ID: 902611402

View in Genome Browser
Species Human (GRCh38)
Location 1:17599644-17599666
Sequence GCTTCTCTGGACCAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 7, 3: 22, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902611402_902611406 -8 Left 902611402 1:17599644-17599666 CCACCTTCCTGGTCCAGAGAAGC 0: 1
1: 0
2: 7
3: 22
4: 300
Right 902611406 1:17599659-17599681 AGAGAAGCCCTGTCCTCTCTTGG 0: 1
1: 0
2: 1
3: 23
4: 294
902611402_902611412 15 Left 902611402 1:17599644-17599666 CCACCTTCCTGGTCCAGAGAAGC 0: 1
1: 0
2: 7
3: 22
4: 300
Right 902611412 1:17599682-17599704 CCTTTACTTCCTGTCATTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 159
902611402_902611410 12 Left 902611402 1:17599644-17599666 CCACCTTCCTGGTCCAGAGAAGC 0: 1
1: 0
2: 7
3: 22
4: 300
Right 902611410 1:17599679-17599701 TGGCCTTTACTTCCTGTCATTGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902611402 Original CRISPR GCTTCTCTGGACCAGGAAGG TGG (reversed) Intronic
900771075 1:4545418-4545440 GCTGCTCAGGATCTGGAAGGGGG - Intergenic
901668091 1:10837868-10837890 TCTTCCCTAGACCAGGACGGGGG + Intergenic
901960933 1:12826095-12826117 GCTTCTGTGGCCCAGGGATGTGG - Intronic
901982930 1:13050962-13050984 GCTTCTGTGGCCCAGGGATGTGG - Intronic
901986091 1:13076376-13076398 GCTTCTGTGGCCCAGGGATGTGG + Intronic
901995718 1:13150391-13150413 GCTTCTGTGGCCCAGGGATGTGG - Intergenic
901999159 1:13177956-13177978 GCTTCTGTGGCCCAGGGATGTGG + Intergenic
902218978 1:14952736-14952758 GCTTCCCCAGCCCAGGAAGGTGG - Intronic
902611402 1:17599644-17599666 GCTTCTCTGGACCAGGAAGGTGG - Intronic
902837963 1:19058815-19058837 GCTTCTCTGTGCCAGGCACGGGG - Intergenic
903672529 1:25045187-25045209 GCTTTTCTGTCCCAGAAAGGTGG - Intergenic
903818705 1:26084382-26084404 GCCTCCCTGGTCTAGGAAGGTGG + Intergenic
904456106 1:30649216-30649238 ACTTCCCTGTACCAGGAATGGGG - Intergenic
904891448 1:33782591-33782613 GCATCTGTGCACTAGGAAGGTGG + Intronic
905171934 1:36114777-36114799 GCTTGGCTGGACAAGGGAGGTGG - Intronic
905662624 1:39739003-39739025 GCATCTCTGAACCAGGAGGACGG + Intronic
905775963 1:40667317-40667339 GTTACTCTGGAGCAGCAAGGGGG + Intergenic
906528163 1:46508490-46508512 GGTTCTCTGGACCAGTGTGGAGG + Intronic
906609724 1:47192895-47192917 GCTGGGCTGGAACAGGAAGGAGG - Intergenic
913100889 1:115564357-115564379 GCACCTCTCGCCCAGGAAGGGGG - Intergenic
913986432 1:143569994-143570016 GCCTCTCTGGACCAGGCCTGGGG + Intergenic
916231588 1:162545971-162545993 GTTTCTCTGGATCAGGAAGCTGG - Intergenic
917007090 1:170426973-170426995 GGTGCTCTGTCCCAGGAAGGTGG - Intergenic
918712137 1:187744715-187744737 GTTTCTGTGGACCAGGAATCAGG + Intergenic
920866893 1:209760425-209760447 CCCTCTCTGGACAAGGAGGGTGG + Intronic
920979552 1:210820520-210820542 GCTTCTCAGGAGCATGAAGCAGG + Intronic
921146588 1:212363896-212363918 GCTTCTGTGGAGCAGAAAAGTGG + Intergenic
921693180 1:218176733-218176755 GCTTCTCTGGGTCAGGAACTGGG - Intergenic
921989621 1:221350533-221350555 TCTTCTATGAACCAGGAAAGGGG - Intergenic
922171567 1:223159869-223159891 GAACCTCTGGAGCAGGAAGGAGG + Intergenic
922218195 1:223538099-223538121 CCCTCTATGAACCAGGAAGGGGG - Intronic
923919138 1:238544655-238544677 GCTACTCTGGGCAAGGAAGAAGG - Intergenic
1063451193 10:6151426-6151448 GCTTCTCTGGCCGAGGACTGGGG - Intronic
1066236457 10:33489750-33489772 GCTTCTCTGGTCCAGAAAGCAGG - Intergenic
1066521793 10:36228402-36228424 CCTTCTCTGGATCAGCAAAGAGG + Intergenic
1068023700 10:51616848-51616870 GCTCCTCAGGACCAAAAAGGTGG + Intronic
1068517073 10:58038180-58038202 ACTGCTCTGGACCAAGAAGCAGG - Intergenic
1070814271 10:79313153-79313175 GAGGCTCTGGACCAGGAAGCAGG - Exonic
1071177281 10:82941091-82941113 GCTTCTCTGCACTTGGATGGTGG + Intronic
1071844363 10:89506097-89506119 GGTTCTCTGTCCCAGGAAGATGG - Intronic
1072895509 10:99362922-99362944 CCTTCAGAGGACCAGGAAGGGGG + Intronic
1074867133 10:117551444-117551466 CCTTCTTTGGGCCGGGAAGGGGG - Intergenic
1074951108 10:118337510-118337532 GATTCTTTGGACCTGGAAGGAGG - Intronic
1075013175 10:118892062-118892084 TTTTCTATGGACCAGGATGGGGG + Intergenic
1075276848 10:121101600-121101622 TCTACTATGTACCAGGAAGGGGG + Intergenic
1075565825 10:123503519-123503541 GTTTCCCTGAATCAGGAAGGCGG - Intergenic
1076076384 10:127537178-127537200 CTGTCTCTGGAGCAGGAAGGAGG + Intergenic
1076649391 10:131977315-131977337 GGTGCTCTGCACCAGGAAGTAGG + Intronic
1076839078 10:133036754-133036776 GGTTCTCTTGGCCATGAAGGGGG - Intergenic
1076859494 10:133133919-133133941 GCTCCTCTGGGCCTGGAGGGAGG + Intergenic
1077235044 11:1477670-1477692 TCCACTGTGGACCAGGAAGGGGG - Intronic
1077496975 11:2891151-2891173 GCCTTTCTGGGCTAGGAAGGGGG + Intronic
1078282889 11:9920364-9920386 GCTTCTCTGTATCAGGAACTTGG - Intronic
1078756648 11:14217095-14217117 GTTTCTCTGAACCAGGAATAAGG - Intronic
1079353263 11:19711382-19711404 TCTTCTGTGGACCAGGAAGAGGG - Intronic
1079969156 11:27015419-27015441 GCATCTATGAACCAGGAAGCAGG - Intergenic
1080161374 11:29180632-29180654 GATTTTCTGGATTAGGAAGGAGG + Intergenic
1080414642 11:32057930-32057952 CCTGCTCTGCTCCAGGAAGGAGG + Intronic
1080517728 11:33039577-33039599 GCTTCTCAGCATCAGGAAGGAGG - Exonic
1081149998 11:39616242-39616264 GCATCTATGTGCCAGGAAGGTGG + Intergenic
1084446591 11:69207128-69207150 CCTTCTCTCAACCAGGAAGGTGG - Intergenic
1084759612 11:71261118-71261140 CCATCTCTGAACCAGGAAGTGGG + Intergenic
1085899964 11:80687162-80687184 CCCTCTCTGGTCCTGGAAGGTGG - Intergenic
1086721489 11:90127152-90127174 GGTTTTCAGGAGCAGGAAGGAGG - Intergenic
1087729379 11:101760890-101760912 CCGTCTATGGACCAGGAAGTGGG - Intronic
1087938183 11:104060360-104060382 GCTTCTCTGGACCAGGTAGCTGG + Intronic
1089533167 11:119145018-119145040 GCAGCCCAGGACCAGGAAGGAGG - Intergenic
1089631071 11:119784566-119784588 GCTTCGCAGGGCCAGAAAGGTGG - Intergenic
1089670514 11:120053849-120053871 GATTCTATGGGCAAGGAAGGAGG + Intergenic
1089677396 11:120099021-120099043 GCTTCTCTGCCCAGGGAAGGCGG - Intergenic
1090248712 11:125236346-125236368 GCTTTCCTGGAACAGGATGGAGG - Intronic
1092289331 12:7149772-7149794 ACATCCCTGGACCTGGAAGGAGG - Intronic
1092908617 12:13125085-13125107 GCTGCTCTGGACCAAGTAGCTGG - Intronic
1093104519 12:15069750-15069772 GTGTATCTGGACCAGGAAGTAGG - Intergenic
1096519812 12:52178548-52178570 GCTGCGCTGGAGCCGGAAGGAGG - Intronic
1097276672 12:57818327-57818349 ACCTCTCTGGGCCAGGAAGCTGG + Intronic
1099251241 12:80257603-80257625 GCTGCTGAAGACCAGGAAGGAGG + Intronic
1100244140 12:92739480-92739502 GTTTCTTAGGACAAGGAAGGTGG - Intronic
1101822594 12:108195582-108195604 GCTTCTTTGGGCCAACAAGGGGG - Exonic
1102351234 12:112193827-112193849 GATCCTCTGCACCAGGATGGTGG + Intronic
1103711681 12:122917547-122917569 GCTTCTCCAGAACAGGAAGATGG - Intergenic
1103972078 12:124678727-124678749 GCTGCCCTGGGCCAGGACGGTGG + Intergenic
1104197458 12:126554636-126554658 CCTTGTCTGGGCCAGGAAAGAGG + Intergenic
1105826195 13:24125680-24125702 GTTGCTCAGGAGCAGGAAGGAGG + Intronic
1106124600 13:26890009-26890031 GCTTTTGTGGATGAGGAAGGGGG + Intergenic
1106608102 13:31250735-31250757 GGTTCTCTGTCCCAGGGAGGTGG - Intronic
1108394261 13:49978062-49978084 GTTTCTCTGAAACAAGAAGGAGG - Intergenic
1109283134 13:60380062-60380084 TCTCCTCTGTACCAGGAAGTGGG - Intergenic
1110467800 13:75822605-75822627 GCTTCCCTGGAGCAAGAATGAGG + Intronic
1113501193 13:110775752-110775774 GCTTCCCTGAACCAGGAACCAGG + Intergenic
1113609473 13:111633079-111633101 GCTGCTCTGGCCCTGGAGGGCGG + Intronic
1113839579 13:113351130-113351152 GGCTCACTGGGCCAGGAAGGAGG + Intronic
1115801956 14:37004676-37004698 GCTCCTCTGGAACAGGGAGCAGG + Intronic
1116585363 14:46696815-46696837 CCATCTATGAACCAGGAAGGAGG - Intergenic
1119812031 14:77529864-77529886 GCTTTACTGGGCCAGGCAGGTGG - Intronic
1120540803 14:85748002-85748024 GCTTCTCTGAACCAGGAAGCAGG + Intergenic
1120647269 14:87088973-87088995 GGTTCTCTGGAGGAAGAAGGGGG - Intergenic
1122472355 14:101978624-101978646 GCTTCTTGGGAACAGGAAGCAGG - Intronic
1124696157 15:31866333-31866355 GCATTTCTGGACCAGGAAGTGGG - Intronic
1125143161 15:36433773-36433795 GATTTTCTGCATCAGGAAGGAGG + Intergenic
1125460185 15:39898990-39899012 GCTCCTCTAGAACAGGAAGGAGG - Intronic
1125484215 15:40101129-40101151 ATTCCTCTGGACCAGGCAGGTGG + Intronic
1127286452 15:57537954-57537976 TCTTCTCTGGTCCAGGAGGCTGG + Intronic
1127643424 15:60936488-60936510 GCTACTGTGGACAAAGAAGGTGG - Intronic
1130091665 15:80826318-80826340 GTTACTATGCACCAGGAAGGCGG - Intronic
1133252382 16:4491793-4491815 GCTTCTCAGAACCTGGGAGGTGG - Intronic
1133360906 16:5173188-5173210 GGGTCTCTGCACCAGGCAGGAGG + Intergenic
1133538447 16:6724512-6724534 TCTTCTGTGGACGAGGAAGCAGG + Intronic
1135137566 16:19896212-19896234 GCATCTGTGAACCAGCAAGGAGG + Intergenic
1135915470 16:26601844-26601866 GATTCTCTGGACCTGGGAGAGGG - Intergenic
1137814313 16:51383806-51383828 GATCCTCTGGACCAGGAGGTTGG - Intergenic
1138615477 16:58162054-58162076 GCCTGTCTGGACCAGGCAAGAGG - Intronic
1139336451 16:66235071-66235093 CCATCTATGAACCAGGAAGGGGG + Intergenic
1139750876 16:69108101-69108123 GGTTCTCTAGATCAGGCAGGTGG + Intronic
1140023841 16:71265453-71265475 CCCACTCTGGACCAGGATGGGGG - Intergenic
1140397892 16:74644677-74644699 GCTTCTATGGATGAGGAAGAAGG - Exonic
1140419635 16:74807700-74807722 TGTTCTATGGATCAGGAAGGAGG - Intergenic
1140981262 16:80112000-80112022 GCTTCTCTTGACCCGCAGGGAGG + Intergenic
1141161635 16:81632979-81633001 GTTTCTTTGGGCAAGGAAGGGGG + Intronic
1141611443 16:85183389-85183411 GCTGGGCTGCACCAGGAAGGAGG + Intronic
1141843455 16:86590232-86590254 GCTGCTGTGGACCATGGAGGTGG + Intergenic
1142525163 17:535059-535081 GCTTCTCTGGGCCATCAGGGCGG + Intronic
1142717091 17:1753070-1753092 GCTTCCCTGGAAGGGGAAGGAGG + Intronic
1142899985 17:3005753-3005775 GCTTCCCAGGACCAGGGAAGCGG + Intronic
1143137086 17:4718006-4718028 GCTTCCCTGGACAAGGAGGTGGG + Exonic
1144042866 17:11428648-11428670 GCTTCTCTGGGTCAGGAATCTGG + Intronic
1145242674 17:21248911-21248933 GGTTCTCAGGCCCAGGAGGGAGG - Intronic
1145272627 17:21412878-21412900 ACTTCTCTGAACCTGGATGGTGG + Intronic
1145310836 17:21700341-21700363 ACTTCTCTGAACCTGGATGGTGG + Intronic
1146263719 17:31437786-31437808 GCTTCTCGGGGCCTGGGAGGGGG - Intronic
1146527825 17:33581837-33581859 GCTACTCTGGAGCGGGGAGGTGG + Intronic
1146574896 17:33982311-33982333 CCTTCTCTTGCCCAGGAAGCAGG - Intronic
1148346428 17:46906374-46906396 GCATGTCTACACCAGGAAGGTGG + Intergenic
1149497047 17:57125588-57125610 GATGCTCTGGGCAAGGAAGGCGG + Intergenic
1150825624 17:68472199-68472221 TCTTCTGTGGCCCAGGCAGGTGG + Intergenic
1152240210 17:79157041-79157063 GCTGCTGTGGGCCAGGGAGGCGG + Intronic
1152381242 17:79943320-79943342 GCTTCTCTGGGAGAGGAATGTGG + Intronic
1152711431 17:81872047-81872069 GCTCCTCAGGACCAGGAGGCAGG + Intergenic
1154035541 18:10798205-10798227 CTTTCTCTGGACCAGGAACCTGG - Intronic
1154338414 18:13483850-13483872 CCTTCATAGGACCAGGAAGGAGG - Intronic
1157967095 18:52220620-52220642 GCTTCTGTGGGTCAGGAAGTTGG - Intergenic
1159511600 18:69402192-69402214 GCTTTTCTGGACCAGCCAGCCGG - Intronic
1161654325 19:5504503-5504525 GGTTCTCTGGACAAAGGAGGAGG - Intergenic
1163718125 19:18884206-18884228 GCTTCCCTGGAGCAGGTAGGCGG + Exonic
1163827002 19:19529426-19529448 CCTCCTCTGGACAAGGGAGGTGG - Exonic
1165406810 19:35636071-35636093 TCTTCTCTGGGCCAGGTAGACGG - Intronic
1165407795 19:35641732-35641754 GCTTATCTGCAACAGGAAGAGGG - Exonic
1166120429 19:40683124-40683146 GCATGTCTAGACCAGGAATGGGG - Intronic
1167693492 19:51001284-51001306 GCTTCTCTGGAGGAAGGAGGAGG + Intronic
1168207430 19:54861535-54861557 GCTACTCTGGAGGAGGAAGCAGG + Intronic
925386263 2:3463879-3463901 GCTTCTCTGGGGAAGGAAGTAGG - Intronic
925873538 2:8292453-8292475 GCTTCTCAAGCCCAGGCAGGAGG + Intergenic
926953657 2:18271461-18271483 GCTTTTATGGACCACGGAGGTGG + Intronic
928842517 2:35627307-35627329 CCTTCTATGAACCAGGAAGTAGG + Intergenic
929552086 2:42900801-42900823 TCTTATATTGACCAGGAAGGTGG - Intergenic
929985839 2:46731323-46731345 CCATCTCTGAACCAGGAAGCAGG + Intronic
935524435 2:104148055-104148077 GCATCTATGAACCAGGAAGTAGG + Intergenic
936659478 2:114526652-114526674 ACTTCTATGAACCAGGAAGCAGG - Intronic
938605814 2:132891461-132891483 GCTTCTCTGGAACTGGGGGGTGG + Intronic
939816012 2:146898242-146898264 GCTCCTATGAACCAGGAAGTGGG - Intergenic
940666150 2:156612271-156612293 GCTACTGTGGACCAGGCATGTGG + Intronic
941714510 2:168749561-168749583 CCTTTTCTGGAGCAGGAAGCTGG + Intronic
942106652 2:172640367-172640389 GCTTTTCAGGACCAGGAAGGAGG - Intergenic
942299105 2:174545212-174545234 GACGCTGTGGACCAGGAAGGTGG - Intergenic
942785828 2:179700924-179700946 GAATCTCTTGACCGGGAAGGCGG + Intronic
943479308 2:188397643-188397665 GTTCCTGTGGACCAGGAATGTGG + Intronic
944607967 2:201370139-201370161 GGTGCTCTGTCCCAGGAAGGTGG - Intergenic
944995832 2:205292324-205292346 GCATCCATGGACCAGGAAGCAGG + Intronic
945527764 2:210909895-210909917 GCTTCTATGCACCAGGAAATGGG + Intergenic
947714612 2:232333352-232333374 GCTACTCTCGCCCAGGAAGAAGG - Intronic
947733741 2:232444473-232444495 GCTACTCTGGCCCAGGAAGGAGG - Intergenic
948034100 2:234843803-234843825 GCTTCTCCGGGCCAGCATGGAGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG + Intergenic
948591667 2:239054381-239054403 GCTTCTCTGGTCCAGGGAAGAGG + Intronic
948832458 2:240604842-240604864 CTGTCTCTGGACCAGGAAGCAGG - Intronic
1170270763 20:14524796-14524818 GCTGCTCAAGACCAGGAAGGAGG - Intronic
1171442881 20:25179830-25179852 GCATCTCTGCTCCAGGAGGGTGG - Intergenic
1171986426 20:31664592-31664614 GCTTCCCTGGACCAGGGCAGGGG + Exonic
1172526367 20:35602359-35602381 GCTTCTCTGGCTCAGCAGGGAGG + Intergenic
1174016088 20:47489488-47489510 GCTCCTCTGGAAGAGGAAGTGGG + Intergenic
1174365622 20:50054552-50054574 GCTTTTCTGTGCCAGGAACGAGG - Intergenic
1174971518 20:55281211-55281233 GCTTCTCTGGGGCAGGAGGCTGG - Intergenic
1175282255 20:57811774-57811796 GCTTATGAGGAACAGGAAGGAGG + Intergenic
1176256080 20:64153995-64154017 GCTGCTCTGGCCTGGGAAGGTGG + Intronic
1177169973 21:17644396-17644418 GCATCTATGAACCAGGAAGTGGG - Intergenic
1178185155 21:30209902-30209924 CCTTCTCAGGACAAGGAAGGAGG + Intergenic
1178804065 21:35823898-35823920 CCTTCTCGGGACAAGGTAGGCGG + Intronic
1180715087 22:17866147-17866169 GCTTCTCTGGACAAGAAAGCTGG - Intronic
1181587589 22:23862036-23862058 GCAGCTCTGGTCCAGGGAGGGGG + Intronic
1181907025 22:26206301-26206323 ACTTCTCTGGAGCAGGAATTGGG - Intronic
1181908642 22:26220160-26220182 GCATCTGTGGCCCAGAAAGGTGG - Intronic
1182368374 22:29793663-29793685 CCTTCTCAGCACCAGGAAGGAGG - Exonic
1183308608 22:37097464-37097486 GCTTCTTTGGCCCTGGCAGGGGG - Intronic
1183324226 22:37182820-37182842 TCTTCTCTGGGCCAGGACAGGGG - Intronic
1183552155 22:38495530-38495552 GCTTCTCTGGGCCAGTGCGGTGG - Intronic
1184232119 22:43163768-43163790 GCCGCTCTGGGCCAGCAAGGAGG - Intergenic
1184659158 22:45957946-45957968 GCCTCTCTGGACCCTGAATGCGG + Intronic
1184754909 22:46510306-46510328 GCCTCTGTGGCTCAGGAAGGGGG - Intronic
1185176515 22:49330396-49330418 ACTTCTCTAAACCAGGAAGCAGG + Intergenic
950186587 3:10949226-10949248 GCTGCCCTGGCCCAGGAAGTGGG - Intergenic
952292065 3:32026853-32026875 GCATCTTTGGCCCAGGATGGAGG - Intronic
953451263 3:43008379-43008401 GCTTCAGAGGACTAGGAAGGAGG - Intronic
953568106 3:44050607-44050629 GCTTCTCTGTAAAATGAAGGTGG - Intergenic
954302290 3:49706402-49706424 GCTGCCCTAGCCCAGGAAGGTGG + Intronic
954672577 3:52298762-52298784 GCTTCTCTGCCCCAGGCAGTGGG - Intergenic
955206766 3:56903006-56903028 GCTTCCCTGGATGAGGAAGGAGG - Intronic
955414625 3:58680591-58680613 CCTTCTCTGGGCCAGAAAGCAGG + Intergenic
955796089 3:62638795-62638817 TCTTCTCTGGACCAGTTAGTTGG + Intronic
958454636 3:94315415-94315437 GATTCTCTGGATCAGGAATTTGG + Intergenic
958552754 3:95637658-95637680 GCTTTTCTGGACAAGGGAGTAGG - Intergenic
960226270 3:115172831-115172853 GTTTCTGTGGATCAGGAATGTGG - Intergenic
960803974 3:121564980-121565002 ACTTCTCTGGACCAGGGAGGGGG - Intergenic
962666083 3:137654720-137654742 GGTTCTCTGTCCCAGGTAGGTGG - Intergenic
963430410 3:145194528-145194550 GATTGTTTGGACCCGGAAGGTGG + Intergenic
964660953 3:159119838-159119860 ACTTCTCTGGTCAATGAAGGTGG - Intronic
965497303 3:169413910-169413932 GGTTCTCTGTTCCAGGAAGATGG - Intronic
966098190 3:176231513-176231535 CCTTCTCTAGATCAGGAAGAAGG + Intergenic
967191321 3:186987336-186987358 CCTTCACTGGATAAGGAAGGTGG - Intronic
967754839 3:193157170-193157192 TGTTCTCTGGAACAGGAACGAGG + Intergenic
968648549 4:1751479-1751501 GCTCTTCTGGGCCAGGGAGGTGG + Intergenic
969695899 4:8734700-8734722 TCTTCACTGCTCCAGGAAGGTGG + Intergenic
973314394 4:48744925-48744947 GCTTCTGTGTACAAAGAAGGCGG + Intronic
973993736 4:56436215-56436237 GCTTCGCTGGGCGGGGAAGGAGG - Exonic
974383696 4:61176932-61176954 TCTTCTATGAACCAGGAAGCAGG + Intergenic
976715979 4:88122686-88122708 GCTGCTCTGTCCCAGGGAGGTGG - Intronic
978365777 4:107979769-107979791 TCATCTGTGAACCAGGAAGGAGG + Intergenic
980802909 4:137776015-137776037 TGTTCCCTGGAGCAGGAAGGTGG + Intergenic
981245457 4:142532001-142532023 GATTATCTGAACCAGGATGGTGG - Intronic
982305163 4:153923094-153923116 TCATCACTGGATCAGGAAGGTGG - Intergenic
982780200 4:159482618-159482640 CCATCTATGAACCAGGAAGGGGG - Intergenic
982954119 4:161740914-161740936 GCATCTATGAACCAGGAAGTGGG - Intronic
983432951 4:167674432-167674454 CCTTCTATGAACCAGGAAGCAGG - Intergenic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
984561456 4:181275930-181275952 GCATCTATGAACCAGGAAGCAGG - Intergenic
984895654 4:184537386-184537408 GCTTCTCTGAACCGGGAGAGAGG - Intergenic
985606634 5:861538-861560 GCTTGTCTGAGCCAGGAAGCAGG - Intronic
987024245 5:13908090-13908112 GCTTTGCTGGATCAGGCAGGAGG - Intronic
987398202 5:17445776-17445798 ATTTCTCTGGACCAGGAAGATGG - Intergenic
987970995 5:24944710-24944732 GTATCTCTGAACCTGGAAGGTGG - Intergenic
988445799 5:31284541-31284563 GCTTCTCCAGAACAAGAAGGGGG + Intronic
988533763 5:32048427-32048449 GCTTCTCAAAACCATGAAGGTGG + Intronic
990610418 5:57451312-57451334 GCTTATTTTGACCAGGAATGAGG - Intergenic
990840931 5:60078101-60078123 GAATATCTGGATCAGGAAGGAGG - Intronic
992154652 5:73943090-73943112 CCTTCTATGAACCAGGAAGTTGG + Intergenic
992869500 5:80992088-80992110 CCTTCTCTGGTCCAGGATAGGGG - Intronic
992980163 5:82161412-82161434 TATTCTCTGGAACAGGTAGGAGG - Intronic
993047810 5:82888416-82888438 GATTGCTTGGACCAGGAAGGTGG - Intergenic
996823940 5:127660293-127660315 CTTGCTCTGGACAAGGAAGGAGG - Intergenic
997840383 5:137234228-137234250 GATTCTCAGGACCAGCAGGGAGG + Intronic
998825134 5:146093766-146093788 GGTTTTCTGGAAAAGGAAGGAGG - Intronic
999371260 5:151056684-151056706 GATTCCCAGGAGCAGGAAGGTGG + Intronic
1001346647 5:170907009-170907031 GCATTTCTGAACCAGGAAGTAGG + Intronic
1004304298 6:14486794-14486816 GCTTCTCTGGACAGGGATAGAGG - Intergenic
1004982880 6:21046154-21046176 GCCTCTCTGAACCAAGAATGTGG - Intronic
1005451266 6:25975117-25975139 GTTTCACTTGACCCGGAAGGCGG - Intronic
1006516498 6:34548505-34548527 GATTATCTGGGCCAGGTAGGAGG - Intronic
1007593765 6:43038982-43039004 TCTGACCTGGACCAGGAAGGGGG + Exonic
1007628661 6:43260424-43260446 CCTTCTCTGCACCAGAAAAGGGG + Intronic
1008883730 6:56409751-56409773 GCTTCTCTGGATCAGGAAGCAGG - Intergenic
1010743768 6:79537514-79537536 GCTTCAGTGGAACTGGAAGGCGG + Intergenic
1011547130 6:88493718-88493740 GTTCCTCAGGGCCAGGAAGGAGG + Intergenic
1013594119 6:111645610-111645632 CCATCTCTGAACCAGGAAGCAGG + Intergenic
1015719714 6:136228476-136228498 CCTTCTATGAACCAGGAAGCAGG + Intergenic
1015862984 6:137699902-137699924 GCCTCTCTGGATCACCAAGGTGG - Intergenic
1016888661 6:148983815-148983837 CCTTTTCTGGACAAGGAATGAGG - Intronic
1017816121 6:158017854-158017876 GCTTCTCTGGCACAGGGTGGGGG - Intronic
1019165044 6:170093234-170093256 TCTTTCCTGGACCAGCAAGGTGG + Intergenic
1021009854 7:15448362-15448384 TCATCTATGGACCAGGAAGTGGG + Intronic
1022485081 7:30771663-30771685 GCATCTCTGGAGCAGGCAGTAGG - Intronic
1022707614 7:32819236-32819258 GCAGCTCTGGAAGAGGAAGGTGG + Intergenic
1022915297 7:34943769-34943791 GCAACTCTGGAAGAGGAAGGTGG - Intronic
1023893177 7:44408803-44408825 GCTACGCTGTACCAGGAATGCGG - Intronic
1026553123 7:71384889-71384911 GCTAAGCTGGACCAGGAAGGTGG - Intronic
1027597479 7:80192780-80192802 GAATCGCTGAACCAGGAAGGCGG - Intronic
1029188432 7:98755482-98755504 ACTTCCCTGGACCAGGAGGGTGG - Intergenic
1031562985 7:123260623-123260645 CCTTCTAAGGACAAGGAAGGAGG - Intergenic
1033679553 7:143580542-143580564 GCTGCTCTGTCCCAGGGAGGTGG + Intergenic
1033692283 7:143748901-143748923 GCTGCTCTGTCCCAGGGAGGTGG - Intergenic
1034936746 7:155204831-155204853 GCTGCTCTGGATGAGGGAGGGGG + Intergenic
1035595453 8:854022-854044 CTGTCTCTGGACCAGGAAAGAGG + Intergenic
1036016166 8:4787234-4787256 GCATCTCTGGGCGGGGAAGGAGG - Intronic
1036616025 8:10388333-10388355 CCCTCTCTGTACCAGGAAGACGG - Intronic
1037630269 8:20649441-20649463 GGTCCTCTGGACCAGGGCGGTGG + Intergenic
1037813176 8:22098493-22098515 GCTGCTCTGTACCAGGTAGGTGG - Exonic
1037813591 8:22100577-22100599 GCTGATCTGGAGCAGGAAGGGGG - Exonic
1038152945 8:24958557-24958579 GCTTCTCTGGAGGCGGAGGGTGG + Intergenic
1039600130 8:38829544-38829566 GGTACTGTGGAACAGGAAGGGGG - Intronic
1039800475 8:40950250-40950272 GCTTCCCTGGCCCAGGGAGATGG - Intergenic
1040066294 8:43147346-43147368 CCTTCTCTGGTCCAGCAAGAGGG - Intronic
1040892603 8:52333097-52333119 TCTCCTCTGGCCCAAGAAGGTGG - Intronic
1041516378 8:58703115-58703137 GCTTCTATGAATCAGGAAGCAGG + Intergenic
1042502956 8:69529533-69529555 GCTTCTGTGAATCAGGAATGTGG + Intronic
1043027101 8:75083852-75083874 TCTTCTTTGGAGCAGGTAGGTGG + Intergenic
1043617153 8:82140319-82140341 GCTTTCCTGGTCCAGGATGGTGG + Intergenic
1047778752 8:128094847-128094869 GAGGCTCTGGAGCAGGAAGGTGG - Intergenic
1049111106 8:140644022-140644044 TCATCTGTGGACCAGGAAGGAGG + Intergenic
1049479966 8:142817938-142817960 GATTCGGTGGACCAGGCAGGAGG + Intergenic
1049582822 8:143420553-143420575 TCTTCTCTGGAGCAGGGTGGGGG - Intronic
1050619124 9:7434176-7434198 GCTTCTCTGAACCAGGATCTTGG + Intergenic
1050759671 9:9052119-9052141 CCATCTGTGAACCAGGAAGGCGG - Intronic
1051893200 9:21964609-21964631 GCTTTTCTGGACCGGCACGGTGG + Intronic
1051895360 9:21981210-21981232 GCTTCTCTGGAGGAGGAAGGTGG + Intronic
1052774982 9:32724165-32724187 GATTCTGTGGATCAGGAATGCGG + Intergenic
1054876067 9:70097576-70097598 CCTTCTCTAGACCAGCAAAGAGG - Intronic
1055125672 9:72716378-72716400 GGTGCTCTGTCCCAGGAAGGTGG + Intronic
1055716824 9:79127142-79127164 GCTTCACTGGACTCGGAAGGAGG + Intergenic
1056128889 9:83564779-83564801 GCTTCTCTTGCCAAGGCAGGAGG + Intergenic
1056919251 9:90771813-90771835 GCGTCCCTGAGCCAGGAAGGTGG + Intergenic
1057410084 9:94810233-94810255 TCTTCTCTGGAAAAGTAAGGGGG + Intronic
1058769504 9:108216603-108216625 GCTTCCCTGAACAAGGAAGAAGG - Intergenic
1059389279 9:113988668-113988690 GGTTCTCTCAGCCAGGAAGGGGG - Intronic
1059394810 9:114027718-114027740 GCTCCCCTGGCCCAGGCAGGTGG - Intronic
1059497086 9:114718858-114718880 TCTTCCCTGGTCCAGAAAGGAGG - Intergenic
1060575634 9:124690417-124690439 GTTTCTCTGGAAAAGAAAGGAGG + Intronic
1061561324 9:131405783-131405805 GCTACTCTCCACCAGGAAGAGGG - Intronic
1061620785 9:131810019-131810041 GCTTCTCTGGCCCAGCCAGCTGG - Intergenic
1061942983 9:133892985-133893007 GCTCCTCACGACCAGGAAGATGG - Intronic
1185529129 X:803195-803217 GCTTTTCTCCAGCAGGAAGGGGG + Intergenic
1185885678 X:3780489-3780511 CCATCTATGAACCAGGAAGGAGG + Intergenic
1186057098 X:5661322-5661344 CCATCTATGTACCAGGAAGGGGG + Intergenic
1189935364 X:46062510-46062532 GCTTCTGGGGAGCAGGAATGGGG - Intergenic
1190365909 X:49695112-49695134 GCTACTCCGGACGAGGCAGGAGG - Intronic
1193277175 X:79602783-79602805 GCATGCCTTGACCAGGAAGGTGG - Intergenic
1195465667 X:105176471-105176493 GCTTCTCGGGGCCAGGACTGGGG - Intronic
1197115270 X:122824795-122824817 ACATCTGTGAACCAGGAAGGGGG - Intergenic
1198278147 X:135116953-135116975 CCTTCTCGGGACGGGGAAGGGGG - Intergenic
1198292815 X:135255563-135255585 CCTTCTCGGGACGGGGAAGGGGG + Intronic
1199204690 X:145135144-145135166 GCTTCTATGGGGTAGGAAGGAGG + Intergenic
1199316112 X:146379754-146379776 GCTTCTCTGACACTGGAAGGGGG + Intergenic