ID: 902611416

View in Genome Browser
Species Human (GRCh38)
Location 1:17599715-17599737
Sequence AAGGCAGCACATTTGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902611416_902611426 9 Left 902611416 1:17599715-17599737 CCCAGGACCAAATGTGCTGCCTT 0: 1
1: 0
2: 1
3: 12
4: 167
Right 902611426 1:17599747-17599769 GGGGTGACACTGTTGACTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 146
902611416_902611421 -10 Left 902611416 1:17599715-17599737 CCCAGGACCAAATGTGCTGCCTT 0: 1
1: 0
2: 1
3: 12
4: 167
Right 902611421 1:17599728-17599750 GTGCTGCCTTCCTTGCCCTGGGG 0: 1
1: 0
2: 4
3: 40
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902611416 Original CRISPR AAGGCAGCACATTTGGTCCT GGG (reversed) Intronic
900797183 1:4715204-4715226 AAGGCAGCAGAAGTGGTCTTGGG + Intronic
902437692 1:16409063-16409085 CAGGCAGGACCCTTGGTCCTTGG - Intronic
902611416 1:17599715-17599737 AAGGCAGCACATTTGGTCCTGGG - Intronic
908301377 1:62763860-62763882 AAGGCAGATCATTTGAGCCTAGG - Intergenic
910259887 1:85284427-85284449 AAGGCAGGTCATCTGGTCATCGG - Intergenic
911074913 1:93863862-93863884 AAGGCACCACACTAGGTGCTAGG - Intergenic
912061204 1:105673096-105673118 AAGGTACCATATTTGGCCCTTGG + Intergenic
912557841 1:110529081-110529103 AAGGCAACATATTAGGTACTGGG - Intergenic
915644615 1:157260143-157260165 AATGCAGCACGTTTGGACATTGG - Intergenic
916336976 1:163683826-163683848 AAGGCAGCATATTTAATCATTGG + Intergenic
917117034 1:171613310-171613332 AAGGCAACACATGTTTTCCTTGG - Intergenic
917188147 1:172384977-172384999 AAGGCAGCAAATTTGGCTTTAGG - Intronic
918382123 1:183966796-183966818 AAGAGAGCACATATGGTCATAGG - Intronic
923870023 1:237981833-237981855 AGGGAAGCACAATTGGTTCTTGG + Intergenic
924328267 1:242917514-242917536 AAGGCAGAACATTAGCTCCAAGG + Intergenic
924759969 1:246974789-246974811 AAAGCAGCACATCTAGTCCCAGG + Intronic
1063399817 10:5732279-5732301 AAGGCAGCACATTATGGCCAAGG + Intronic
1063997653 10:11635736-11635758 CAGGGAAGACATTTGGTCCTGGG + Intergenic
1067074607 10:43169078-43169100 AAGGCAGTGCATGTGGTCCCTGG + Intronic
1068734037 10:60392042-60392064 AAGGCAGCCCTGTGGGTCCTAGG + Intronic
1068859684 10:61834859-61834881 AAGCCAGCACATTAGGTTGTGGG + Intergenic
1071962486 10:90820693-90820715 AAGGCAACACAGATGTTCCTTGG + Intronic
1073227710 10:101937573-101937595 AAGGCCCCATATTTGTTCCTTGG - Intronic
1074127828 10:110543969-110543991 AAAGTAGGAAATTTGGTCCTTGG + Intergenic
1074142148 10:110682536-110682558 AAAGGTTCACATTTGGTCCTTGG + Intronic
1074278240 10:112025227-112025249 TAGGCAGCTGATTTGGTACTGGG + Intergenic
1074293804 10:112163063-112163085 AAGGCAGCACAGTGGTTCTTTGG - Intronic
1076137909 10:128057438-128057460 AAGGCAGCCCATGTGGGCCCCGG + Intronic
1082029126 11:47592215-47592237 AAGTCAGCAGCTTTGTTCCTTGG + Intronic
1082119981 11:48369774-48369796 GAGACAGCTCCTTTGGTCCTGGG + Intergenic
1082254306 11:50015432-50015454 GAGACAGCTCCTTTGGTCCTGGG - Intergenic
1083754695 11:64785187-64785209 AAAGCAGCACAGTTGTTACTTGG + Intergenic
1086254863 11:84863630-84863652 ATGGAAGCCCATTTGGTGCTAGG - Intronic
1088991792 11:114960432-114960454 AAAGCAGCAGACTTGGTTCTAGG + Intergenic
1090448635 11:126786718-126786740 GTGGCAGCACATTTGCTACTGGG - Intronic
1091670455 12:2448516-2448538 AAGACAGCAGACTTGGTCTTGGG - Intronic
1094008501 12:25781844-25781866 AAGGCACCACAGTAGGTGCTAGG + Intergenic
1097979326 12:65720804-65720826 AAGGAGGCACATCTGGTCCCGGG + Intergenic
1100568344 12:95820686-95820708 AAGGCAACACATTAGTTCATTGG + Intronic
1103095083 12:118126232-118126254 CAGGCAGCACCTTTGATCCTAGG - Intronic
1104123107 12:125818064-125818086 AAGGAAGCACAGCTGATCCTTGG - Intergenic
1104748454 12:131224016-131224038 AAGGCAGCGCACTTGGTCTGTGG - Intergenic
1110689657 13:78417438-78417460 ACCGCAGCATATTTAGTCCTTGG - Intergenic
1111549416 13:89787002-89787024 AAGCCAGAACATTTGGTGTTTGG + Intergenic
1112433610 13:99374744-99374766 ATGGCAGCACATTGGGTATTGGG + Intronic
1114544346 14:23487466-23487488 AAGGCACCACAGATGGTTCTGGG - Intronic
1116508012 14:45709408-45709430 AAGTGAGCATATTTGCTCCTGGG - Intergenic
1118298426 14:64591816-64591838 TAGGCACCACATTAGGTGCTGGG + Intergenic
1119909031 14:78333136-78333158 AAGGCAGAACTCTTGCTCCTTGG + Intronic
1124985307 15:34603941-34603963 AAGTGAGAACATTTGGTGCTTGG + Intergenic
1125141425 15:36412384-36412406 AAGGTACCAGATTTGGTTCTTGG - Intergenic
1125194525 15:37030987-37031009 AAGTTACCACATTTGTTCCTGGG - Intronic
1125599097 15:40906072-40906094 AAGCCAGCCCATCTGGTCCTAGG + Intergenic
1128957359 15:71962437-71962459 AAGCCAGGAATTTTGGTCCTTGG + Intronic
1129970898 15:79777072-79777094 CAGCCAGCACATTTGGTTATTGG - Intergenic
1131765067 15:95667058-95667080 AAGTCTGCACATTTGGTAATAGG + Intergenic
1132302926 15:100787673-100787695 AAGGCAGCAGGTGTGGTGCTGGG - Intergenic
1132591993 16:730122-730144 AGGGCAGCACCTGTGGGCCTCGG + Exonic
1133758782 16:8781766-8781788 AGGGCATTACATTTGTTCCTGGG + Exonic
1136284476 16:29233064-29233086 CAGGAAGCACATCTGGTCCAAGG + Intergenic
1138353675 16:56360845-56360867 AGGGCAGCAAAAGTGGTCCTGGG + Intergenic
1140681875 16:77393209-77393231 AGGGCTGCACATTGGGTTCTAGG - Intronic
1141803544 16:86327247-86327269 GAGCCAGCACATTTAGCCCTTGG - Intergenic
1142089513 16:88202577-88202599 CAGGAAGCACATCTGGTCCAGGG + Intergenic
1144755594 17:17678856-17678878 AAGGAAGCACATTTGTTCAAGGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1144892404 17:18501444-18501466 AAAGCAGGACACTTGGTCTTGGG + Intergenic
1145139810 17:20442844-20442866 AAAGCAGGACACTTGGTCTTGGG - Intergenic
1145982962 17:29024949-29024971 AAGGAAGCATCTTTGGTGCTTGG - Intronic
1147388434 17:40095308-40095330 AAGGCAAGACATTTTCTCCTGGG + Intronic
1149719829 17:58831975-58831997 AAGGCAGCTCATTTCCTCTTTGG + Intronic
1152788354 17:82264013-82264035 TTGGCAGCACCTGTGGTCCTGGG - Intronic
1153405064 18:4728789-4728811 CAGGCAGCACATTTCATCCTTGG - Intergenic
1155424208 18:25689372-25689394 AAGGGAGAACATTTGGTATTTGG - Intergenic
1157334557 18:46728571-46728593 CAGTCAGCACATGGGGTCCTGGG - Intronic
1158551003 18:58436411-58436433 AAAGCAACAAATTTGTTCCTGGG + Intergenic
1158793809 18:60816485-60816507 AGTGAAGCACATCTGGTCCTGGG + Intergenic
1158851225 18:61497000-61497022 AAGGCATTTCATTTGGACCTGGG - Intronic
1160622782 18:80182200-80182222 AAGGCAGCCCAGTTGGTCACAGG - Intronic
1161191747 19:2961247-2961269 CAGGCAGCAAATCTGGGCCTGGG - Intergenic
1162874418 19:13610178-13610200 AGGACAGCACATTTGGTCATGGG - Intronic
1163408962 19:17141492-17141514 GAGGCAGCAGAGCTGGTCCTGGG - Intronic
1164089099 19:21932023-21932045 AGGGCAGCACATAAGGTTCTAGG + Intergenic
1164434096 19:28213693-28213715 ATGGCAGAAAATGTGGTCCTTGG - Intergenic
1166661187 19:44648203-44648225 AAGGCTGCAGCTTTGGTCTTGGG - Intronic
932619400 2:73256973-73256995 AAGGCAGCACCTCTGGTTCTGGG + Exonic
934896392 2:98123655-98123677 AGGGCAGCACGTGGGGTCCTGGG + Intronic
935246184 2:101220449-101220471 AAGGCAGCAGTTCTGGTCCATGG + Intronic
936340254 2:111625099-111625121 AAATCAGCACATTTGGTACATGG + Intergenic
936916201 2:117641268-117641290 AAGGCAGCCCTTGTGGTTCTTGG + Intergenic
937064519 2:119007088-119007110 AAGGAGGCACAATTTGTCCTGGG - Intergenic
939285885 2:140128669-140128691 AAGGGAGAACATGTGGTACTTGG + Intergenic
940171421 2:150833498-150833520 ATGGCTGCATATTTGGTACTAGG + Intergenic
940647113 2:156403246-156403268 AGGGCACCACATTTGTTCCTTGG - Intergenic
942073834 2:172338948-172338970 AAGGCCACACATTTGGTGCCTGG + Intergenic
945077912 2:206058938-206058960 GAGCCACCACATTTGGCCCTGGG - Intronic
946560005 2:220901930-220901952 AAGCCAGCCCATTCAGTCCTAGG + Intergenic
948271628 2:236678367-236678389 AAGGCAGCACATTTTTCCCCAGG + Intergenic
948555031 2:238803729-238803751 AAGGCAGCACACGTTGCCCTGGG + Intergenic
948721799 2:239905376-239905398 CAGGCACCACATGTGCTCCTGGG + Intronic
1168840316 20:905865-905887 AATACAGCTCATTTAGTCCTTGG + Intronic
1168850910 20:976390-976412 TAGCCAGCAGCTTTGGTCCTAGG + Intronic
1173420568 20:42897528-42897550 AAGGCATCAGATTTGGTTCTAGG - Intronic
1175959064 20:62625964-62625986 AAGGCAGCCCATTCTGTCCCCGG + Intergenic
1177609758 21:23431593-23431615 CAGGCAGCACCTTGGGTGCTTGG - Intergenic
1178155740 21:29851831-29851853 AAGACAGGACATTTCGTCCAAGG - Intronic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1182299864 22:29331350-29331372 AAGGCAGTCCATCTGGACCTTGG + Intronic
1182563211 22:31178111-31178133 AGGGCAACACATGTGGTGCTGGG - Intronic
1182660702 22:31923204-31923226 AAGGCAGCAGATTTTCTCTTGGG - Intergenic
951363488 3:21751837-21751859 GAGGCAGCAAATTTGGTCCTGGG - Intronic
951727689 3:25778295-25778317 AGTGAACCACATTTGGTCCTTGG + Intronic
952641402 3:35601036-35601058 AAGGCAGCAAGTGTGGTACTTGG + Intergenic
953338210 3:42111820-42111842 AAGGCATCAAATTTTGTCATAGG - Intronic
953474576 3:43194611-43194633 ATGGCAGAACACTTGCTCCTGGG - Intergenic
954707762 3:52490092-52490114 GAGGCACCTCATGTGGTCCTCGG + Exonic
955484133 3:59418458-59418480 AAGGCAGCACTTTTGTGCCAAGG - Intergenic
955790919 3:62588006-62588028 AGTGCAGCACACATGGTCCTCGG - Intronic
959834043 3:110897212-110897234 ATGTCAGCACATCTAGTCCTAGG - Intergenic
962481763 3:135804010-135804032 AAGACATCACTGTTGGTCCTAGG - Intergenic
964116990 3:153146891-153146913 AAGACAGCAGCTTTTGTCCTGGG - Intergenic
965549528 3:169950105-169950127 AAGGCAACATTTTTAGTCCTGGG + Intergenic
967879779 3:194293291-194293313 AACGCAGAGCATTTGGTCCCTGG + Intergenic
967889032 3:194351855-194351877 AAAGCAGCATCTTTCGTCCTCGG - Intergenic
970083265 4:12315143-12315165 AATGCAGCCCAGTAGGTCCTAGG - Intergenic
970435872 4:16034778-16034800 AAGACATCACATTTGCTCCCAGG - Intronic
971150268 4:24023970-24023992 AAAGCTGCAGATTTTGTCCTGGG + Intergenic
973941176 4:55911932-55911954 AAGGCAGCATATTAGGCACTGGG - Intergenic
974523942 4:63023750-63023772 AAGTGAGAACATTTGGTACTTGG - Intergenic
974558349 4:63482275-63482297 AAGGAAGCACATTTGGTATATGG - Intergenic
974833073 4:67212900-67212922 AAGCCAGAACATTTGCTCTTTGG + Intergenic
977112852 4:92981938-92981960 ATGTCAGCACAGTTTGTCCTGGG - Intronic
982655430 4:158142447-158142469 AAGTCAGCAAATTAGGTCATTGG + Intronic
982962293 4:161855568-161855590 TAGGTACCATATTTGGTCCTAGG + Intronic
988355654 5:30170553-30170575 ATTCCAGCACATTTGGTTCTTGG + Intergenic
991119268 5:62993073-62993095 AAGGGAGGATATTTGGTCATGGG - Intergenic
992182615 5:74212968-74212990 GAGGCAGGACCTTAGGTCCTGGG - Intergenic
994423146 5:99547714-99547736 ATGACAGAACATTTGGTCTTTGG - Intergenic
994718772 5:103355762-103355784 AAGGCAGCTCAGTTGCTTCTTGG + Intergenic
996983495 5:129530377-129530399 AAGGCAACAAATATGGACCTAGG + Intronic
997473037 5:134127294-134127316 AAGACAGCCCTTTTGGCCCTGGG - Intronic
1001580058 5:172792094-172792116 AAGGCCCCACAGTTGGTCCCTGG - Intergenic
1008698950 6:54075804-54075826 GAGGCAGCAACTTTGGTGCTGGG - Intronic
1008779391 6:55084462-55084484 AAGTCAGAACATTTGGTATTTGG - Intergenic
1012537267 6:100313766-100313788 AAGGCAGCACCTCTGCTCCCTGG - Intergenic
1015164464 6:130188035-130188057 AAGACAACACATTTGATACTTGG + Intronic
1016002106 6:139052104-139052126 ATGGCAGAACATTAGGACCTAGG - Intergenic
1016760122 6:147727471-147727493 AAGGCAATACAATTGCTCCTAGG - Intronic
1021345314 7:19520154-19520176 AAGGCAACACATTATGTGCTTGG - Intergenic
1021904085 7:25316078-25316100 CAGAAAGCTCATTTGGTCCTTGG - Intergenic
1023664831 7:42512325-42512347 AAGGCAACACATTTAGAACTGGG - Intergenic
1024060109 7:45691011-45691033 CAGACAGCAGATTTGGGCCTTGG + Intronic
1032851488 7:135799196-135799218 AAGGCAGTACAAGCGGTCCTGGG - Intergenic
1039768697 8:40660616-40660638 CAGGTAGCAGTTTTGGTCCTGGG + Intronic
1040694766 8:49982676-49982698 AAGGTAGCATCCTTGGTCCTTGG - Intronic
1047233644 8:123019393-123019415 AAGGCAGCCCATTTAGTCCCTGG + Intronic
1047983887 8:130212882-130212904 AAGCCAATACATTTGGTCCTTGG + Intronic
1048458448 8:134599729-134599751 AAGGAAGCACATCTGGCCCCAGG - Intronic
1051979115 9:22992004-22992026 TAGGAAGCACATTAGTTCCTTGG + Intergenic
1052683680 9:31727304-31727326 AAGGACTCAAATTTGGTCCTAGG + Intergenic
1055681614 9:78721499-78721521 AAGGTAGCACACTGGGACCTGGG - Intergenic
1057116765 9:92530921-92530943 AAGGGAGAACATGTGGTCTTTGG + Intronic
1057859581 9:98629385-98629407 AAGCAAGCACATTTGCTGCTGGG + Intronic
1060679036 9:125544915-125544937 AGGGAAGCAAATTAGGTCCTTGG - Intronic
1188025447 X:25203441-25203463 AAGGCAACAAATTTAGTGCTTGG + Intergenic
1188333502 X:28899383-28899405 AAGGCAGCTCATTTGAGCCCGGG - Intronic
1190138076 X:47815529-47815551 AAGGCAGCAAATGTTGTGCTGGG + Intergenic
1190723531 X:53171422-53171444 ATGGCATCCCGTTTGGTCCTGGG - Intergenic
1191966224 X:66761288-66761310 AAGGGAGCACATGTGGTGTTTGG + Intergenic
1192178163 X:68898822-68898844 AAGGCAGCACATCTGGGGGTGGG - Intergenic
1192561990 X:72133203-72133225 AAGGCAGCTCATTTCTTCCACGG - Intergenic
1193325232 X:80172533-80172555 AAGGCAGGACACTTGGTTGTGGG + Intergenic
1195516146 X:105778479-105778501 AAGGCAGCATATTTGGTTTATGG - Intergenic
1196237961 X:113305002-113305024 AAGGCAGCACAATTTGTGCCAGG - Intergenic
1198413710 X:136397634-136397656 TTGGAAGAACATTTGGTCCTTGG - Intronic
1198428853 X:136546124-136546146 AAGGCAGCAAATTCTGCCCTGGG + Intronic
1199089292 X:143672162-143672184 AAGGCTGCACATTTCGACCATGG - Intergenic
1199387869 X:147243965-147243987 AAGGAAGGACATTTGGGCTTGGG - Intergenic
1199696614 X:150346982-150347004 AAGGCAGCCTATTTGTTCCTTGG + Intergenic
1200047324 X:153409843-153409865 AAGGCAGCTCCTGTTGTCCTTGG - Intergenic
1201225652 Y:11816470-11816492 AAGGCAGAACATTAGCTCCAAGG + Intergenic