ID: 902610496

View in Genome Browser
Species Human (GRCh38)
Location 1:17594385-17594407
Sequence TCTCCCACACAGAGCTGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902610491_902610496 6 Left 902610491 1:17594356-17594378 CCTGTGTTCTAATCCCTCTGGTG 0: 1
1: 0
2: 2
3: 10
4: 156
Right 902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 166
902610493_902610496 -8 Left 902610493 1:17594370-17594392 CCTCTGGTGCAACCGTCTCCCAC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 166
902610487_902610496 24 Left 902610487 1:17594338-17594360 CCCAGCTGGCTTCCAGAACCTGT 0: 1
1: 0
2: 1
3: 29
4: 208
Right 902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 166
902610486_902610496 25 Left 902610486 1:17594337-17594359 CCCCAGCTGGCTTCCAGAACCTG 0: 1
1: 1
2: 7
3: 25
4: 313
Right 902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 166
902610489_902610496 12 Left 902610489 1:17594350-17594372 CCAGAACCTGTGTTCTAATCCCT 0: 1
1: 0
2: 6
3: 28
4: 201
Right 902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 166
902610488_902610496 23 Left 902610488 1:17594339-17594361 CCAGCTGGCTTCCAGAACCTGTG 0: 1
1: 0
2: 1
3: 26
4: 259
Right 902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 166
902610492_902610496 -7 Left 902610492 1:17594369-17594391 CCCTCTGGTGCAACCGTCTCCCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902610496 Original CRISPR TCTCCCACACAGAGCTGGTT TGG Intronic
900327860 1:2118702-2118724 ACACACACACAGAGCTGGTGTGG - Intronic
901064635 1:6489000-6489022 TCTCCCACCCAGACCAGGCTGGG - Intronic
902551255 1:17220947-17220969 GCTCCCAGCCACAGCTGGTTGGG - Intronic
902610496 1:17594385-17594407 TCTCCCACACAGAGCTGGTTTGG + Intronic
904597590 1:31656556-31656578 TTTCTCACACAGAGCTGGGCTGG - Intronic
904605325 1:31694994-31695016 TCTTCCACACAGTCCTGGCTTGG + Intronic
906203647 1:43975463-43975485 TCCCCCACCCACAGCTTGTTGGG + Intronic
913972180 1:143423732-143423754 TCTGCCACACAGATCAGGTCTGG + Intergenic
914066561 1:144249345-144249367 TCTGCCACACAGATCAGGTCTGG + Intergenic
914112592 1:144717009-144717031 TCTGCCACACAGATCAGGTCTGG - Intergenic
919208298 1:194446661-194446683 TCTGACACACAGCGCTTGTTTGG + Intergenic
922696437 1:227733321-227733343 TCTCCCAGCCAGAGCTGGGCTGG - Intronic
1065264686 10:23962697-23962719 TTGCCCACACAGAACTGGATGGG + Intronic
1066080229 10:31923343-31923365 ACTCACACACAAAGCTGGTGAGG + Intronic
1068982044 10:63072306-63072328 TCTCCCCAACCTAGCTGGTTTGG + Intergenic
1069899007 10:71696293-71696315 TGTCCCCCACAGGGCTGGGTGGG - Intronic
1074840235 10:117344342-117344364 TCTGCCACCCTGAGCTTGTTGGG - Intronic
1075648063 10:124109434-124109456 TCCCCCAAACAGAGGTGGTGAGG - Intergenic
1075687570 10:124375252-124375274 CCCCCCACACTGAGCAGGTTGGG + Intergenic
1076893785 10:133298675-133298697 ACTCCCACTCAGGGCTGGTCAGG + Intronic
1077299893 11:1841982-1842004 ACTCCCACCCAGACCTGGCTCGG - Intergenic
1077708471 11:4511971-4511993 TTACCAACACAGAGCTGATTAGG + Intergenic
1079367965 11:19825969-19825991 TCTCCCTCACAGAGCAGTTCTGG + Intronic
1080580620 11:33640204-33640226 TCTCTCAGACTGAGCTGTTTGGG - Intronic
1081063280 11:38505964-38505986 TCTCCAAGACAGAGTTGCTTTGG + Intergenic
1082723422 11:56706446-56706468 GCACCCACACAGAGCTCCTTTGG - Intergenic
1084786426 11:71444276-71444298 TCTCCCACACAGAGCCTCTTAGG - Intronic
1085484941 11:76854874-76854896 TCTCCCACAGAGAGATAGCTAGG + Intergenic
1087721859 11:101674813-101674835 TTTCCCACAGAGTGCTGTTTTGG + Intronic
1088898343 11:114094711-114094733 TATCCCACAGTGAGCTGGTTGGG + Intronic
1090138196 11:124222715-124222737 GCTCTCACACATAGCTGGTGAGG - Intergenic
1091293986 11:134459657-134459679 TCTCCCACACAAAGCGGGCCAGG + Intergenic
1091502306 12:1030364-1030386 TCTGCCACACAAAGATGTTTAGG + Intronic
1091690701 12:2595453-2595475 TCACCTACAGAGAGCCGGTTTGG + Intronic
1092252959 12:6911385-6911407 TCTGCCACACGGATCTGGTGGGG + Intronic
1094108983 12:26841037-26841059 TCTTCAAAACAGATCTGGTTTGG - Intergenic
1094492724 12:30971016-30971038 TCTCACACACAGAGCCAGCTGGG + Intronic
1095098956 12:38162097-38162119 TCACCCACCCAGAGCTGCTAGGG + Intergenic
1096258085 12:50074849-50074871 ACACACACACAGAGCTGGTGGGG - Intronic
1097450413 12:59731697-59731719 TCTTCCACATAGAGCTCATTTGG + Intronic
1098638929 12:72817032-72817054 TTTCTCACACAGAGCCAGTTTGG - Intergenic
1099005035 12:77225625-77225647 TCTGCCTCACAGAGGTGGTGCGG + Intergenic
1099167799 12:79328051-79328073 TCTTACACACAGAGCTGATGTGG - Intronic
1101506231 12:105349293-105349315 TCTCCCACCCAAAACTGGGTTGG + Intronic
1103054125 12:117805221-117805243 TCTCCCACACACACCTTTTTAGG + Intronic
1103842471 12:123876261-123876283 ACTCCCACCGAGGGCTGGTTGGG + Intronic
1104972097 12:132535472-132535494 GCTCCCTGACAGTGCTGGTTGGG + Intronic
1108582989 13:51843046-51843068 TCAGCCACCCAGTGCTGGTTAGG - Intergenic
1109436093 13:62304924-62304946 TCTCCAAAACAGAAGTGGTTTGG + Intergenic
1109609773 13:64749484-64749506 TCTGCCACACTGAGCAGGTTAGG + Intergenic
1110775361 13:79403050-79403072 TCTCTCAAACAGAGGTCGTTTGG + Intronic
1110780151 13:79455959-79455981 TCTCTGAAACAGAGCTTGTTGGG + Intergenic
1110800780 13:79692113-79692135 TCTCTCTCACTGAGATGGTTTGG - Intergenic
1112290498 13:98141859-98141881 TCTGTGACACACAGCTGGTTGGG + Intergenic
1113889210 13:113727138-113727160 TGTGCCACACAGAGCTGGCTCGG + Intronic
1114353128 14:21876518-21876540 TCCCCCTCACAGTGCTGATTTGG + Intergenic
1115343624 14:32318705-32318727 TCTCCCTCACAAACCTGCTTTGG - Intergenic
1118882867 14:69843520-69843542 TCTCCCACTCAGATCTGGCTGGG - Intergenic
1118902817 14:70000961-70000983 TCTCCGAGACATAGCAGGTTAGG + Intronic
1119778590 14:77263378-77263400 TCTCCCACACAGCAATGGTGAGG + Intergenic
1121710013 14:96030700-96030722 TCAGCCACACAGAGCTGGTGAGG - Intergenic
1128213967 15:65921744-65921766 TCCCCCACAAAGAGCTGGTAGGG + Intronic
1128347109 15:66861279-66861301 TCTCCCAAACAGAGACCGTTGGG + Intergenic
1128692437 15:69735282-69735304 TCTCCCACCCAGGGTTGGTGTGG + Intergenic
1128715864 15:69907719-69907741 TCTTCCTCACAGAGCTTGTTTGG + Intergenic
1129784753 15:78302145-78302167 TCTCCCACACCGAGATAATTGGG + Intergenic
1130762430 15:86834303-86834325 TCTTGCACACTGAGCTGGTCTGG - Intronic
1130788174 15:87123285-87123307 TCACCTACACCGAGGTGGTTGGG + Intergenic
1131780210 15:95847782-95847804 TCTCCAACATAGTGCGGGTTTGG + Intergenic
1137530270 16:49275075-49275097 TCTCCCACAGATTGCAGGTTGGG - Intergenic
1141164670 16:81652504-81652526 ACTCCCACACACGGCTGGGTGGG - Intronic
1146495710 17:33320127-33320149 TCTCACACGCAGGGCTGGTATGG - Intronic
1147460916 17:40568487-40568509 TCTTACACACAGAGCTGCATTGG + Intergenic
1148152790 17:45405981-45406003 TCTCCCACACCGGGCTGGGAAGG + Exonic
1148559465 17:48597627-48597649 TCTCCCACAGGGTGCTGGGTGGG - Intronic
1149259436 17:54862920-54862942 TCTCACTCACAGAGCAGGTCTGG + Intergenic
1149963019 17:61132802-61132824 TGACCCACACAGACCTGGTAAGG - Intronic
1152545899 17:80999994-81000016 TCTCGTGCACAGGGCTGGTTTGG + Exonic
1152927325 17:83093270-83093292 TCTGCCACATGGAGCTGTTTGGG + Intronic
1153586688 18:6628366-6628388 ACTCCCACAGTGTGCTGGTTAGG - Intergenic
1155909607 18:31493312-31493334 TCTCCCACACAGAACATTTTTGG + Intergenic
1161990403 19:7681245-7681267 CCTCCCACGCAGACCTCGTTGGG + Intronic
1165236842 19:34428554-34428576 TCTCCCACATCGACCTGGTGAGG + Exonic
1165558677 19:36659132-36659154 TCTCCCATGGAGAGCTTGTTAGG - Intronic
1167916158 19:52741669-52741691 TTTCCCACACGGAGATGTTTGGG + Intergenic
926229004 2:10988916-10988938 GAACCCACACAGAGCTGGGTGGG + Intergenic
928364713 2:30691984-30692006 ATTCCCACGCAGAGCTGGTGAGG - Intergenic
929407375 2:41658307-41658329 TCTCTCACACAAAGCTGGATTGG + Intergenic
932398734 2:71465547-71465569 TCTCCAACACAGCACTGGTTGGG + Intronic
934176877 2:89584669-89584691 TCTGCCACACAGATCAGGTCTGG + Intergenic
934287184 2:91659029-91659051 TCTGCCACACAGATCAGGTCTGG + Intergenic
936373778 2:111923982-111924004 GCCCCCACACAGGGCTGGTGAGG + Intronic
936618820 2:114074212-114074234 TCTCCCTGACAGTGCTGATTGGG + Intergenic
937601450 2:123740455-123740477 TCTACTACACAGAGCTGTTATGG - Intergenic
938097759 2:128474582-128474604 TCTGCCACACGGAGCTGGGAGGG - Intergenic
938130392 2:128710502-128710524 TCTGCAACACAGAGCTGGTGCGG + Intergenic
939548711 2:143586950-143586972 TCTGACACACAGAGCTGTGTTGG - Intronic
944480459 2:200152493-200152515 TCTCCCTGACCGAGCTGGTCCGG + Intergenic
945058571 2:205888822-205888844 TCTTGCACACAGGGCTGGTTAGG - Intergenic
947624832 2:231612963-231612985 ACTCCTCCACAGGGCTGGTTTGG - Intergenic
1168820727 20:772113-772135 TTTCCCACAGAGGGCTGGATGGG + Intergenic
1168841182 20:911123-911145 CCTCCCAAACTGACCTGGTTTGG - Intronic
1169330625 20:4713460-4713482 TCTCACACACTGAGCTGTTTTGG + Intergenic
1170752095 20:19158924-19158946 TAACCCAAAGAGAGCTGGTTAGG - Intergenic
1171880253 20:30613371-30613393 TCTACCTCACAAAGCTGCTTGGG - Intergenic
1173601878 20:44301103-44301125 ACTCCCACTCAGAGCTGTTGTGG - Intergenic
1174882298 20:54293076-54293098 TCACCCACTCAGTGCTGCTTTGG + Intergenic
1178179425 21:30143125-30143147 TGTCACACACTGAGCTAGTTTGG - Intergenic
1178354022 21:31895567-31895589 TCTGTCACACAGAGATGGATGGG - Intronic
1180239298 21:46489584-46489606 TCTGCCACACTGCGCTTGTTGGG + Intronic
1183009913 22:34936467-34936489 TCTCCCACACTAAGTTGGTTAGG - Intergenic
1183542284 22:38436409-38436431 TGTTCCACACAGAGCTGGGCTGG + Intronic
1183916182 22:41121462-41121484 TCTCCCACACAGATCTGCTGAGG - Intronic
1183950465 22:41349692-41349714 TCTTCCTCACAGAGCTGCTGCGG + Intronic
952604650 3:35130317-35130339 TCTCCCAGACTGATATGGTTTGG - Intergenic
952855108 3:37763878-37763900 TCTCACCCAGAGAGCTGGCTTGG - Intronic
952985348 3:38774763-38774785 TCTCCCACACTGAATTGCTTTGG - Intronic
953182533 3:40609476-40609498 TCTCCTTCACAGAGCTGTCTTGG - Intergenic
954431895 3:50475320-50475342 TCTCCCACTGAGAGTTGGCTCGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956650345 3:71499079-71499101 TCTAGGACACAGAGCTGGGTGGG - Intronic
960326216 3:116299216-116299238 TCTCCTACCCACAGCTGTTTTGG - Intronic
960917845 3:122715196-122715218 TCTCCTTCAGAGAGCTGGTCAGG + Intronic
962693564 3:137925787-137925809 GCTCCAACACAGAGCTGGGAAGG + Intergenic
963965467 3:151364208-151364230 TCTCATTCACAGAGCAGGTTTGG + Intronic
967684422 3:192402817-192402839 TCTCCCACTCACAGATGCTTAGG + Intronic
969896674 4:10311856-10311878 TCTCCCTATCTGAGCTGGTTTGG + Intergenic
970122326 4:12770468-12770490 TCTCCCCCAAGGAGCTGGCTGGG - Intergenic
973058148 4:45686379-45686401 TTTCCCACACAAAACTTGTTTGG - Intergenic
974040942 4:56856974-56856996 GCTCCCACAGACAGCTGGTTTGG + Intergenic
977198718 4:94089813-94089835 TCGCCCACACAAAGCCTGTTTGG - Intergenic
977868890 4:102065280-102065302 TCTCCCAGATAGATCTTGTTGGG - Intronic
983290513 4:165798501-165798523 TCTACCAAACAGTGCTTGTTTGG + Intergenic
983529246 4:168792687-168792709 CCTCCCACACAGATGTGTTTTGG - Intronic
985727805 5:1524901-1524923 TCACCCAGACAGAGCCGGTTTGG + Intergenic
985770888 5:1810036-1810058 TCTCCCTCACAGATATGTTTCGG - Intronic
987238473 5:15968377-15968399 ACTCTCAAACAGATCTGGTTTGG + Intergenic
988092214 5:26558450-26558472 CCTCCCACAGAGAGCAGATTAGG + Intergenic
990269171 5:54116189-54116211 TCTCCCAAACATATTTGGTTGGG + Intronic
992445910 5:76833298-76833320 TCTCCCACCAAGAGCTGCTCAGG - Exonic
995016418 5:107314515-107314537 TTTTCCTAACAGAGCTGGTTTGG - Intergenic
995109798 5:108416565-108416587 TCCCCCACACACAGATGCTTCGG + Intergenic
999111689 5:149126973-149126995 TCTCCCACAGATGCCTGGTTTGG - Intergenic
1000114010 5:158135987-158136009 TCATCCACACAGAGCTGCCTTGG - Intergenic
1000412684 5:160950042-160950064 TATACCATACAGAGCTGGCTTGG + Intergenic
1001494193 5:172176456-172176478 CCTCCCACACCCACCTGGTTCGG + Intronic
1002129292 5:177070161-177070183 GCTCCCACACACTGCTGGTGAGG - Intronic
1005661517 6:28003399-28003421 GCTCCCACATACAGCTGGCTGGG - Intergenic
1007095877 6:39212676-39212698 TTTCCCACACAAAGGTGGTGGGG - Intronic
1007462212 6:42026920-42026942 TCTCCCATACAGATCCGGGTGGG - Intronic
1010872857 6:81063471-81063493 TCTCCCCAACGGAGCTGGTCTGG + Intergenic
1014672474 6:124322880-124322902 TCTCTCATTCAGAGCTGGTGAGG - Intronic
1015161706 6:130159447-130159469 TCTGCCACACAGAGGCGGGTGGG + Intronic
1018277223 6:162145996-162146018 TCTGCCACACAGAAAAGGTTGGG + Intronic
1018946272 6:168348432-168348454 ACTCCCACACAGAGCAGGGTCGG + Intergenic
1019389227 7:776463-776485 ACCCCCACCCAGTGCTGGTTTGG - Intronic
1020560841 7:9727583-9727605 TCTCCCACCCACTGCAGGTTGGG + Intergenic
1023247061 7:38216446-38216468 ACACACACACAGAGCTGCTTGGG - Intronic
1025713118 7:63930128-63930150 GCTCCCACACAGTGCTGATGGGG + Intergenic
1026033575 7:66815700-66815722 TCTCTAACACAGAGCTGGCAGGG + Intergenic
1026986037 7:74555652-74555674 TCTCTAACACAGAGCTGGCAGGG - Intronic
1028712991 7:93932153-93932175 TCTACTTCACAGAGCTGGTTTGG + Intergenic
1031071086 7:117162657-117162679 TCTCTTACACACAGCTGGTTTGG - Intronic
1031206677 7:118767651-118767673 TCTTCCACACTGACATGGTTTGG - Intergenic
1035061187 7:156070800-156070822 ACTCTCACACAGAGCAGCTTGGG - Intergenic
1035120047 7:156559485-156559507 TCTCCTAGACAGTGCTGGATTGG - Intergenic
1035709962 8:1705534-1705556 TGTCCAAAACAGCGCTGGTTCGG + Exonic
1038536809 8:28359578-28359600 TCTCCCACACAAACCTCTTTGGG + Exonic
1045610938 8:103840502-103840524 TCTCCCACAGAGAGATTGTTGGG + Intronic
1048918080 8:139203299-139203321 TCTCCCTGACTGAGCTGGTCTGG - Intergenic
1049848846 8:144820097-144820119 CCTCCCACACACAGCTGCTGTGG + Intergenic
1050527680 9:6560226-6560248 TATCCCACAGAGAGATGGATGGG + Intronic
1050530756 9:6586959-6586981 TCTCCCTCACATAGCTGGTGAGG - Intronic
1051897643 9:22005602-22005624 TCTCCCACTCAGCGCTGGAGTGG + Exonic
1052332253 9:27281860-27281882 TCTCACAGCCAGTGCTGGTTGGG - Intergenic
1052790739 9:32873394-32873416 TCTTCCACTCAGATGTGGTTCGG - Intergenic
1056383792 9:86078998-86079020 TCTCCCACCCAAAGCTGCTTGGG + Intronic
1057215775 9:93227905-93227927 TCTAAAACACTGAGCTGGTTAGG + Intronic
1058331361 9:103764971-103764993 TCTACCTCACAGTGCTGATTTGG - Intergenic
1058606205 9:106726240-106726262 TCTAGCACACAGCTCTGGTTTGG + Intergenic
1061102586 9:128503569-128503591 CCTGCCAAACAGGGCTGGTTGGG + Intergenic
1062028433 9:134351162-134351184 TCTCCCACACAGGCCAGGCTTGG + Intronic
1062339165 9:136086298-136086320 CCTCCCACTCAGAGCTGGGAGGG + Intronic
1186323565 X:8455133-8455155 CCTCCCACCCAGTGCAGGTTTGG + Intergenic
1186536253 X:10351912-10351934 GCTCCCACACATTGCTGGTGGGG - Intergenic
1192815458 X:74586053-74586075 TCTCCCAGGAAGAGCTGCTTTGG - Exonic
1195499190 X:105574416-105574438 TGTCCCATACAGAGCTTGCTTGG - Intronic
1198711058 X:139504808-139504830 TCTCTGCCTCAGAGCTGGTTGGG + Intergenic
1199716205 X:150508813-150508835 GCTCCCAGACAGAGCTGCCTTGG + Intronic
1200069791 X:153522536-153522558 ACTGTCACACAGAGCTGCTTTGG + Intronic