ID: 902612062

View in Genome Browser
Species Human (GRCh38)
Location 1:17603239-17603261
Sequence TAGCCAGATGGGCAGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902612057_902612062 -5 Left 902612057 1:17603221-17603243 CCGGGAGCAGCTGTCCATTAGCC 0: 1
1: 0
2: 1
3: 10
4: 126
Right 902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG 0: 1
1: 1
2: 0
3: 16
4: 233
902612056_902612062 5 Left 902612056 1:17603211-17603233 CCTGCAGGGGCCGGGAGCAGCTG 0: 1
1: 0
2: 5
3: 49
4: 468
Right 902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG 0: 1
1: 1
2: 0
3: 16
4: 233
902612055_902612062 6 Left 902612055 1:17603210-17603232 CCCTGCAGGGGCCGGGAGCAGCT 0: 1
1: 0
2: 3
3: 23
4: 243
Right 902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG 0: 1
1: 1
2: 0
3: 16
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902612062 Original CRISPR TAGCCAGATGGGCAGGCCTG CGG Intronic
900083430 1:875659-875681 GAGGCAGATGGGCATGCCTAGGG - Intergenic
900198161 1:1387925-1387947 CAGCCACCTGGGCAGCCCTGGGG + Intronic
900362046 1:2293826-2293848 GTGCCAGGTGAGCAGGCCTGTGG + Intronic
900509161 1:3050231-3050253 AAGAGAGATGGGCAGGACTGGGG + Intergenic
900657651 1:3767681-3767703 GAGCCCCATGGGCAGGGCTGCGG + Intronic
901528023 1:9836201-9836223 GAGGCAGATGGGCAGGCCGAGGG + Intergenic
902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG + Intronic
904362918 1:29990076-29990098 GAGGGAGATGGGGAGGCCTGCGG + Intergenic
904374456 1:30071339-30071361 TAGCCAGCAGGGAGGGCCTGGGG - Intergenic
904616901 1:31754866-31754888 TAGCCAGCAGAGCAGGGCTGGGG + Intronic
905054458 1:35080890-35080912 TAGCCTGATGGGAAGGCTGGAGG - Intronic
907297804 1:53466664-53466686 TGGCCAGGAGGGCGGGCCTGGGG - Exonic
910218672 1:84867182-84867204 TAGACAGATGGGCATCCGTGGGG - Intronic
911401344 1:97379119-97379141 TAGCCAGAGGCTCAGGACTGAGG + Intronic
913540562 1:119816259-119816281 CAGCCAGATGGGCAGCAGTGTGG + Intergenic
914434073 1:147644760-147644782 TACCTAGATGGGAAAGCCTGTGG + Exonic
915283065 1:154835982-154836004 TAGCCCCATGGCCAGGCATGGGG + Intronic
921411355 1:214839580-214839602 TCACCAGATGGCCAGCCCTGCGG + Intergenic
923517384 1:234709171-234709193 GAGCCAGTAGGGCAGGCATGTGG + Intergenic
924448872 1:244159795-244159817 TGGCCAGATGGACATACCTGTGG + Intergenic
1064281510 10:13955571-13955593 TAGCCATATGCAAAGGCCTGAGG - Intronic
1064320406 10:14299324-14299346 TGGCCACGTGGGCTGGCCTGGGG + Intronic
1065871324 10:29958832-29958854 AAGCAAGATGGGGAGGACTGGGG - Intergenic
1067061551 10:43080512-43080534 AAGCCAGAGGGCCAGGGCTGGGG - Intronic
1067087307 10:43249734-43249756 GAGCCAGCTGGGAAGGCCTGTGG + Intronic
1067187679 10:44044216-44044238 TGACCAGCTGGACAGGCCTGGGG + Intergenic
1068773417 10:60847120-60847142 TAGCCACATGGGCAGGGCCCTGG - Intergenic
1069852988 10:71422676-71422698 CAAGCAGTTGGGCAGGCCTGTGG - Intronic
1070263863 10:74883772-74883794 TGGGCAGAAGGGTAGGCCTGGGG - Intronic
1071076542 10:81760578-81760600 TTGCCAGAGGGTCAGGGCTGGGG - Intergenic
1072623427 10:97095899-97095921 TGTTCAGATGGGCAGGTCTGGGG + Intronic
1072640135 10:97205486-97205508 TAGCCAGATGGGCTGGCACTGGG - Intronic
1073098787 10:100996592-100996614 TGCCCAGGTGAGCAGGCCTGCGG - Intergenic
1073138117 10:101230702-101230724 TAGCAAGACAGGAAGGCCTGAGG - Intergenic
1073608846 10:104923263-104923285 TAGCCAGTTGGGAAGTCCTTAGG + Intronic
1075512258 10:123082065-123082087 GAGCCAGCTGGGCAAGCCGGGGG - Intergenic
1075797761 10:125133336-125133358 TAGGCAGGTGAGCAGGTCTGAGG - Intronic
1075831925 10:125419296-125419318 TTGCCAGATGGGAACACCTGTGG + Intergenic
1075953001 10:126498205-126498227 TAGGCACATGGGCAGGCCCTTGG + Intronic
1076412584 10:130262516-130262538 GAGCCATGGGGGCAGGCCTGCGG + Intergenic
1076447396 10:130526096-130526118 GAGCCCGGTGGGCAGGCATGAGG - Intergenic
1076827868 10:132978934-132978956 AAGCCAGATGGGCCTGGCTGAGG + Intergenic
1077247367 11:1546271-1546293 TAGACAGCTGGGTAGGGCTGGGG + Intergenic
1077350407 11:2090571-2090593 TAGCCAGATGAGCAGGCCTGTGG - Intergenic
1077378439 11:2216331-2216353 GGGCCAGATGGGCAGCCCCGAGG + Intergenic
1078354399 11:10623376-10623398 TACCCAGCAGGGCAGGGCTGGGG + Intronic
1083619667 11:64042583-64042605 TGGCCTGGTGGCCAGGCCTGTGG + Intronic
1084482741 11:69431315-69431337 GAGGCAGATGGCCAGGCCAGAGG - Intergenic
1084764756 11:71301143-71301165 TAGCCAGATACGGAGTCCTGAGG - Intergenic
1084883943 11:72191162-72191184 CAGCCAGCTGGACAGCCCTGGGG - Intronic
1085079865 11:73625202-73625224 CAGCCATATGGGCAGGCCCAAGG + Intergenic
1085319216 11:75563951-75563973 TGGCAAGATGGGCTGGGCTGTGG + Intronic
1086676310 11:89611493-89611515 TAGCCAGATGGGGTTGCCTCTGG - Intergenic
1087731857 11:101787858-101787880 TAGCCAGATGTGGTGGCATGTGG - Intronic
1088683467 11:112265261-112265283 TAGGCAGACGGGCAGGCTTGGGG - Intronic
1090831894 11:130426187-130426209 TAGCCAGAGGGGCAGCCACGTGG + Intronic
1090953781 11:131496935-131496957 AAGCCAGAGGGAGAGGCCTGAGG - Intronic
1091601636 12:1921442-1921464 AAGGGAGATGGGCAGCCCTGGGG - Intergenic
1093018884 12:14184716-14184738 TAGCCGGGTGTGCATGCCTGTGG + Intergenic
1094009880 12:25796563-25796585 TAGGCCTATGGTCAGGCCTGCGG + Intergenic
1096680708 12:53253410-53253432 TAGCCAGCTGGATAGGGCTGGGG + Exonic
1098059183 12:66541630-66541652 CAGCCACATGGGCAGACCTGGGG + Intronic
1099783071 12:87224606-87224628 TAGCTAGAATGGAAGGCCTGAGG + Intergenic
1100451739 12:94713085-94713107 TGGCCAGTAGGGCAGGCCAGAGG - Intergenic
1102399800 12:112618468-112618490 TTGCTAGTTGGGCAGGTCTGAGG + Intronic
1102581945 12:113894938-113894960 TGGCCAGAAGAGCAGGCTTGGGG - Intronic
1103725438 12:122995373-122995395 TGTCCAGGTGGGCAGGGCTGGGG - Exonic
1104595136 12:130115618-130115640 TGGGCAGATGGGCAGGGCTCCGG + Intergenic
1105284320 13:18992395-18992417 AACCCAGAAGGGCAGGCCAGAGG + Intergenic
1106675238 13:31951378-31951400 TGACCAGATGGGCAGGGGTGTGG - Intergenic
1110238097 13:73237119-73237141 CACCCAGATGGGGAGGCCTGTGG + Intergenic
1111177300 13:84612206-84612228 CAGCCAGGTGGGCAGTCCAGGGG - Intergenic
1111679971 13:91430275-91430297 TAGTCAGATGGGCATACCTTGGG + Intronic
1113628714 13:111865437-111865459 CAGCCAGATGGACAGGTCTGTGG + Intergenic
1113917446 13:113882998-113883020 CAGGGAGATGGCCAGGCCTGCGG - Intergenic
1114636873 14:24192535-24192557 TATCCAGAGGGGCAGACCTAAGG - Intronic
1114703912 14:24706665-24706687 TTGCCATATGGAGAGGCCTGGGG + Intergenic
1117319952 14:54612032-54612054 GAGCCAGATGGGCAGTGATGGGG + Intronic
1118026619 14:61775161-61775183 CAGCCAAATGGGCAGATCTGTGG - Intronic
1121486667 14:94321643-94321665 GAGCCACATAGGCAGGACTGAGG - Intronic
1121558010 14:94852816-94852838 TGGCCAGATGGGCACAGCTGTGG + Intergenic
1121930155 14:97964916-97964938 TAGGGAGAAGGGCAGGGCTGGGG - Intronic
1122138779 14:99649955-99649977 AGGCCAGATGGCCAGGCCTCAGG - Intronic
1122701050 14:103589431-103589453 CTGCCAGCTCGGCAGGCCTGGGG + Intronic
1125404893 15:39341897-39341919 CAGGCAGGTGGGCAGGCCTTTGG - Intergenic
1128440758 15:67706465-67706487 TAACCAGATGGTCAGGAGTGAGG + Intronic
1129263325 15:74381066-74381088 TGGCCTGATGGGCAGGGCTCGGG - Intergenic
1130687643 15:86053134-86053156 TAGCCAGATTTGCAGGCCATGGG - Intergenic
1130905422 15:88236944-88236966 TTGACAGATGCGCACGCCTGTGG - Intronic
1132338044 15:101061300-101061322 TACCTCGGTGGGCAGGCCTGCGG - Intronic
1132466607 16:80297-80319 GAACCAGAAAGGCAGGCCTGGGG - Intronic
1132944874 16:2527314-2527336 TGGCCATGTGGGCAGGCTTGTGG - Intronic
1135244383 16:20842607-20842629 TAGCCAGGCGTGCATGCCTGTGG - Intronic
1136295936 16:29302013-29302035 AAGCCAGATGGGCAGGTCCTGGG + Intergenic
1137249403 16:46731214-46731236 GAGCCAGAGGGGCAGGCCCCGGG + Intronic
1138712745 16:58987205-58987227 AAGCCAGATGGGCAGGTCCTTGG - Intergenic
1139325937 16:66152595-66152617 CAGAAAGATGTGCAGGCCTGAGG + Intergenic
1140035414 16:71367899-71367921 GAGCTAGAAGGGCAGCCCTGTGG - Intronic
1140745341 16:77975825-77975847 TGGTCAGATGGCCAGGACTGGGG - Intronic
1141742382 16:85902496-85902518 TATTTAGATGGGCTGGCCTGAGG + Intronic
1142353430 16:89590103-89590125 TAGCCAGAGAGGCTGGCCTTTGG + Intronic
1145796828 17:27660487-27660509 CAGCCAGATGGGGTGGCCAGAGG + Intergenic
1145997999 17:29115476-29115498 TACCCAGATGGGGAGCCCTGGGG - Intronic
1147557246 17:41487229-41487251 TAGGCAGATGCCCAGGGCTGTGG - Intronic
1152240102 17:79156518-79156540 TCTCCAGTTGGGCAGGCCTAGGG + Intronic
1154348539 18:13564421-13564443 TTGCCAGGTGGCCAGGCCTCAGG + Intronic
1156204770 18:34873554-34873576 GAGTCAGAGGGGCAGGGCTGGGG - Intronic
1157289618 18:46400247-46400269 TGGCCATGTGGGTAGGCCTGGGG + Intronic
1159992396 18:74924738-74924760 AAGCCAGACGGGGAGGGCTGAGG + Intronic
1160692272 19:465568-465590 TAGGTAGATGGGCAGGCAGGTGG + Intronic
1160811013 19:1012908-1012930 CTGCCAGATGGGCAGGGGTGGGG + Intronic
1160930209 19:1566836-1566858 CAGCCTGCTGGGCAGGCCGGCGG - Intronic
1162003944 19:7765298-7765320 TAGCCAAAAGGCCAGGCCTGGGG - Intronic
1162794376 19:13078931-13078953 GAGCCAGGTGGGCAGCCCAGGGG - Intronic
1162933025 19:13966604-13966626 TGGCCAGGTGGGCAGGCAAGTGG - Intronic
1163414524 19:17178047-17178069 TAGCCAGGTCGGCAGGGCTGCGG + Intronic
1163698471 19:18775584-18775606 TGGCCAGCTGGGCAGGCCCGCGG + Intronic
1166121408 19:40689722-40689744 TGGACAGCTGGGCAGCCCTGGGG + Intronic
1166302981 19:41922620-41922642 GAGGCAGTGGGGCAGGCCTGAGG + Intronic
1166344180 19:42155106-42155128 GAGGCAGGTGGGCAGGACTGTGG - Intronic
1167593346 19:50415882-50415904 TTCCGAGATGGGCGGGCCTGCGG + Intronic
1167608912 19:50496799-50496821 CAGCCAGCTGGGGAGGCCTGTGG - Intergenic
1167768535 19:51499876-51499898 CAGCCAGAGGGGAAGGCCCGAGG - Intronic
925909755 2:8566001-8566023 TAGCCAGAGGGGAAGGCCATTGG - Intergenic
927120072 2:19951123-19951145 TAGACAGATGGGAAGGTGTGAGG + Intronic
927503250 2:23596159-23596181 CAGCCGGACGGGCAGGCCGGGGG + Intronic
927880169 2:26684608-26684630 TCACCAGATGGGCAGCCCAGTGG - Intergenic
929368321 2:41189283-41189305 TAGGCATATGGGCATGTCTGAGG - Intergenic
929827640 2:45321803-45321825 TGGCCAGATGAGCAGGCCAAGGG + Intergenic
931641342 2:64383274-64383296 TAGGCAGAGGGGCAGACCTGGGG + Intergenic
931852171 2:66262655-66262677 CAGCCAGATGGGGAGGCATAGGG + Intergenic
932817254 2:74871868-74871890 CAGCAAGATGGGCTGGCCTTTGG + Intronic
936192341 2:110342739-110342761 GAGCCAGCAGGGCAGGGCTGTGG - Intergenic
937050236 2:118882554-118882576 TAGCCATAAGGGAAGACCTGGGG + Intergenic
938291148 2:130151272-130151294 AAGCCAGAGGTCCAGGCCTGTGG + Intergenic
938457429 2:131475791-131475813 CAGGGAGAGGGGCAGGCCTGGGG + Intronic
938465397 2:131521687-131521709 AAGCCAGAGGCCCAGGCCTGTGG - Intergenic
940286899 2:152041494-152041516 TAGGCAGTTGGCCAGGCCAGGGG + Intronic
940316542 2:152333486-152333508 TATCCAGATGGGCAACCCTCTGG + Intergenic
940516770 2:154693416-154693438 TGAAGAGATGGGCAGGCCTGGGG - Intergenic
942938119 2:181582932-181582954 TAGTGAGATGGGCAAGACTGTGG - Intronic
943943478 2:194028913-194028935 TAGGCAGATGGGGAGGGGTGAGG + Intergenic
948482615 2:238259700-238259722 TGGCTAGGTGTGCAGGCCTGGGG - Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1168799594 20:635591-635613 CAGGCAGGAGGGCAGGCCTGGGG - Intergenic
1169895626 20:10502431-10502453 GAGTCAGATCGGAAGGCCTGAGG - Intronic
1170578815 20:17682673-17682695 TATCCAGAGGCGCAGGCCCGGGG - Intergenic
1170658122 20:18309613-18309635 TAGCCAGAGGCTCAGCCCTGTGG + Intronic
1172447884 20:35002654-35002676 GAGGCAGAGGGGCAGGCTTGGGG + Exonic
1174379845 20:50149459-50149481 TGGCCAGCTTGGCAGGCCAGAGG - Intronic
1174420678 20:50397190-50397212 AAGACAGGTGGGCAGGGCTGGGG - Intergenic
1175207914 20:57326190-57326212 TAGCCAGGTGTGGTGGCCTGAGG - Intergenic
1175327776 20:58141751-58141773 TGGGCAGGTGGCCAGGCCTGTGG - Intergenic
1175333616 20:58180858-58180880 TTGCCTGGTGGGGAGGCCTGAGG - Intergenic
1175454884 20:59105015-59105037 GAGCCAGCTGGGCAGACATGGGG + Intergenic
1175994510 20:62806027-62806049 CAGGCAGCTGGGGAGGCCTGAGG - Intronic
1178548555 21:33515211-33515233 TAGTGAGATGATCAGGCCTGGGG - Intronic
1180824930 22:18855532-18855554 TGGGAAGATGGGCAGGACTGGGG + Intronic
1181125346 22:20698683-20698705 TTGGAAGATGGGCAGGACTGGGG + Intergenic
1181187801 22:21119016-21119038 TCGGAAGATGGGCAGGACTGGGG - Intergenic
1181211397 22:21291477-21291499 TCGGAAGATGGGCAGGACTGGGG + Intergenic
1181398107 22:22635410-22635432 TGGGAAGATGGGCAGGACTGGGG - Intergenic
1181500850 22:23314781-23314803 TAAGAAGATGGGCAGGACTGGGG - Intronic
1181651306 22:24260650-24260672 TCGGAAGATGGGCAGGACTGGGG + Intergenic
1181706075 22:24650089-24650111 TCGGAAGATGGGCAGGACTGGGG - Intergenic
1182219100 22:28743577-28743599 GAGCAAGATGGGGATGCCTGAGG - Intronic
1183262464 22:36804423-36804445 TAGCCACATGCGCTGGCCTTCGG + Intronic
1184245471 22:43233698-43233720 GAGCGACATGGGCCGGCCTGAGG - Intronic
1185373047 22:50469690-50469712 GAGCCAGATGGGCAAGGCGGGGG + Intronic
1203215551 22_KI270731v1_random:3954-3976 TCGGAAGATGGGCAGGACTGGGG - Intergenic
1203275075 22_KI270734v1_random:81437-81459 TCGGAAGATGGGCAGGACTGGGG + Intergenic
949826379 3:8169745-8169767 AAGCCAGAGGGGCAAGGCTGAGG - Intergenic
950084508 3:10248240-10248262 CAGCCAGATGTGCAGGCAGGTGG - Exonic
950184647 3:10937620-10937642 TGGCCTGAGGGGCAGGGCTGTGG + Intronic
950533585 3:13567052-13567074 TGGGGAGATGGGCAAGCCTGAGG + Intronic
950880943 3:16322267-16322289 AAGCCAGATGGGCTGGAGTGTGG - Intronic
951522728 3:23624556-23624578 TACTCAGATGGGCAGGACTTGGG + Intergenic
954292605 3:49657717-49657739 GAGCCAGATGGGCAGGCCCAGGG + Exonic
954301188 3:49701651-49701673 TGGCCAGATGCCCAGGCCAGGGG - Intronic
957103601 3:75858566-75858588 TAGCCAGTTGGTCAGGAGTGTGG - Intergenic
961370046 3:126423431-126423453 GAGCCAGAGGGGCAGGGGTGGGG - Intronic
961439651 3:126945284-126945306 GAGCTGGAAGGGCAGGCCTGTGG + Intronic
963289430 3:143472908-143472930 CAGCCTGTGGGGCAGGCCTGAGG - Intronic
964109379 3:153073124-153073146 TAGCCTCAGGGGCAGGCCTCAGG - Intergenic
967175268 3:186857084-186857106 TAGCCAGATGGTGTGGCTTGGGG - Exonic
967681802 3:192372278-192372300 TATCCAGGTTGGCAAGCCTGAGG + Intronic
968487109 4:868021-868043 GAGCCCGATGGGAAGGCCAGGGG + Intronic
972056910 4:34815113-34815135 TAGGGAGATGGGGAGCCCTGGGG - Intergenic
972346733 4:38198648-38198670 CAGTCAGACAGGCAGGCCTGGGG - Intergenic
974328176 4:60443486-60443508 AGTCCATATGGGCAGGCCTGGGG + Intergenic
977995796 4:103496536-103496558 TAGCCAGGGGTGAAGGCCTGGGG + Intergenic
983987575 4:174078823-174078845 TAGTCTGATGGGCAGGCATTGGG - Intergenic
985175175 4:187192878-187192900 CAGTGAGATGGGCATGCCTGAGG - Intergenic
985904721 5:2824331-2824353 TAGCCAGACCGGCTGGCCCGAGG - Intergenic
986861482 5:11931772-11931794 TAGCAGGGTGGACAGGCCTGGGG - Intergenic
987913251 5:24178007-24178029 TAGCAAGATGCGCAGGCATTTGG + Intronic
990966240 5:61451031-61451053 TAGCCAGATGGTCAGTCTTCAGG - Intronic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
992722898 5:79578212-79578234 TGGCCATTTGGGCTGGCCTGTGG - Intergenic
994252141 5:97548482-97548504 TAGGCAGATGGTCAGAGCTGAGG + Intergenic
999428427 5:151506295-151506317 TTGCAAGATGGGCTGGCCTTAGG - Intronic
999654674 5:153800166-153800188 TAGGTAGAGGGACAGGCCTGAGG - Intronic
1001136515 5:169107138-169107160 CAGCCATATGGGCAGCCATGAGG - Intronic
1001525037 5:172422906-172422928 CAGCATGATGGGCTGGCCTGTGG - Intronic
1003160932 6:3633664-3633686 TAGCCAGCTGGGCAGAAGTGAGG + Intergenic
1006373548 6:33659564-33659586 TGGCCAGCTGGGCAGGGCAGGGG - Intronic
1011127886 6:84026470-84026492 TAGACAGGTGTGCAGGCATGTGG + Intergenic
1016278387 6:142381984-142382006 TGGCCAGCTGTGCAGACCTGGGG + Exonic
1016393241 6:143596173-143596195 TGGCCAGTTTTGCAGGCCTGAGG - Intronic
1016647832 6:146430284-146430306 TGGACAGCTAGGCAGGCCTGAGG - Intronic
1019136612 6:169912448-169912470 CAGACAGATGGGCAGGCTTGGGG - Intergenic
1019191387 6:170253057-170253079 TAAGCAGAGGGGGAGGCCTGGGG - Intergenic
1019703687 7:2487571-2487593 GACCCAGATGCCCAGGCCTGGGG + Intergenic
1020050620 7:5079239-5079261 AAGCCAGAGGAGCGGGCCTGGGG + Intergenic
1020204799 7:6105591-6105613 CAGCCAGGTGGCTAGGCCTGGGG - Intronic
1021043374 7:15890899-15890921 TAGCCTCCTGGCCAGGCCTGTGG - Intergenic
1021633334 7:22667380-22667402 TAGCCAGATGTGGTGGCATGTGG - Intergenic
1023920950 7:44629492-44629514 TAGGCAGGTGGGCAGGGCAGAGG - Intronic
1025250297 7:57347293-57347315 AAGACAGGTGGGCAGGGCTGGGG + Intergenic
1026310589 7:69180418-69180440 GAGCCAGATGGGCTGCCCAGGGG + Intergenic
1026889589 7:73974189-73974211 TGGCCTGGTGGGCAGGCCGGGGG + Intergenic
1028809454 7:95067892-95067914 TAGCCAGATAGCCAGATCTGAGG - Intronic
1029278711 7:99423414-99423436 CAGCCAGCTGGGCATGTCTGAGG + Intronic
1029940710 7:104477879-104477901 TAGCCAGATGGGGAGGGAGGGGG + Intronic
1034276940 7:149828029-149828051 CAGACAGATGGGGAGGCTTGGGG - Intergenic
1035524607 8:302588-302610 AAGCCAGAGGGGCAGTCCTGGGG - Intergenic
1035721311 8:1795495-1795517 AAGCCAGATGAGCAGGCTAGAGG - Intergenic
1036127078 8:6072775-6072797 TGGGCGGATGGGCAGGACTGGGG - Intergenic
1036807939 8:11847927-11847949 TAGCCAGGTGCACAGGCCTCTGG - Intronic
1037460269 8:19101681-19101703 GGGCCACATGGGCAGGACTGTGG - Intergenic
1037891997 8:22628457-22628479 AAGCCAGCCAGGCAGGCCTGAGG + Intronic
1038018919 8:23536689-23536711 GAGGCAGAAGGGCAGGCCCGAGG - Intronic
1039241490 8:35561395-35561417 GAGCCAGATGGGGAAGCATGGGG - Intronic
1051677277 9:19571070-19571092 CAGCCAGATGGAGAGGCATGGGG + Intronic
1060470376 9:123943281-123943303 TAGACAGAGGTGCAGACCTGGGG + Intergenic
1061514722 9:131082342-131082364 TAGCCACATGGGCAAGTCCGAGG - Intronic
1061901234 9:133673135-133673157 TAGCCTGTTGTGCAGGCGTGCGG - Intronic
1062201146 9:135303408-135303430 TATCCAGACAGGCAGGGCTGTGG - Intergenic
1062282801 9:135759497-135759519 GGGACAGATGGGCAGGGCTGAGG + Intronic
1062313138 9:135950367-135950389 CAGACAGATGCGCAGGCCAGAGG + Intronic
1062439713 9:136564252-136564274 TAGGCAGAAGGGCAGGATTGGGG + Intergenic
1187243468 X:17533668-17533690 TAGGAAGATGGACAGGGCTGGGG + Intronic
1190056815 X:47185964-47185986 TAGCCAGATGGCATGCCCTGTGG + Intronic
1190264331 X:48818289-48818311 CAGCCAGATCGGCCGGGCTGCGG + Exonic
1190887109 X:54539876-54539898 CAGCCAGATGGGCAGATCTTTGG + Intronic
1193241385 X:79174246-79174268 AACGTAGATGGGCAGGCCTGGGG - Intergenic
1195315467 X:103673169-103673191 TGACCAGATGGGCAGGCTTGGGG - Intergenic
1195990752 X:110679806-110679828 TAGCCAGGAGGGCAGCCCAGCGG - Intronic
1199602013 X:149546671-149546693 TTGTCACATGGGCAGGCCTTGGG + Intronic
1199648375 X:149932813-149932835 TTGTCACATGGGCAGGCCTTGGG - Intronic
1199859142 X:151784105-151784127 TAGACAGATGTACAGGTCTGGGG - Intergenic