ID: 902613198

View in Genome Browser
Species Human (GRCh38)
Location 1:17609122-17609144
Sequence CATGCAGGAATGGCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902613198_902613211 1 Left 902613198 1:17609122-17609144 CCACCTGGGGCCATTCCTGCATG 0: 1
1: 0
2: 0
3: 11
4: 218
Right 902613211 1:17609146-17609168 GCAGGGTGGGGACAAGAGAGGGG 0: 1
1: 0
2: 7
3: 99
4: 759
902613198_902613214 30 Left 902613198 1:17609122-17609144 CCACCTGGGGCCATTCCTGCATG 0: 1
1: 0
2: 0
3: 11
4: 218
Right 902613214 1:17609175-17609197 CCAGTGCCTCCCACCTTTTCTGG 0: 1
1: 0
2: 3
3: 31
4: 287
902613198_902613209 -1 Left 902613198 1:17609122-17609144 CCACCTGGGGCCATTCCTGCATG 0: 1
1: 0
2: 0
3: 11
4: 218
Right 902613209 1:17609144-17609166 GGGCAGGGTGGGGACAAGAGAGG 0: 1
1: 1
2: 6
3: 138
4: 1152
902613198_902613210 0 Left 902613198 1:17609122-17609144 CCACCTGGGGCCATTCCTGCATG 0: 1
1: 0
2: 0
3: 11
4: 218
Right 902613210 1:17609145-17609167 GGCAGGGTGGGGACAAGAGAGGG 0: 1
1: 1
2: 11
3: 97
4: 930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902613198 Original CRISPR CATGCAGGAATGGCCCCAGG TGG (reversed) Intronic
900339368 1:2180815-2180837 GATGCAGGGCTGGGCCCAGGAGG - Intronic
900678622 1:3903876-3903898 CATCCAGGAAGGGCCCCCTGAGG - Intergenic
900949489 1:5850287-5850309 CTTGTATGAATGGCCCCATGAGG - Intergenic
900970421 1:5989666-5989688 CAGGCCGTGATGGCCCCAGGTGG + Intronic
901868992 1:12126543-12126565 CTGGCAGGAATGCCCCCTGGGGG - Intronic
901908276 1:12433357-12433379 GATGGAGGAATGGCGCCAGCAGG - Intronic
902613198 1:17609122-17609144 CATGCAGGAATGGCCCCAGGTGG - Intronic
903681990 1:25103361-25103383 CAGGCAGGGCTGGCCCCAGCTGG - Intergenic
904171343 1:28593775-28593797 CATCCAAGACTGGCACCAGGAGG + Exonic
904239380 1:29134270-29134292 CCTGCAGGGCAGGCCCCAGGTGG + Intergenic
904598487 1:31661281-31661303 CAGGCACCAGTGGCCCCAGGAGG + Intronic
904849159 1:33444057-33444079 TATGCAGGCCTGGCCCCAGGAGG + Intergenic
904867118 1:33588813-33588835 CATTCAGGACTGGCACTAGGTGG + Intronic
904943564 1:34182319-34182341 CAGGCAGGCAAGGCCTCAGGAGG + Intronic
913059675 1:115193610-115193632 CCTGCAGGAATGGCAGCAGTGGG - Intergenic
914740946 1:150464520-150464542 GATGCAGGACTGACCCCTGGTGG - Exonic
916276971 1:163004921-163004943 AATGCAGGAAAGGCTCGAGGAGG + Intergenic
916963850 1:169915275-169915297 CCTGCGGGCATGGCCCCTGGGGG - Intergenic
917486585 1:175460362-175460384 CATGCACGCAAGGCCACAGGAGG + Intronic
919842408 1:201619002-201619024 CACACAGGATTGCCCCCAGGTGG - Intergenic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1066413425 10:35196114-35196136 CATGCAGGGACGGCCTCAGTAGG - Intronic
1066416296 10:35224396-35224418 TATCCAGCAATGGACCCAGGTGG + Intergenic
1066645367 10:37602031-37602053 CTTGTATGAATGGCCACAGGAGG - Exonic
1067278674 10:44855262-44855284 GATGCAGGCATGAGCCCAGGGGG - Intergenic
1070488123 10:76950577-76950599 CATGCCTGGATGGCCCCATGTGG + Intronic
1071525717 10:86357044-86357066 CCTGGAGAAATGGCTCCAGGAGG + Intronic
1071767648 10:88686776-88686798 GATGCAGAAGTGGACCCAGGTGG + Intergenic
1072607636 10:96997926-96997948 CATCCAGGGATGGCTCCAAGGGG - Intergenic
1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG + Intergenic
1073591425 10:104761453-104761475 CATGCAGAAATGGCTCCTGCAGG + Intronic
1074364725 10:112848816-112848838 TATTCAGGAAGGCCCCCAGGAGG + Intergenic
1075477649 10:122750142-122750164 CATGCACGCACTGCCCCAGGTGG - Intergenic
1076243083 10:128925072-128925094 CCTGCAGGAATAGCCGGAGGAGG + Intergenic
1076500385 10:130931838-130931860 CAGGCAGGCATGGCCCCTGCAGG + Intergenic
1076723805 10:132404283-132404305 CCAGCAGGAATGCTCCCAGGAGG - Intronic
1078545106 11:12241516-12241538 GATGTTGGAATGGGCCCAGGTGG + Intronic
1080432979 11:32215633-32215655 CATGTAGGCATGTTCCCAGGAGG - Intergenic
1081013764 11:37849817-37849839 GTTGCAGGAATGGCCTCATGAGG - Intergenic
1083289616 11:61682535-61682557 CCTGCAGGAGTGGCCCAAGCAGG + Intronic
1083664609 11:64267711-64267733 CAGGAAGGAGGGGCCCCAGGAGG - Intronic
1084643088 11:70437427-70437449 CATGCAGAAAGGGCCCCCGCTGG + Intergenic
1085728380 11:78975123-78975145 CAAGCAGGAATGGCTCAAGAGGG + Intronic
1089221297 11:116873980-116874002 CCTGCAGGAATGGAGCCTGGGGG + Exonic
1089283560 11:117391382-117391404 TATGGAGTAATGGGCCCAGGTGG - Intronic
1092998957 12:13977815-13977837 CAAGGAGGAATCGCCACAGGTGG - Intronic
1093562148 12:20553670-20553692 CACGCAGAAATGGCCTCAAGGGG + Intronic
1095830176 12:46577330-46577352 CAGGCAGGAATTGGCCAAGGTGG + Intergenic
1098107117 12:67080432-67080454 CATGGAGGAATGGCATCACGTGG + Intergenic
1099689820 12:85938309-85938331 CCTGCACCAATGGCCCCATGGGG + Intergenic
1102036364 12:109772509-109772531 CATGCTAGAATGGCCACCGGAGG - Intergenic
1103264050 12:119614013-119614035 CCTGCAGGAGTGGCCCCTGCAGG - Intronic
1104823978 12:131695291-131695313 CATACAGGCCTGGCCCCTGGCGG + Intergenic
1112700475 13:102001939-102001961 CAGCCAGGGATGGTCCCAGGAGG - Intronic
1115157093 14:30353374-30353396 CCTTCAGGAATGGCTCCTGGAGG - Intergenic
1115268739 14:31527929-31527951 CACGGAGGAAAGGCCACAGGAGG - Intronic
1117851037 14:59969901-59969923 CATGCAGGAATGGCAGCTGTAGG - Intronic
1118063310 14:62164291-62164313 CATGCACACAGGGCCCCAGGAGG + Intergenic
1119322668 14:73740916-73740938 CCTGCAGGTAAGGCCCCAGAAGG + Intronic
1119774991 14:77242771-77242793 CATGCAAGTCTGGGCCCAGGAGG + Intronic
1120935519 14:89892102-89892124 CATCCAAGACTGGCACCAGGAGG + Intronic
1121345883 14:93135668-93135690 CAGGCAGGCCTGGCCCCAGCAGG + Intergenic
1122718348 14:103708277-103708299 CATGGAGCAAGGTCCCCAGGAGG + Intronic
1124645445 15:31434863-31434885 CATGCAGGAAGGCGCCCAGTGGG - Intronic
1127335625 15:57980391-57980413 CATGCAGAAGTGGCACCAGCTGG - Intronic
1128330050 15:66749805-66749827 CAAGGAGGACTGACCCCAGGTGG + Intronic
1128555971 15:68631899-68631921 GCTGCTGGAATGGCCCCAGATGG + Intronic
1129385197 15:75192451-75192473 CAGGCTGGCAAGGCCCCAGGTGG - Intergenic
1132157815 15:99508918-99508940 GATGCAGTGATGGGCCCAGGAGG + Intergenic
1133103141 16:3491225-3491247 TATGCAGGCATGGCCCGGGGTGG - Intergenic
1134101208 16:11452753-11452775 CTGGCAGGAATGTCCCCAGATGG - Intronic
1136226966 16:28866079-28866101 CATTCATGATGGGCCCCAGGAGG - Exonic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1138199461 16:55078167-55078189 CATCCAGGAATGACTCCTGGAGG + Intergenic
1138371791 16:56532882-56532904 CACCCAGGAATGGCTCCAGGGGG - Intergenic
1138576643 16:57911715-57911737 CACCCAGGCATGGCCCCAGGGGG + Intronic
1139950371 16:70665382-70665404 TGTGCAGTAATGGCACCAGGTGG + Intronic
1139961902 16:70722704-70722726 GATGCAGGCAGGGCCCAAGGAGG + Intronic
1140671971 16:77288149-77288171 CATGCACGTATGGTCCAAGGAGG - Intronic
1141609402 16:85172565-85172587 CAAGCAGGAACTGCCCCCGGTGG + Intronic
1141738276 16:85870416-85870438 AAGGCAGGAATGTGCCCAGGTGG + Intergenic
1142400267 16:89854894-89854916 GGTCCAGGAATGGCCCCTGGAGG + Intronic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1143918298 17:10311011-10311033 CTGGCAGGAAAGGCCCCATGGGG + Intronic
1144871847 17:18376805-18376827 CACCCAGAAATGGCCCCTGGTGG - Intergenic
1145004785 17:19331753-19331775 CAGGCAGGCATGTCCCCAGGAGG + Intronic
1146720373 17:35119622-35119644 CAGGCCGGAACAGCCCCAGGGGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147381071 17:40056603-40056625 GATCCAGGAATGGCTCCAGGTGG - Intronic
1148153341 17:45409343-45409365 CACGAAGGAATGTCCCCAGCAGG + Intronic
1148215078 17:45829906-45829928 CAGGCAGGAAGGGCTCCATGGGG + Intronic
1148954280 17:51340945-51340967 CAGCCAGGAATGGTCCCATGAGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151396982 17:73829805-73829827 CAGGCAGGGATGGTCCCAGAAGG - Intergenic
1151749443 17:76028261-76028283 CACCCAGAAATGGCCCCTGGTGG + Intergenic
1152146708 17:78572840-78572862 CATGGCTGGATGGCCCCAGGTGG - Exonic
1152842214 17:82577420-82577442 CATGCAGGTTGGGCCACAGGCGG - Intronic
1154095756 18:11413650-11413672 CAGGCAGGAATGCCACCAGGAGG - Intergenic
1159917528 18:74200061-74200083 CAGGCAGGATGGGCCCAAGGAGG + Intergenic
1160015827 18:75139715-75139737 CATGCAGGACGCACCCCAGGCGG + Intergenic
1160085955 18:75777869-75777891 CAGGCAGGACTGTCCCGAGGTGG - Intergenic
1160981901 19:1820076-1820098 CAGGCAGGCATGGCCTCAGCTGG - Intronic
1161559148 19:4961460-4961482 CACGCAGAAATGGCCTCAAGGGG + Exonic
1162951134 19:14072721-14072743 CCTCCAGGAACGGCCCCCGGGGG - Intronic
1164541819 19:29127173-29127195 CATGCTGGGCTGGACCCAGGAGG + Intergenic
1166934335 19:46321879-46321901 CATCCAGGATGGGTCCCAGGAGG - Exonic
1166947196 19:46404526-46404548 CTGGCAGGCAGGGCCCCAGGAGG + Intergenic
1167058652 19:47129724-47129746 AAACCAGGGATGGCCCCAGGTGG - Intronic
1167155134 19:47734028-47734050 CATGCAGCAGTGGCCCAAGAGGG - Intronic
1167633608 19:50640273-50640295 CAGGCAGGAGTTGGCCCAGGTGG - Intronic
1168355658 19:55698185-55698207 CATGCACGGATGGGCCTAGGAGG + Intronic
925041255 2:733169-733191 CATGGAGGGAGGGCGCCAGGCGG + Intergenic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
925720523 2:6822223-6822245 CAGGCAGTGATGGCTCCAGGCGG - Intergenic
927779692 2:25929263-25929285 CAGGCAGCACTGGACCCAGGAGG - Intronic
927847487 2:26479142-26479164 GCTGCAGGAACGGCCCCAGCAGG - Intronic
929559296 2:42945767-42945789 CATGAAGGAAGGGGCCCCGGAGG - Intergenic
929686223 2:44037395-44037417 CTTGCTGGAAAGGCCCCATGCGG - Intergenic
929863911 2:45701690-45701712 CACCCAGGCATGGCCCCAGATGG + Intronic
931679051 2:64728095-64728117 CTTACAGGAATGGCAGCAGGGGG - Intronic
932840187 2:75074655-75074677 CATTAAGGAATGGCCCCTGAAGG + Intronic
933779514 2:85791846-85791868 CATGCTGGGGTGGCCCGAGGAGG - Intergenic
935735121 2:106100397-106100419 TAGCCATGAATGGCCCCAGGTGG + Intronic
936242585 2:110800741-110800763 GCTGCAGGCATGGCCGCAGGTGG + Intronic
938110344 2:128560073-128560095 CCTGCAGGAGTGGTCACAGGTGG + Intergenic
939872833 2:147543876-147543898 CATGCTGGTATGGCCACATGTGG - Intergenic
946453276 2:219799471-219799493 GATGGCAGAATGGCCCCAGGGGG - Intergenic
947187237 2:227466355-227466377 CCTGCAGGCAAGGCCCCAAGAGG - Intergenic
948473345 2:238200943-238200965 CATGTAGGAATAGCCACAGAAGG + Intronic
948750409 2:240129086-240129108 CAGGAAGGAATGATCCCAGGTGG - Intronic
1168979367 20:1991773-1991795 TGTGCAGGAATGACCCAAGGAGG + Intronic
1170475795 20:16713240-16713262 CATGGAGGAAAGGCCCCTTGAGG + Intergenic
1172353742 20:34264300-34264322 CATGCCGCAATGGCAACAGGAGG - Intronic
1172810719 20:37646060-37646082 CTTTCAGGAATGGGGCCAGGAGG + Intergenic
1173109149 20:40169391-40169413 CCAGCAGGACTGGCTCCAGGAGG + Intergenic
1173743840 20:45421387-45421409 CATGCAGGAAGGGCACTGGGGGG - Exonic
1175973529 20:62699058-62699080 ACTCCAGGAATGGGCCCAGGAGG + Intergenic
1176026340 20:62987510-62987532 CATGCAGGGGTGGGCACAGGGGG + Intergenic
1176294634 21:5064831-5064853 CATGAAGGGAAGGTCCCAGGAGG + Intergenic
1179862416 21:44197295-44197317 CATGAAGGGAAGGTCCCAGGAGG - Intergenic
1180181318 21:46119822-46119844 CAGGCAGCGATGGCCCCAAGGGG + Exonic
1182624459 22:31635689-31635711 CATACAGCCATGCCCCCAGGTGG - Intronic
1182685096 22:32116298-32116320 CAAGTTGGTATGGCCCCAGGAGG - Intergenic
1184785779 22:46671095-46671117 CAAGCAAGGATGGCCCCAGCTGG + Intronic
1184953841 22:47866510-47866532 CAGGCAGTAATGGCCTCAGTAGG - Intergenic
1185077625 22:48691762-48691784 CATCCGGGGAGGGCCCCAGGCGG + Intronic
951353726 3:21638483-21638505 GATGCAGGGATGGGCTCAGGTGG - Intronic
952041680 3:29268717-29268739 TATGAGGGAATGGCCCCAGCTGG + Intergenic
953889879 3:46743789-46743811 CCAGCAGGAAAGGCCCCAGAAGG + Intronic
954640304 3:52093847-52093869 CAGGCTGGTATGGCCCCATGTGG - Intronic
954849395 3:53587537-53587559 CAGGCAGGAATGGGGACAGGTGG + Intronic
955256073 3:57332865-57332887 CATTCAGTAAAGGCCCCAGACGG + Intronic
955804512 3:62720288-62720310 AATGCAGGAATGGTATCAGGGGG + Intronic
960996830 3:123345691-123345713 CAGACAGGAAAGGCCCCTGGTGG + Intronic
962848734 3:139291966-139291988 CATGGAGAAAGGGCCCCAGCTGG - Intronic
966445730 3:179998845-179998867 CCTGCACCAATGGCCTCAGGGGG + Intronic
969599089 4:8165350-8165372 CATGCAGCCAGGTCCCCAGGAGG + Intergenic
969690129 4:8699613-8699635 CACGCAGGGATGGCCTCACGCGG + Intergenic
972150024 4:36077869-36077891 CATTCAGGAATGGGGCCAGCAGG - Intronic
977529961 4:98189125-98189147 CATGAATGAATGTCCCCTGGGGG + Intergenic
981615663 4:146640532-146640554 CCTGCAGGCATGGCTCGAGGAGG + Exonic
985591219 5:766469-766491 CACGCAGGAATGGCCTGATGTGG + Intronic
987134683 5:14889792-14889814 AATGCTGAAATGGCACCAGGAGG - Intergenic
992095596 5:73359644-73359666 CCTGCAGGATAGGTCCCAGGTGG - Intergenic
995132211 5:108642531-108642553 CATGGACAAATGTCCCCAGGAGG + Intergenic
998690385 5:144581141-144581163 CAGGCAGGAATGGCAGCAGCTGG + Intergenic
998849533 5:146339932-146339954 CATGCAGGCATGGCGCTATGAGG - Exonic
999892390 5:155993183-155993205 CATGCAGGAATGTTCCATGGCGG - Intronic
1002104761 5:176874564-176874586 CAGGTAGGAAGGACCCCAGGGGG + Exonic
1002594714 5:180314374-180314396 CAAGCAGGAATGTCCCCAAGTGG + Intronic
1004481018 6:16019368-16019390 CAGGCAGGAATGGTCTCACGGGG - Intergenic
1005914737 6:30342346-30342368 GATTCAGGACTGGACCCAGGTGG - Exonic
1006602881 6:35237602-35237624 CAGGCAGGAATGTGCCGAGGGGG - Intronic
1007417311 6:41699298-41699320 TATGCAGGGATGCCCCCAGTGGG - Intronic
1015206821 6:130649876-130649898 CATGCTGGAATGGACCCATGTGG + Intergenic
1015571557 6:134626438-134626460 TCTGCAGGAAATGCCCCAGGAGG + Intergenic
1016932930 6:149427471-149427493 CCTGCAGAAATGGTCACAGGTGG + Intergenic
1017135216 6:151141994-151142016 GTCCCAGGAATGGCCCCAGGAGG + Intergenic
1017622966 6:156317779-156317801 CATGCTGGGAAAGCCCCAGGAGG - Intergenic
1017682061 6:156874159-156874181 GAGGCAGGAATGAGCCCAGGAGG - Intronic
1018386888 6:163312541-163312563 CAGGCAGGAATGGCTGCACGGGG - Intronic
1024020115 7:45360956-45360978 CCTGGAGGGATGGCCCCAGGTGG - Intergenic
1024353670 7:48393334-48393356 CATGCAGCACTAGCCCCAGGAGG - Intronic
1025827731 7:65024270-65024292 CCTGGAGGAAAGGCCACAGGTGG - Intergenic
1025915266 7:65860724-65860746 CCTGGAGGAAAGGCCACAGGTGG - Intergenic
1028807312 7:95043448-95043470 CAAGGAGGAAGGGCCCCAGATGG + Intronic
1029403733 7:100360660-100360682 TATGGAGGAATGGCCAGAGGTGG + Intronic
1029680768 7:102107586-102107608 GATGCAGGGAGGGCCCCGGGTGG - Intronic
1030192318 7:106821966-106821988 CCTGCACCAATGGCCCCATGGGG + Intergenic
1032136620 7:129285271-129285293 CTTGCAAGAATGACTCCAGGAGG - Intronic
1034451021 7:151137358-151137380 CACAAAGAAATGGCCCCAGGCGG - Intronic
1034478473 7:151302406-151302428 CAGGGAGGAATAGCTCCAGGAGG + Intergenic
1035198567 7:157243590-157243612 CATGCAGGAACAGCAGCAGGAGG - Intronic
1035290464 7:157834740-157834762 CCTGCAGGGAGGACCCCAGGCGG + Intronic
1036772387 8:11588160-11588182 CAGGCCGTAATGGCCCCGGGGGG - Intergenic
1038416069 8:27397038-27397060 AAGGCAGGAAAGGGCCCAGGTGG - Intronic
1039838741 8:41278623-41278645 CATGCAAGCAAGGCCCCTGGGGG - Intronic
1040592353 8:48805395-48805417 CAGGGAGGAATGGGCCCATGTGG - Intergenic
1041382037 8:57260794-57260816 CTGGCAGGAATGGACCCAGATGG - Intergenic
1041631542 8:60094105-60094127 TATGGAGAAATGGCCCCAAGTGG + Intergenic
1043991851 8:86765280-86765302 CATCCAGGAATGACCAAAGGAGG - Intergenic
1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG + Intronic
1045545872 8:103127633-103127655 CATGCAGGAATGGTAGGAGGTGG - Intergenic
1047619823 8:126594985-126595007 TATGCAGAAATGGCCACAGTAGG + Intergenic
1048256073 8:132906244-132906266 CCTGCAGGAAGGCCACCAGGTGG + Intronic
1056626840 9:88260729-88260751 GACGAGGGAATGGCCCCAGGTGG + Intergenic
1056826242 9:89878234-89878256 CCTGCAGAAATGGCCGAAGGAGG - Intergenic
1059447656 9:114348867-114348889 CAGGCAAGAACGGCCCCAGTGGG - Intronic
1061711870 9:132493536-132493558 CATGGATGAATGGCTCCTGGGGG + Intronic
1062433494 9:136535962-136535984 CATGCACCCATTGCCCCAGGAGG - Intronic
1190246748 X:48696059-48696081 CATCCAGCCATGCCCCCAGGCGG - Intronic
1193356293 X:80523407-80523429 CCTGCAGCAATGGCCTCATGAGG + Intergenic
1200146252 X:153927828-153927850 CAGGCAGGAAAGGCCTCAGCCGG + Intronic
1200232559 X:154451292-154451314 CAGGCAGGCCTGGCTCCAGGAGG + Intergenic
1200234097 X:154459949-154459971 CATGCTGGAAAGGAGCCAGGAGG - Intronic