132183612-132183634 GTGGAGAAATTCCTTCTGATGGG + Intronic
941695626 2:168548262-168548284 GAGGAGATACTCAATCTGGTGGG + Intronic
941848231 2:170152520-170152542 GTTCAGACCCTCAGTCTGGTAGG - Intergenic
942353069 2:175075169-175075191 TTTAACAAACTCAGTCTGGTTGG + Intronic
945038944 2:205728518-205728540 GAGGAGAAATTCAGTTTGTTGGG + Intronic
945498385 2:210537349-210537371 GTTGTGTAATTCAGTCTGGTTGG + Intronic
947887533 2:233585572-233585594 GTGGAGAAACTCATTCTCAGGGG + Intergenic
947889403 2:233603685-233603707 GTGGAGAAACTCATTCTCAGGGG + Intergenic
947893654 2:233647968-233647990 GTGGAGAAACTCATTCTCAGGGG + Intronic
947895937 2:233672067-233672089 GTGGAGAAACTCATTCTCAGGGG + Exonic
948676707 2:239601192-239601214 GTGAGGAAACTGAGGCTGGTAGG - Intergenic
1170169374 20:13393760-13393782 GGGGAGATTCTCAGTGTGGTAGG - Intronic
1172739689 20:37156199-37156221 GAGGAGAAACCCAATCTGGCTGG + Intronic
1174276334 20:49407295-49407317 ATGGGGAAACTGAGACTGGTGGG + Intronic
1176765664 21:13015801-13015823 GTGGAGAAATTCCTTCTGATGGG - Intergenic
1179496184 21:41772621-41772643 GTGGAGAGCCTCTGCCTGGTGGG - Intergenic
1180077017 21:45468127-45468149 AAGGAGAAACTGAGTCTGGGAGG - Intronic
1180512848 22:16110550-16110572 GTGGAGAAATTCCTTCTGATGGG - Intergenic
1183861458 22:40673378-40673400 GGGGAGATGCTCAGTGTGGTGGG + Intergenic
1183948724 22:41340888-41340910 GTGGACACACTCAGGCTGGGAGG + Intronic
949623042 3:5837620-5837642 GTGGAGAGACTCCTTCTGCTTGG - Intergenic
950660668 3:14465007-14465029 GTGGAGAAACTGAGGCTTGGTGG - Intronic
952887382 3:38020012-38020034 GTGGGGAAACTGAGGCTGGCTGG - Intronic
954506628 3:51082259-51082281 GTAGAAAAACGCAGTCTGGTGGG - Intronic
955765850 3:62343294-62343316 GGGCAGAAAGTCAGTATGGTTGG - Intergenic
956337580 3:68181197-68181219 GGTGAGAGACTCAGTCAGGTGGG + Intronic
956644429 3:71442262-71442284 GTCAAGCAACTCAGTCTGGTTGG - Intronic
956942741 3:74182729-74182751 CTTGAGAGACTGAGTCTGGTTGG + Intergenic
957913650 3:86656821-86656843 GTGGGGAAACTCAATAGGGTAGG - Intergenic
963292150 3:143503173-143503195 GGGGAGATTCTCAGTGTGGTTGG + Intronic
965631695 3:170739946-170739968 GTGGAGAACATCAGCCTTGTTGG + Intronic
968234494 3:197023684-197023706 CTGGAAAAGCTCAGTCTGGCTGG - Intronic
973994256 4:56440539-56440561 TTGCAGAACTTCAGTCTGGTTGG - Intronic
974472549 4:62337464-62337486 CTGGAGAAAATGAGTCTGATGGG - Intergenic
975456330 4:74595805-74595827 GTGTAGAATGTCAATCTGGTAGG + Intergenic
975769272 4:77703756-77703778 GGGGAGAAACCCAGTCTGGAGGG + Intergenic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
980105709 4:128586419-128586441 GTGAAGAAACTCAGGAGGGTGGG - Intergenic
980250761 4:130311620-130311642 TTGTAGAAACTCACTCTGGCAGG + Intergenic
981648602 4:147028937-147028959 GTGGAGAAAGTGAGTCAAGTTGG - Intergenic
984860011 4:184229574-184229596 GTGGAGAAAAGTAGTATGGTGGG + Intergenic
985478712 5:93968-93990 GAGGACAAACTCATTCTGTTTGG - Intergenic
985887871 5:2694222-2694244 CTGGAGAAACTGAGTTTGTTTGG + Intergenic
986785914 5:11113753-11113775 GAGAAGCAGCTCAGTCTGGTGGG - Intronic
986847247 5:11769867-11769889 CTGGAGAAAATCAGTGGGGTTGG - Intronic
987453912 5:18119797-18119819 GGGGAGAAACTCACTCATGTGGG - Intergenic
988499415 5:31771994-31772016 GTGGAGAAGCCCCATCTGGTTGG + Intronic
988670405 5:33375369-33375391 TTGAAGAAACTAAGTCTTGTAGG - Intergenic
988705704 5:33724266-33724288 GTGGAGAAACTCTGGTTGATTGG + Intronic
988817792 5:34851714-34851736 TTTGAGAAAATCAGTCTGATGGG - Intronic
991956511 5:72000286-72000308 GAGGAGAAACTCAGGTTAGTTGG - Intergenic
994580323 5:101633084-101633106 GTGGAGAAATTCAAGCTGGCTGG - Intergenic
998662368 5:144254089-144254111 TTGGAGAAAACCAATCTGGTTGG + Intronic
999196252 5:149783575-149783597 GGAGAGAAACTCAGTGTGGTAGG + Intronic
999932740 5:156451249-156451271 ATGGAGAAATATAGTCTGGTTGG + Intronic
1000545564 5:162596957-162596979 GAGGAGAAAATCAGTGTGCTTGG + Intergenic
1001878356 5:175220387-175220409 GTGAAGAAACTGAGGCTGGGTGG - Intergenic
1002040661 5:176511587-176511609 GTGCAGATACTCAGTTTTGTGGG + Intergenic
1002773350 6:307943-307965 GTGGAAAAAATAAGTCTGGATGG - Intronic
1004335720 6:14762689-14762711 GTGGGGAAAATCAGGCTGGTTGG - Intergenic
1011071864 6:83393494-83393516 GGGGAGATTCTCAGTGTGGTGGG - Intronic
1011680389 6:89777742-89777764 GTGGGGTAACTGAGTCAGGTGGG - Intronic
1011946376 6:92909196-92909218 GTGAAGAAACTCATGATGGTAGG + Intergenic
1012420748 6:99062278-99062300 GTAGAGAAACACAGGGTGGTGGG - Intergenic
1016816843 6:148310899-148310921 GTGTAGAAAGTCAGTCTGACAGG + Intronic
1017518690 6:155182167-155182189 TTGGAGAAATTCAGTGTGGTGGG + Intronic
1017972764 6:159327412-159327434 GTGGGAAAACTGAGACTGGTGGG - Intergenic
1018298682 6:162376951-162376973 GAGGAGAAGCCCAGTCTGGGAGG + Intronic
1019034684 6:169044485-169044507 GTGAGGAAACTCAGGCTGGAAGG - Intergenic
1022015181 7:26343482-26343504 GTGGAGAAATTCAGTCAAATGGG + Intronic
1022190275 7:28010697-28010719 TTGGAGAAGCTGAGTCTGTTGGG - Intronic
1023112240 7:36825454-36825476 GTGGGGAAAGCCAGTATGGTCGG + Intergenic
1024381583 7:48703056-48703078 CTGGAGCAACTGAGTCTAGTAGG + Intergenic
1029482798 7:100823355-100823377 TGGGAGAAACTCAGTGTGGCTGG + Intronic
1029614048 7:101645239-101645261 GTTGAGAAAGTCATTCTGGGTGG + Intergenic
1030549340 7:110938307-110938329 GCTGAGAAATTCAGTCTAGTTGG + Intronic
1030677468 7:112398937-112398959 GAGGAGAAGCTCAGGCTGGCTGG + Intergenic
1032035828 7:128520552-128520574 ATGGAGAAACTGAGTCTTGGAGG - Intergenic
1032080224 7:128854952-128854974 GGGCAGAAACCCAGTCTGGAAGG - Intronic
1032802571 7:135328634-135328656 GTGTGGAGACTCAATCTGGTTGG + Intergenic
1034353438 7:150432299-150432321 ATGGAGAAACACAGTCTGGTGGG + Intergenic
1034605727 7:152311842-152311864 TGGGATGAACTCAGTCTGGTTGG - Exonic
1039377937 8:37055932-37055954 GTGGAGAAGCTCTGTCTCATAGG - Intergenic
1039803933 8:40982913-40982935 GAGGAGAAACTCAGTTTGAAAGG + Intergenic
1044446574 8:92284240-92284262 GTGGAAAAACTCAGGAGGGTGGG - Intergenic
1046525645 8:115378981-115379003 GGGGAGAAACTCAGGCAGATGGG - Intergenic
1050256626 9:3799116-3799138 GTAGAGAAATTCAGTCTGTGTGG + Intergenic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050592903 9:7178689-7178711 GCTGAGAAACTCAGTGAGGTGGG + Intergenic
1052033229 9:23651653-23651675 ATGGAAAATCACAGTCTGGTAGG + Intergenic
1053709393 9:40790126-40790148 GTGGAGAAATTCCTTCTGATGGG + Intergenic
1054419301 9:64910929-64910951 GTGGAGAAATTCCTTCTGATGGG + Intergenic
1058389986 9:104485320-104485342 GATGAGAAATTCAGTGTGGTGGG - Intergenic
1058979803 9:110158577-110158599 GAGGAAAAACTCAACCTGGTTGG - Intronic
1060052081 9:120384785-120384807 CTGGAGGAACTCAGGTTGGTCGG - Intergenic
1185671213 X:1811526-1811548 GTGGAGAAAATGGGACTGGTGGG + Intergenic
1186114122 X:6287379-6287401 GTGCAGAAACTCAGCCTTGTGGG - Intergenic
1187019977 X:15370902-15370924 GAGGAGATCCTCAGTGTGGTGGG + Intronic
1187093811 X:16125743-16125765 ATGGAGAAACTCTGTCCAGTCGG - Intronic
1193300860 X:79886862-79886884 GTGGAGGAACTCAGCCAGGAGGG - Intergenic
1195654468 X:107321931-107321953 GTGAAGAAATTAAGTGTGGTGGG + Intergenic
1197240626 X:124119210-124119232 GCGAAGAGACTCAGTCTGGCAGG - Intronic
1199494093 X:148433743-148433765 ATGAAGAAAATCAGTATGGTTGG + Intergenic
1201482646 Y:14456599-14456621 CTGTAGAAACTCAGCCTTGTGGG + Intergenic
1201584197 Y:15542946-15542968 GTGGTGGGACTCAGTCTGGGTGG + Intergenic
1201861052 Y:18597517-18597539 CGGGAGAAATTCAGCCTGGTTGG - Intergenic
1201872271 Y:18722863-18722885 CGGGAGAAATTCAGCCTGGTTGG + Intergenic