ID: 902613726

View in Genome Browser
Species Human (GRCh38)
Location 1:17612345-17612367
Sequence ATGAAGAGACAGTCAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 497}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902613726 Original CRISPR ATGAAGAGACAGTCAGATGA AGG (reversed) Intronic
901586082 1:10294095-10294117 ATGAAAGAAGAGTCAGATGAGGG - Intronic
901799440 1:11699084-11699106 TTGAACAGACAGACAGATGGAGG + Intronic
902112120 1:14090273-14090295 ATGGAGTGTCAGTGAGATGAGGG - Intergenic
902313641 1:15601064-15601086 ATGAAGAGAAAGTCATAGGATGG - Intergenic
902613726 1:17612345-17612367 ATGAAGAGACAGTCAGATGAAGG - Intronic
903510625 1:23872186-23872208 ATGAAGACAGAGTCAGAGGTAGG + Exonic
905141821 1:35852330-35852352 TTAAAGAGAAAGTCAGAAGAGGG + Intronic
905479179 1:38249466-38249488 ATACAGAGACATACAGATGAGGG + Intergenic
905952196 1:41961243-41961265 ATGCAGTTACAGTCTGATGATGG - Intronic
906155270 1:43610269-43610291 ATGAACACACAGACAAATGAAGG + Intronic
906976677 1:50581780-50581802 ATGAAGAAAGAGTAAGATTATGG + Intronic
907548287 1:55282286-55282308 TTGAAGTGACAGTAAGAAGAGGG + Intergenic
907857062 1:58313798-58313820 ATGAAGATACAATGAGAGGATGG - Intronic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909619885 1:77655442-77655464 GTGAAGACACAGTGAGAAGATGG + Intronic
909712107 1:78663324-78663346 ATGAAGAGGGACTAAGATGAAGG - Intronic
909790203 1:79667473-79667495 ATGAAGAGACTTTCAAATAAAGG + Intergenic
910335828 1:86130177-86130199 ACAAAAAGAAAGTCAGATGAGGG - Intronic
911550331 1:99271030-99271052 ATGAAGAAACAGTAAGATAGTGG - Intronic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
912104593 1:106256481-106256503 ATGTAGAAAAAGTCATATGAGGG + Intergenic
912649195 1:111423196-111423218 CTCATGAGACAGGCAGATGAGGG + Intronic
913221556 1:116664660-116664682 ATGAAGAGACTGGCAAATGAAGG + Intronic
913479939 1:119278327-119278349 ATATAGAGACAGACAGATGATGG - Intergenic
915564931 1:156707891-156707913 ATGCAGGGACAGTCATAGGAGGG + Intergenic
915860547 1:159439931-159439953 ATGAAGATCCATTCGGATGATGG - Exonic
916145854 1:161738827-161738849 ATGAGTAGACAGGCAGATTAGGG - Intergenic
916179881 1:162073962-162073984 GAGGAGAGACAGTCAGTTGATGG - Intronic
916388640 1:164305705-164305727 ATGGAGAGATAGTCAGATGGGGG + Intergenic
916845617 1:168646866-168646888 AGTAAGAGATAATCAGATGAAGG - Intergenic
917346490 1:174033635-174033657 AGGAGGAGAGAGTCAGATGCTGG - Intergenic
917689372 1:177451604-177451626 CTGAAGAGACTGACAGATCAAGG + Intergenic
918333860 1:183487864-183487886 AGGAAGAGAAATTCAGATGCTGG + Intronic
918448677 1:184639011-184639033 GTGAAGACACAGTGAGAAGATGG + Intergenic
918699303 1:187587631-187587653 ATGAAGACACAGTGAGAAGGTGG - Intergenic
919065826 1:192691935-192691957 ATGAAGAGTCAGTAGAATGAAGG - Intergenic
919127126 1:193408633-193408655 ATAGAGAGATAGACAGATGATGG - Intergenic
919659207 1:200226935-200226957 ATGAAGGGACAGTCAGCTATAGG - Intergenic
922022727 1:221720406-221720428 ATAGATGGACAGTCAGATGAAGG - Intronic
922208736 1:223470977-223470999 ATCAAGAGCCTCTCAGATGATGG + Intergenic
922499543 1:226086359-226086381 ATGGAGAGACAGCCAGATGGAGG - Intergenic
922616069 1:226961884-226961906 ATGAGGACACAGTGAGAAGATGG - Intronic
922861773 1:228824594-228824616 ATGAAGACATTGTCAGATGAAGG - Intergenic
922999349 1:229993860-229993882 ATGATGAGACAGTGATATGCAGG + Intergenic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
923916299 1:238509878-238509900 ATGAATAGATAGATAGATGATGG - Intergenic
923929176 1:238674101-238674123 TTGAAGAGACAGCCAGAAGGTGG + Intergenic
924028883 1:239867011-239867033 CTGAAGAGTCAGACAGATGCAGG - Intronic
924047540 1:240047285-240047307 GTGAAGACACAGTGAGAAGATGG + Intronic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
1063084005 10:2798427-2798449 CTAAGGAGACAGTCAGATAACGG + Intergenic
1063616100 10:7601757-7601779 ATGAAGAGAAATTCTGGTGAGGG - Intronic
1063998448 10:11642743-11642765 ATGAATAGAAGGTGAGATGAAGG - Intergenic
1064127649 10:12677579-12677601 ATTAAGAGTCAGCCAGATGGAGG + Intronic
1065503619 10:26407373-26407395 ATGAAAAGAAAGTAGGATGATGG - Intergenic
1065786891 10:29224185-29224207 AGGAAGAGAGAGTGAGATGCAGG + Intergenic
1065852270 10:29800719-29800741 AGGAAAAGACAGGAAGATGAGGG - Intergenic
1066204966 10:33180041-33180063 ATGAAAAGACAGTCAAAGGACGG - Exonic
1066295486 10:34050600-34050622 ATCAAGAAACAGTCAGAGGCTGG + Intergenic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1067033115 10:42893584-42893606 ATTAAGAGACAGAAAGTTGAAGG - Intergenic
1067264181 10:44722877-44722899 ATGAAGAGACAGCCAAAGAAAGG + Intergenic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068965184 10:62904832-62904854 AGGAAGAGACATTCAGAAGAGGG + Intronic
1069086500 10:64146063-64146085 ATGAAGTGATAGTCAAAAGATGG - Intergenic
1069453527 10:68535994-68536016 ATGAAGACACCGTCACAGGATGG - Intergenic
1069829679 10:71275110-71275132 ATGACAAGACAGTCAAATGAAGG - Intronic
1069906085 10:71733215-71733237 ATGAAGAGACACACAGAGCAAGG + Intronic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070688913 10:78510467-78510489 ATGAAGACACAAAGAGATGAGGG + Intergenic
1071227036 10:83542725-83542747 TGGAAGAGAAAGTCAGATGCAGG - Intergenic
1073039237 10:100589053-100589075 ATGAAGACATTCTCAGATGAAGG + Intergenic
1073516616 10:104081620-104081642 AGGAAGAGAAAGTTAGAGGAAGG - Intronic
1074441340 10:113479743-113479765 ATGTAGTGACTGTCAGATGTTGG + Intergenic
1074610711 10:115018420-115018442 ATGCAGTGAGAGTCAGATGCTGG + Intergenic
1074805660 10:117048877-117048899 AGGAAGAGACAGTGAGATTGAGG + Intronic
1075523482 10:123161076-123161098 ATCAAGAGTCAGTCATAAGAGGG - Intronic
1075609915 10:123844720-123844742 ATGAAGACAGAATCAGATGGAGG + Intronic
1075620071 10:123920311-123920333 ATAAAGATATATTCAGATGAAGG + Intronic
1076190789 10:128482064-128482086 ATGGAGAGAGACACAGATGAAGG + Intergenic
1077392811 11:2307836-2307858 ATGGAGAGAAAGTGAGGTGAGGG + Intronic
1077571732 11:3345345-3345367 ATGAAAAGGCAGCCAGATAAAGG + Intronic
1077965664 11:7129995-7130017 ATCAAGAAATTGTCAGATGAAGG - Intergenic
1078515259 11:12016589-12016611 GTGATGAGACAGTAAGATGGAGG + Intergenic
1079090117 11:17475032-17475054 AGGGAGAGACAGTCAGAGGCAGG + Intronic
1079592905 11:22202612-22202634 GTGAAGACACAGTAAGAAGATGG - Intronic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1080848921 11:36050907-36050929 ATGAGGACACAGTGAGAAGACGG - Intronic
1080933722 11:36839864-36839886 ATGGAGAGAAAGGGAGATGAAGG + Intergenic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1083752760 11:64770206-64770228 ATGAAGACACATGCAGATCATGG - Intronic
1085024972 11:73231061-73231083 AAGAAGAGACAGGTAGATGCTGG - Intronic
1085956692 11:81406523-81406545 ATGAAGAGACAAACAGAGGGAGG - Intergenic
1087891228 11:103540545-103540567 ATGGAGAGACAAGCAGAAGAGGG - Intergenic
1088046969 11:105464758-105464780 ATGAAGATACAGTAGAATGAAGG + Intergenic
1088130924 11:106489805-106489827 GTGAAGACACAGTGAGAAGAAGG - Intergenic
1088236590 11:107731644-107731666 ATGAAAAGACAGCCAGAAAAGGG - Intergenic
1088345931 11:108825044-108825066 ATGAAAAGAAAGTCAGATAGGGG + Intronic
1089831744 11:121335118-121335140 ATGGAGAGACTGTCAGAGGTGGG - Intergenic
1090010895 11:123045212-123045234 ATGAAGATGCAGTCAGCTGGTGG + Intergenic
1090148761 11:124358821-124358843 ATGAAGAAATAATGAGATGAGGG - Intergenic
1090654148 11:128829869-128829891 AGGAAGAGTTAGTCAAATGATGG - Intergenic
1091092916 11:132789813-132789835 ATGAACACTCAGCCAGATGAGGG - Intronic
1091854167 12:3725447-3725469 ATAAAGAGACACACAGAGGAGGG - Intronic
1092014541 12:5147375-5147397 ATGAAGAGACAGTTACAGGTTGG - Intergenic
1093088541 12:14893883-14893905 AGGAAGAGACAATAAGCTGAAGG + Intronic
1093377336 12:18446421-18446443 GTGAAGACACAGCCAAATGAAGG - Intronic
1093766340 12:22967644-22967666 TATAAGAGACAGTCAGATAATGG - Intergenic
1094101665 12:26770983-26771005 ATAAAGACACAGTCAGAAAATGG - Intronic
1096712573 12:53468237-53468259 ATGAAATGGCAGTCAGGTGAGGG - Intronic
1096886975 12:54727863-54727885 CAAAAGAGACAGTAAGATGAGGG - Intergenic
1096983563 12:55742921-55742943 ATGAAGAGACAGAGATATGAGGG - Intergenic
1097899093 12:64856147-64856169 AGGAAGAGAGAGTTAGATGGGGG + Intronic
1097942809 12:65330846-65330868 ATGAATGGACAGTCAGCAGATGG - Intronic
1099483783 12:83201648-83201670 ATGAAGAGAGAGATAGATTAAGG - Intergenic
1100701777 12:97156082-97156104 AGTAAGAGAAAGTCTGATGATGG - Intergenic
1100867034 12:98868055-98868077 CAGAGGAGACAGTCAGATGGAGG - Intronic
1101234144 12:102771034-102771056 ATGAAGATACAGTAAGTTGCGGG + Intergenic
1101702313 12:107185770-107185792 ATGAGGACACAGTGAGATGGTGG + Intergenic
1102514538 12:113437536-113437558 ATGGACAGACAGTCAAATGATGG + Intronic
1102664901 12:114563512-114563534 ATGAAGAGACTGTGAGAAGATGG - Intergenic
1102720996 12:115015866-115015888 ATGGAAAGACAGTCAGATATGGG - Intergenic
1103022403 12:117546180-117546202 ATCAAGACATTGTCAGATGAAGG - Intronic
1104489996 12:129185756-129185778 ATAGACAGACAGACAGATGATGG - Intronic
1105983812 13:25545952-25545974 ATGAAGTGGCAGACAGATCATGG + Intronic
1106297950 13:28435280-28435302 ATAAGGAGAAAGTCAGATCATGG - Intronic
1106669216 13:31887055-31887077 AGGAAGAGACAGTCAGTGTAAGG - Intergenic
1107094341 13:36518598-36518620 TTGAAGACACAGTGAGAAGATGG - Intergenic
1107483427 13:40804158-40804180 ATGAGGACACAGTGAGAAGACGG - Intronic
1107516920 13:41138302-41138324 ATGAAGAGACATGCAGAGCAAGG - Intergenic
1107531825 13:41289905-41289927 AAGAAGAGATAGTCAGTTGGCGG - Intergenic
1109032961 13:57217258-57217280 GTGAAGAGACAGTGAGAAGATGG + Intergenic
1109157692 13:58931105-58931127 GTGAAGAGACAGGAAGAAGATGG + Intergenic
1109747275 13:66641704-66641726 ATGAAGGGACAGATAGATGATGG + Intronic
1110042849 13:70787155-70787177 ATAAGAAGACAGACAGATGAAGG - Intergenic
1110551073 13:76812137-76812159 AAGAAGATAAAGGCAGATGAAGG + Intergenic
1111996743 13:95173141-95173163 ATGAAGAGACAGCCAGGCAAAGG + Intronic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112204365 13:97309472-97309494 GTGAAGAGACAGGAAGAAGATGG + Intronic
1112868486 13:103938528-103938550 ATGAGGATGCAGTCAGATGGTGG + Intergenic
1114367787 14:22048449-22048471 ATGAAGACACAGGGATATGATGG - Intergenic
1114453082 14:22838920-22838942 ATGAAGGCTCAGTCAAATGAAGG - Intronic
1115741072 14:36389544-36389566 AGGAACAGACTCTCAGATGATGG - Intergenic
1115972550 14:38962118-38962140 ATGAAGACACAGTGAGAAGCTGG - Intergenic
1116185535 14:41596332-41596354 AAGAAGAGTCATTCTGATGAAGG + Intergenic
1117528156 14:56632260-56632282 ATGCAGACACAGTCACAGGAAGG - Intronic
1117595223 14:57320359-57320381 TTAATGAGACATTCAGATGAAGG + Intergenic
1118127660 14:62926643-62926665 ATGAAGACACAGTGAGAAGCTGG - Intronic
1118878525 14:69805978-69806000 TTGAAGAAACAATCAGAGGATGG + Intergenic
1120614822 14:86690283-86690305 GTGAGGACACAGTGAGATGATGG + Intergenic
1121684257 14:95821269-95821291 ATGAAGACATTTTCAGATGAAGG + Intergenic
1122062698 14:99147316-99147338 ATGAAGAGGCTGTCAGATCGTGG - Intergenic
1122671530 14:103376400-103376422 GTGAGGACACAGTGAGATGATGG + Intergenic
1122822951 14:104356238-104356260 TGGGAGAGCCAGTCAGATGAGGG + Intergenic
1202894771 14_GL000194v1_random:627-649 TGGAGGAGACAGTCAGAGGAGGG - Intergenic
1124414558 15:29464457-29464479 ATGAAGAGAAAATCAAATCATGG + Intronic
1125174240 15:36802495-36802517 TTGAAAAGAAAGGCAGATGAAGG - Intronic
1125347591 15:38733704-38733726 ATGAAGACACAGTGAGAAGATGG - Intergenic
1125628743 15:41130719-41130741 ATCAAGATATTGTCAGATGAAGG + Intergenic
1126191626 15:45884907-45884929 TTGAAGAGAGAGTTGGATGAGGG + Intergenic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1127155324 15:56118369-56118391 ATGGAGATACAGTAGGATGATGG - Intronic
1127538485 15:59913670-59913692 ATAAAGAGACAGACACATTAAGG - Intergenic
1127556022 15:60088532-60088554 ATGAAGGGCCAGTCACAGGAAGG + Intergenic
1127678162 15:61264636-61264658 ATGAATAGACAGTCAGCTCAAGG + Intergenic
1127836274 15:62793621-62793643 ATGAAGAAACATTCAGAGTATGG - Intronic
1128706696 15:69842106-69842128 GTGAAGATACAGTGAGAAGATGG + Intergenic
1129114083 15:73355292-73355314 AGGAAGAGACAGTGAGAGGAAGG - Intronic
1130363742 15:83213768-83213790 ATGAGGATACAGTGAGAAGATGG + Intergenic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1131194671 15:90346048-90346070 GTGAGGAAACAGTCACATGAGGG + Intergenic
1131428462 15:92366873-92366895 GTGAAGAGACAGTGAGAAGTTGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133418666 16:5626314-5626336 ATGAAGACACAGGGAGAAGACGG - Intergenic
1134328140 16:13225811-13225833 ATTAAGAGAGAGACAGATGGAGG + Intronic
1136425524 16:30167546-30167568 GAGAAGAGCCATTCAGATGAAGG - Intergenic
1136537169 16:30906785-30906807 TTGAAGAGTCAGTAAGATAATGG + Intergenic
1137911496 16:52382637-52382659 ATAAAAAAACAGTAAGATGATGG + Intergenic
1139144970 16:64312277-64312299 AAGAAAAGACATTCACATGATGG + Intergenic
1139455430 16:67071440-67071462 ATGAGGACACAGTGAGAAGATGG + Intronic
1141398205 16:83723503-83723525 AAAAGGAGACAGTCACATGAAGG - Intronic
1141484529 16:84330063-84330085 AGGAGGAGACAGTCAGACGAGGG + Intergenic
1141910443 16:87054959-87054981 AGGAAGGGACAGTAAGATCAGGG - Intergenic
1141996113 16:87637348-87637370 ATCCAGAGACAGACGGATGATGG - Intronic
1143444612 17:7000148-7000170 GTGAAGAAACAGTCTGGTGAGGG - Intronic
1144245515 17:13359893-13359915 AGGAAGTGTCAGTCAGATAATGG - Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145282395 17:21477619-21477641 TAGAGGAGACAGTCAGAGGAGGG + Intergenic
1145395077 17:22488137-22488159 TAGAGGAGACAGTCAGAGGAGGG - Intergenic
1146726972 17:35164334-35164356 ATGAAGTTACAGTCATATGCTGG + Intronic
1147215741 17:38897996-38898018 GTCAAGAGTCAGGCAGATGAGGG + Intronic
1147811080 17:43170292-43170314 ATCAAGACACAGTCAGAGGAAGG + Intergenic
1147925404 17:43942567-43942589 ATGAGGAGACAGTGAGAGGAGGG - Intergenic
1149177119 17:53886128-53886150 AAAAAGAGAGAGTCAGAAGAGGG + Intergenic
1149305141 17:55340166-55340188 ATTAAGAGACATTCTGAGGATGG - Intergenic
1150001732 17:61444586-61444608 AAGAAAAGACACTCAGCTGAAGG - Intergenic
1151393886 17:73806991-73807013 ATGAAGACACAGCTAGAAGATGG - Intergenic
1151978240 17:77494327-77494349 ATGAAGGGACAGAGAGAGGAAGG - Intronic
1153171556 18:2321918-2321940 ATGAACAGACAAACAGATAAAGG + Intergenic
1153296382 18:3550640-3550662 ATGAAGACACAGGGAGAAGATGG + Intronic
1153512804 18:5873834-5873856 ATGAAGACACAGGGAGAAGATGG + Intergenic
1154394546 18:13975012-13975034 ATGAGGAGACAGCAAGAGGATGG + Intergenic
1154499848 18:14990534-14990556 TGGAGGAGACAGTCAGAGGAAGG - Intergenic
1155616103 18:27723338-27723360 CTGATTAGACACTCAGATGAGGG - Intergenic
1156200565 18:34826863-34826885 ATGAAATGAAAATCAGATGAAGG + Intronic
1156243941 18:35279663-35279685 ATGAGGACACAGTGAGAAGATGG - Intronic
1156511949 18:37644397-37644419 ATGAAGCCACAGCCAGATGGGGG + Intergenic
1156675162 18:39519358-39519380 ATGAAGAGAAAGACAGATCTGGG + Intergenic
1156677600 18:39549047-39549069 ATGAAAAGTCAGTCAGGGGAGGG + Intergenic
1157164348 18:45344530-45344552 ATGAAGAGACACTTAGAGCAGGG + Intronic
1157180661 18:45495190-45495212 AAGAAAAGACAGACAGAGGAAGG + Intronic
1157567322 18:48688368-48688390 AAGAAGAGAGGGTCAGATGAGGG + Intronic
1157797882 18:50592205-50592227 ATAAAGAAACAGCCAGAAGAGGG + Intronic
1158253503 18:55517395-55517417 ATGAGGATACAGTCTGATGGCGG - Intronic
1158264216 18:55641816-55641838 ATGAAGGGGAAATCAGATGAGGG + Intronic
1158340046 18:56456070-56456092 ATGATGACACAGTCATATGCTGG + Intergenic
1158531304 18:58264779-58264801 ACGAAAATACGGTCAGATGAAGG - Intronic
1159127401 18:64240033-64240055 ATACAGAGACAGTCAGATGTAGG + Intergenic
1159202964 18:65211405-65211427 GTGAAGACACAGTAAGAAGATGG + Intergenic
1160018343 18:75161285-75161307 ATGAAAAGATAGTCAGAATAGGG - Intergenic
1160047291 18:75398780-75398802 ATGAAGAGAGAGAGAGAGGAAGG - Intergenic
1160771987 19:836393-836415 ATGAAGAGACAGACAGATATAGG + Intergenic
1162190703 19:8944193-8944215 ATGAAAAGAAAGAAAGATGATGG - Intronic
1162205658 19:9054373-9054395 ATGGAGAGAGAATCAGATGAGGG - Intergenic
1162526644 19:11210229-11210251 GTGAAGAGACAGTGAGGGGATGG - Intronic
1162526757 19:11210713-11210735 GTGAAGAGACAGTGAAAGGATGG - Intronic
1162896154 19:13765660-13765682 ATGAAGAGATAATAAAATGAAGG - Intronic
1163252923 19:16137199-16137221 ATGAAGAGCCAGGGAGATGATGG + Intronic
1163383670 19:16985804-16985826 ATGAAGAGAGGGACAGATGGAGG + Intronic
1164281789 19:23775640-23775662 ATGCAGAGACAGTCACAAGTTGG + Intronic
1164612108 19:29639524-29639546 AAGAATAAACAGCCAGATGAAGG + Intergenic
1165264384 19:34647692-34647714 ATGAAGAACAAGGCAGATGAGGG + Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165900858 19:39168640-39168662 AGGAAGAGACATTCTGATGGCGG - Exonic
1166715193 19:44962505-44962527 ATGAAGACACAGGGAGAAGACGG - Intronic
1166896491 19:46025615-46025637 ATGAACAGACAGTTTGAAGATGG - Intergenic
1167272183 19:48511762-48511784 TTGAAGGGACAGACGGATGAAGG + Intronic
1167346335 19:48947734-48947756 ATGAAGAGACAAACAGAGGCTGG - Intergenic
925221757 2:2147534-2147556 CTGAACAGACAGTCAGCTGTGGG - Intronic
925471399 2:4165113-4165135 ATGCAGAGACAGACATATGAAGG + Intergenic
926705028 2:15831038-15831060 ATGAAGAGACAGACAGAAGGTGG + Intergenic
927845858 2:26472666-26472688 ATGGACAGACAGGCAGAGGAAGG + Intronic
927869459 2:26614375-26614397 ACCAAGGGACAGGCAGATGAGGG - Intronic
928954207 2:36844755-36844777 ATGAAGATCCAGTTGGATGATGG + Exonic
929767578 2:44860179-44860201 ATGATGAGAAACTCAGAAGAAGG + Intergenic
929904219 2:46032180-46032202 ATGAAGATAAAGTAAGATCATGG - Intronic
930852577 2:55976318-55976340 ATGAAGAAAAAGCCAGATAAGGG + Intergenic
931053221 2:58437720-58437742 ATTAGGAGCCAGCCAGATGATGG + Intergenic
931934876 2:67185973-67185995 ATGAAGAGAAGGTGAGATGTGGG + Intergenic
932003782 2:67907830-67907852 ATGCAGAGCCTGGCAGATGATGG + Intergenic
932136250 2:69231641-69231663 ATGAAGCTGCAGTCAGATGGCGG + Intronic
932345047 2:70989828-70989850 ATGAAGAGTCAGTCAGTTTAAGG + Intronic
933075787 2:77924502-77924524 ACAAATAGACAGTCAGAAGAAGG + Intergenic
933364959 2:81340884-81340906 ATGAAGACACAGTCAGAAGGTGG - Intergenic
933597365 2:84295693-84295715 AAGAAGAGACGGTCAGGAGATGG + Intergenic
934699276 2:96426482-96426504 ATGCAAAGAAAGTAAGATGAAGG + Intergenic
935034598 2:99357096-99357118 AAGAAGAGACACACAGATCAAGG - Intronic
935058984 2:99592088-99592110 ATGAAGATACAGTAACAGGAGGG + Intronic
935632148 2:105220849-105220871 AAACAGAGACAGTGAGATGAAGG - Intergenic
935710634 2:105895043-105895065 GTGAATAGACATTCAGGTGAGGG + Intergenic
936002817 2:108851155-108851177 ATGAAGAGAGAGACAGAGCAAGG + Intronic
936021513 2:108998578-108998600 AGGAAGAGAAAGTCAGAAGCAGG - Intergenic
936348206 2:111691260-111691282 TTGAATGGACAGACAGATGAAGG + Intergenic
936650115 2:114416268-114416290 ATTGAGAGGCAGTCAGATGTAGG - Intergenic
937370117 2:121291423-121291445 ATGAAGAGACGGTCAGTAGTCGG - Intergenic
937420283 2:121748385-121748407 ATGAAGACACAGTGAAAAGATGG + Intronic
937532698 2:122848316-122848338 ATGAATAGAAAGTCAAACGAAGG - Intergenic
937672544 2:124553771-124553793 ACAAAGAGACAGACAGAGGAAGG + Intronic
937710320 2:124973474-124973496 AGAAACAGACAGTGAGATGAAGG - Intergenic
937795368 2:126011654-126011676 GTGAAGACACAGTAAGAAGATGG + Intergenic
938144302 2:128821165-128821187 ATGAGGAGGCAGTCAGCTGACGG + Intergenic
938499059 2:131820889-131820911 TGGAGGAGACAGTCAGAGGAAGG - Intergenic
938683162 2:133712559-133712581 ATCCAGAGACACTGAGATGAGGG - Intergenic
939122646 2:138136709-138136731 ATGAAGAGACAAATAGATTAGGG - Intergenic
939173960 2:138728229-138728251 ATGAAGACACAGGGAGAAGATGG + Intronic
939350527 2:141032027-141032049 TTTAAAAGACAGTCAGATGCAGG + Intronic
939563945 2:143764747-143764769 GTGCAGAGACAGTGAGATTAAGG - Intronic
939741966 2:145919033-145919055 AGGAAGAGACTGAGAGATGAGGG - Intergenic
939939979 2:148337586-148337608 ATGAAGAGACAGATGGCTGAGGG + Intronic
939972951 2:148682671-148682693 ATGAAAATACAGTGAGAGGAGGG - Intronic
942366548 2:175234394-175234416 ATAAAGAGACAGACATAAGAGGG + Intergenic
942406207 2:175659024-175659046 ATCAAGACATTGTCAGATGAAGG - Intergenic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
942813576 2:180024874-180024896 AACCAGAGACAGTCAGATAAAGG + Intergenic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
943655206 2:190501348-190501370 ATGAAGACACAGTCAGACACTGG + Exonic
944904440 2:204248656-204248678 CTGAAGAGACAGTCCTATGCTGG - Intergenic
944948579 2:204719352-204719374 ATGAAGAGACAAGCATTTGAAGG - Intronic
945027934 2:205637092-205637114 ATGAGGACACAGTGAGATGGTGG + Intergenic
945212813 2:207401282-207401304 ATCATGAGACAGTTTGATGAGGG + Intergenic
947042293 2:225936962-225936984 ATGAAGAGACAGTAAGTTCAAGG - Intergenic
947071566 2:226293350-226293372 ATAAGGAGACAGCCAGAGGATGG - Intergenic
948219004 2:236254634-236254656 AAGAAGAGAAAGTAAAATGATGG - Intronic
1169304226 20:4474476-4474498 AGGAAGAGAGAGGCATATGATGG - Intergenic
1169484407 20:6014882-6014904 ATGCAGATACAGTCAGAGTATGG + Intronic
1170341623 20:15334552-15334574 ATGAAGAGACAATCAAGTGGGGG + Intronic
1170776425 20:19378751-19378773 ATGAGAAAACAGACAGATGAAGG - Intronic
1172886398 20:38234008-38234030 ATGAAGATACAGGGAGAAGATGG + Intronic
1173553139 20:43947235-43947257 ATGAAGAGACAGAAAGCTCAAGG - Intronic
1173611687 20:44372869-44372891 ATGAAGACACCTTCAAATGAAGG + Intronic
1173881276 20:46414339-46414361 GTGAAGACACAGTGAGAAGATGG - Intronic
1174331445 20:49822277-49822299 GTTAAGAGCCAGTCACATGATGG + Intronic
1175058818 20:56222583-56222605 ATGAGGACACAGTGAGATGGTGG - Intergenic
1176511308 21:7750661-7750683 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1176614470 21:9016614-9016636 TGGAGGAGACAGTCAGAGGAGGG - Intergenic
1176710733 21:10147257-10147279 TGGAGGAGACAGTCAGAGGAGGG + Intergenic
1178039043 21:28619092-28619114 ATGAAGACACAGGGAGAAGACGG + Intergenic
1178550805 21:33537652-33537674 ATGAGGAGACAGTCATAGTAAGG + Intronic
1178645422 21:34381190-34381212 AAGAAGAGGCAGTGAGAGGATGG + Intronic
1179182413 21:39057169-39057191 CTGAAGACTCAGTAAGATGAAGG + Intergenic
1179238612 21:39568824-39568846 AGGAAGAGGCAGTCAGATTCTGG - Intronic
1179367687 21:40773401-40773423 ATGAAGACACAGGGAGAAGAAGG - Intronic
1179399511 21:41070819-41070841 AGGAAGAGACGGTATGATGAGGG + Intergenic
1179653835 21:42832829-42832851 TTGACCAGACAGTCAGAGGAAGG - Intergenic
1180676497 22:17590063-17590085 AAGAAGAGCCAGTGAGCTGATGG - Intronic
1180917105 22:19496990-19497012 ATGCAGAGCCAGGCAAATGATGG + Intronic
1181455631 22:23058771-23058793 ATGAAGGCACAGGCAGAAGAGGG + Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1182100840 22:27656223-27656245 CTAAAGAGACAGGTAGATGAGGG + Intergenic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184117340 22:42429923-42429945 ATGGAGTGACAGATAGATGAAGG + Intronic
1184538928 22:45106990-45107012 ATGAGGACACAGCCAGAAGACGG + Intergenic
1184894142 22:47397303-47397325 ATGGGGAGACCCTCAGATGAAGG - Intergenic
1184926487 22:47643772-47643794 ATGAAGACATTCTCAGATGAAGG + Intergenic
1185257375 22:49842700-49842722 ATGAAGAGACATTTCCATGAAGG + Intergenic
949589907 3:5483182-5483204 ATCAAGAGACAGTAAGAGAAAGG - Intergenic
949848786 3:8399850-8399872 ATGATGTGACGGTCAGAAGAAGG + Intergenic
949891949 3:8739882-8739904 ATGCAGCTACAGTCAGATGGTGG + Intronic
949992105 3:9588103-9588125 ATCAAGTGACCATCAGATGATGG + Intergenic
950133842 3:10566540-10566562 ATAATGAGACAGTCAGATAATGG + Intronic
951221701 3:20075659-20075681 ATACACAGACAGCCAGATGAAGG + Intronic
951850339 3:27132713-27132735 ATGAAGTGACATTTAGAAGAAGG + Intronic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952581622 3:34839873-34839895 ATGAAGAGAAAGTCAGAAAATGG + Intergenic
952625306 3:35395844-35395866 ATGAAGTGACAGTTAGCTCAAGG - Intergenic
952828588 3:37544579-37544601 AAGAAGAGAGATTGAGATGATGG + Intronic
953419702 3:42744951-42744973 ATGAAGACATAGGAAGATGAAGG + Intronic
953859904 3:46534930-46534952 ATGAAGAAACACTCAGCTGCAGG - Intronic
954933250 3:54302759-54302781 AAGAAGAGAGAAACAGATGAAGG - Intronic
955570439 3:60299424-60299446 ATCAAGACACTCTCAGATGAAGG - Intronic
955639353 3:61065877-61065899 ATGGAGATACAGTAAGTTGAAGG - Intronic
955805370 3:62728468-62728490 ATGAAGATATAGTCAGAAAAAGG - Intronic
955874101 3:63472123-63472145 ATGTTCAGAAAGTCAGATGAGGG - Intronic
956047653 3:65213554-65213576 ATGAAGTTACAGTCAGCTGGTGG - Intergenic
956118261 3:65940436-65940458 GTGAAGATACAGTGAGAAGATGG - Intronic
956907300 3:73779964-73779986 ATGATGAAACAGTCAGATCTAGG - Intergenic
957311828 3:78530196-78530218 ATGAAGAGAGAGTGAAAAGAAGG + Intergenic
957358382 3:79120876-79120898 ATAAAGTGACAGTAAGATAATGG + Intronic
958646088 3:96876378-96876400 ATGAAGAGTCAAACTGATGATGG - Intronic
959243773 3:103835936-103835958 ATGAAGAGACACCCATATAATGG + Intergenic
960117422 3:113910645-113910667 ATGAAGAGCAAGTCAGATAGAGG + Intronic
960241720 3:115350361-115350383 TTGTAGAGACTGTAAGATGAGGG + Intergenic
960480919 3:118189181-118189203 ATGAAGAGGGAGTAATATGAAGG + Intergenic
960837661 3:121923905-121923927 AATAAGAGACAGCCAGAGGAAGG - Intronic
961599193 3:128045947-128045969 ATGACGAGCTAGACAGATGAAGG - Intergenic
961950168 3:130741277-130741299 ATGAGGACACAGCCAGAAGATGG + Intronic
962700326 3:137992169-137992191 AGAAAAAGACAGACAGATGAGGG + Intergenic
964190580 3:153995904-153995926 ATGAAGACACAGTGAGAGGGAGG - Intergenic
965833621 3:172826849-172826871 GTGAAGAGACAGTCACAGAATGG + Intergenic
969573040 4:8021340-8021362 ATGAGGTGACAGACAGATGCAGG + Intronic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
970076659 4:12229612-12229634 ATGAAGACACAGCCAGAAGATGG + Intergenic
970374993 4:15448041-15448063 ATGAAGACACAGTGAGAAGATGG + Intergenic
970628405 4:17915133-17915155 ATGAAGGGATAGACAAATGAAGG - Intronic
970675772 4:18448660-18448682 GTGAAGTGACAGTAAGAAGATGG + Intergenic
970720898 4:18987502-18987524 ACAAAGAGACAAGCAGATGAAGG + Intergenic
970725351 4:19037398-19037420 ATTAAGGGACAGTGAGAAGATGG + Intergenic
970783672 4:19770240-19770262 AGGAAGAGACAGTCACACAAAGG - Intergenic
972734057 4:41823059-41823081 ATCAAGGGACTGTCAGTTGAAGG + Intergenic
972866631 4:43241263-43241285 ATGCAGAAGCAGCCAGATGATGG - Intergenic
973152834 4:46909287-46909309 AGGAAGAGGCGGTCACATGAAGG + Intergenic
973729142 4:53806311-53806333 ATGAAGACACAGTGAGAAGGCGG - Intronic
975932710 4:79545129-79545151 ATTAAGATACACTCAGATGAAGG - Intergenic
976620238 4:87119936-87119958 AAGAAAAGACAGTCAGATCTTGG - Intronic
976885800 4:89982508-89982530 ATGAAGCACCATTCAGATGATGG - Intergenic
977441290 4:97071033-97071055 ATGAAGATACAGGGAGAAGATGG + Intergenic
977767542 4:100817562-100817584 TTGAATAGACAGTCTGGTGAAGG + Intronic
977853551 4:101859953-101859975 GTGCAGAAACAGTCAAATGATGG + Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978338737 4:107698561-107698583 ATGGGGAGACAGGCAAATGAAGG + Intronic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980115814 4:128678169-128678191 ATGGAGAGACAGGGAGATGAGGG - Intergenic
980428084 4:132653251-132653273 ATGAAGAGACAACCTGATGAAGG - Intergenic
980773279 4:137406114-137406136 AGGCAGAGACAGGCAGATCATGG - Intergenic
981586993 4:146314332-146314354 TTGGAGAGACAGTCAGATCAAGG + Intronic
981799833 4:148642654-148642676 AGCAAGAGACAGGAAGATGAGGG - Intergenic
982121768 4:152150117-152150139 ATGAAGAGACAACCAGAAGCTGG - Intergenic
982163292 4:152591410-152591432 AAGAAGAGACATTCAGGTGGAGG - Intergenic
983499047 4:168479066-168479088 ATCTAGAGATAGACAGATGATGG + Intronic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
985929511 5:3046072-3046094 ATGAATCTATAGTCAGATGAAGG + Intergenic
985944632 5:3168443-3168465 ATGAAGATACAGCAAGAAGATGG + Intergenic
986552186 5:8969568-8969590 ATGAAGAGACACCCTGTTGAAGG - Intergenic
987225654 5:15838339-15838361 ATGAGGACACAATGAGATGATGG - Intronic
987451804 5:18094234-18094256 ATGAAGATAAAGTCAGGTAATGG + Intergenic
988148652 5:27346519-27346541 TTGAAGAGAGAGTGAGGTGATGG + Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
988351991 5:30120500-30120522 GTGAAGAGACAGTGAGAAGGTGG + Intergenic
988422815 5:31026889-31026911 ATGAAGACACAGGGAGAAGATGG + Intergenic
989764737 5:45068705-45068727 AAGAAGAGTAAGTCAGATGGTGG + Intergenic
989813100 5:45701171-45701193 ATGAAGAGAAATACAGATGTTGG - Intergenic
990373541 5:55145825-55145847 AGGAAGAGAAAGTAAGAGGAAGG - Intronic
990985981 5:61641310-61641332 AAGAAGAGACACTCAAATGTAGG - Intronic
991021790 5:61987032-61987054 GTGAAGACACAGTGAGAAGATGG + Intergenic
992466440 5:77010677-77010699 ATCAAGAAACAATGAGATGATGG - Intergenic
993255077 5:85580549-85580571 GTGAAGACACAGTCAGAAGGAGG - Intergenic
993489368 5:88527609-88527631 ATGAAGTTACAGTCAGATGATGG + Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994851660 5:105062281-105062303 AAGAAGAAACACTTAGATGAAGG + Intergenic
995038513 5:107562337-107562359 ATGGAGAGAGAGACAGACGATGG - Intronic
995773787 5:115702138-115702160 CTTAAGGGACAGTCAGATGATGG + Intergenic
995983003 5:118130761-118130783 ATGAATATGCAGTCATATGAGGG + Intergenic
996058610 5:119008144-119008166 ATGAAGAAACAATGAGAAGATGG - Intergenic
996199953 5:120659776-120659798 AAAAAGAGACAGTCATCTGAGGG + Intronic
996313433 5:122133927-122133949 GAGAAGAAACAGTCATATGAAGG - Intronic
996596826 5:125212897-125212919 ATCAAGAGACTGACATATGAAGG - Intergenic
996650126 5:125865717-125865739 ATTAAGCGATAGACAGATGATGG + Intergenic
997527938 5:134565493-134565515 ATCAAGAGAAAGGCTGATGATGG - Intronic
998019541 5:138757847-138757869 ATGAGGCAACAGTCAGATTATGG + Intronic
998182617 5:139956027-139956049 ATGCTGAGACAGGCAGAGGAAGG + Intronic
999157035 5:149465277-149465299 CTGTAGAGAGAGTCCGATGATGG - Intergenic
999710496 5:154314274-154314296 CTGAAGAGACACTCAGATCTGGG - Intronic
999950279 5:156642083-156642105 GTGAAGATACAGTAAGATGATGG - Intronic
1000358539 5:160424915-160424937 TTGAAGGGAAAGTCAGATGCTGG + Intronic
1001042921 5:168349680-168349702 AAGGAGAGCCAGTCAAATGACGG - Intronic
1002341600 5:178519862-178519884 GTGAATAGATGGTCAGATGATGG + Intronic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1007229470 6:40338298-40338320 AGGAAGAGAGAGACAGAAGAGGG + Intergenic
1007351068 6:41273857-41273879 GTGGGGAGACAGTCAGATCAGGG - Intronic
1008354197 6:50532201-50532223 ATGAAGAGAAAGTCAGGAGGTGG - Intergenic
1009360842 6:62810696-62810718 ATGAAGAAACAGTCAAGGGAAGG + Intergenic
1009477997 6:64118737-64118759 ATGAAGAGACAATCTGTAGAAGG + Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010510655 6:76715070-76715092 ATGAAGAGAAAGGCAGAGAAGGG + Intergenic
1011046584 6:83090379-83090401 ATGAAAAGACAGGCAGTAGACGG - Intronic
1011445527 6:87435145-87435167 ACACAGAGAGAGTCAGATGAGGG + Intronic
1011813036 6:91155062-91155084 ATTAAGATACAGTATGATGAGGG + Intergenic
1011995128 6:93577099-93577121 ATCCAAAGACAGTCAGCTGAAGG - Intergenic
1012599700 6:101079880-101079902 CTGCATAAACAGTCAGATGAGGG - Intergenic
1013258039 6:108408978-108409000 ATGATGATGCAGTCACATGAGGG + Intronic
1013710947 6:112897746-112897768 GTGAAGACACAGTGAGATGATGG - Intergenic
1013799501 6:113925491-113925513 GTGAAGATACAGTGAGAAGATGG - Intergenic
1014141403 6:117947495-117947517 AAGAAGAGACAGTCATAAGTGGG + Intronic
1014689247 6:124542295-124542317 AGGAAGAGAAAGTCTGGTGATGG + Intronic
1014726997 6:124983283-124983305 ATGTAGAGACAATCAGATTCTGG + Intronic
1015510936 6:134037587-134037609 ATGCCGAGACAGGCAGATCACGG - Intronic
1015934592 6:138396027-138396049 ATGAAGAGACACTGAGTTGTGGG - Intergenic
1016980450 6:149848948-149848970 ATGAGGACACAGTGAGAAGATGG + Intronic
1017033078 6:150241310-150241332 ATGAAGAGACACACAGGTCAGGG - Intronic
1017080281 6:150661991-150662013 ATGAGGAGACAGTCAGAATGAGG + Intronic
1017918066 6:158848006-158848028 GTGAAGACACAGGCAGAAGACGG + Intergenic
1019131382 6:169879387-169879409 ATGCAGAAACAGTGAGATGGGGG + Intergenic
1019190485 6:170247955-170247977 ATAATGAGACAGGGAGATGAAGG + Intergenic
1019845310 7:3493298-3493320 CTGAATGGACAGTTAGATGAAGG - Intronic
1019864480 7:3693978-3694000 AGGAAGAGTCAGTCACATGCAGG - Intronic
1019985511 7:4652546-4652568 ATGAAAAGACAGGGAGAAGATGG - Intergenic
1022506425 7:30910936-30910958 AGGCAGAGACAGACAGATGCTGG - Intergenic
1022508805 7:30922494-30922516 GTGAAGAGAGAGTGAGAGGAGGG - Intronic
1022822818 7:33977972-33977994 ATGAAGAAGCAGCCAGTTGAGGG + Intronic
1023175945 7:37435612-37435634 ATGATAAGACAGGCAGATGAGGG - Intronic
1023530875 7:41152690-41152712 ATGAAGACTCAATGAGATGAGGG - Intergenic
1023683005 7:42706909-42706931 ATAAAGAGACAGTCAGATGGGGG - Intergenic
1024103582 7:46058734-46058756 GTGAAGATACAGGCAGAAGATGG + Intergenic
1024218874 7:47272140-47272162 ATAAAGATATTGTCAGATGAAGG - Intergenic
1024391061 7:48812994-48813016 GTGAAGAGACAGTAAGAGGGTGG + Intergenic
1024634262 7:51274398-51274420 TTGATGAGACAAACAGATGAAGG - Intronic
1026290551 7:69002078-69002100 ATGAGGTGACTGTCAGATGATGG + Intergenic
1026574779 7:71563018-71563040 AGGAATAGACAGTGAGAAGAGGG - Intronic
1026772923 7:73213495-73213517 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027013786 7:74766891-74766913 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027074252 7:75179141-75179163 ATGAAGAAAATGTCACATGAAGG + Intergenic
1027657098 7:80944197-80944219 ATAATGAGACAGGCAGAGGAAGG - Intergenic
1028031090 7:85913812-85913834 ATGATGAGAAAGACAGATGTTGG + Intergenic
1028066323 7:86389618-86389640 AGAAAAAGACAGTTAGATGAAGG - Intergenic
1031825834 7:126564109-126564131 AAGAAATGAAAGTCAGATGATGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031916598 7:127568937-127568959 AGGAAGAGAAAATCAGAAGAAGG - Intergenic
1032398044 7:131604854-131604876 GAGAAGAGACAGTCAAAGGATGG + Intergenic
1033946322 7:146723190-146723212 ATGGAGATACAGTGAGAAGATGG + Intronic
1034391759 7:150792670-150792692 ATGCAGTTACAGTCAGATGGGGG - Intronic
1034675838 7:152891912-152891934 ATGAAGACACAGGGAGAAGACGG + Intergenic
1034679807 7:152920028-152920050 ATGAGGAGGGAGGCAGATGAAGG - Intergenic
1035496606 7:159333255-159333277 ATGTAGAGCCAGTGAGCTGAGGG - Intergenic
1036743799 8:11389997-11390019 ATGGAGAGAGAGAGAGATGAAGG + Intergenic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1037513527 8:19607445-19607467 GTGAAGATACAGACAGCTGATGG + Intronic
1038558394 8:28545627-28545649 ATGTAGCTGCAGTCAGATGATGG - Intronic
1038850191 8:31268255-31268277 ACAAAGGGACAGCCAGATGAAGG + Intergenic
1038982310 8:32773383-32773405 ATGCAGAGTCAGTGAGATGAAGG + Intergenic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1040593012 8:48813132-48813154 ATGAAGAGACAATCTGTTGCAGG - Intergenic
1042473167 8:69214177-69214199 ATGAAGACACAGGGAGAAGATGG + Intergenic
1042477221 8:69262105-69262127 ATGAAGTGAGAGTCAAAGGAAGG - Intergenic
1043196208 8:77295534-77295556 ACGAGGAGACAGTCTGATGAAGG - Intergenic
1044066100 8:87702427-87702449 ATGAAGATACAGTAAAATTATGG + Intergenic
1045056544 8:98373057-98373079 AGACAGAGAGAGTCAGATGAGGG + Intergenic
1045911837 8:107419130-107419152 ATTCAGAGACAGGGAGATGATGG + Intronic
1046186096 8:110721545-110721567 ATGAAGATACAGTGAGAAAACGG - Intergenic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047935558 8:129774283-129774305 AAGAAAAGACAGTGAGATAAAGG + Intronic
1048184528 8:132227434-132227456 ATGAAGACACAGTGAGAAGCCGG + Intronic
1048253944 8:132890955-132890977 ATGGGAAGACAGTCAGGTGAAGG + Intronic
1048279798 8:133096720-133096742 ATGATGAGGCAGGGAGATGAAGG + Intronic
1048302813 8:133264156-133264178 ATGAAGGGTCAGTCATCTGAGGG + Intronic
1048495573 8:134933022-134933044 ATGAAGAGACATTCAGGTTAAGG + Intergenic
1048545367 8:135381879-135381901 GTGAAGAGCCAGTGAGAGGAAGG + Intergenic
1049629166 8:143642951-143642973 ATGAAGAGACTTGCAGATGTCGG + Intronic
1049822030 8:144641378-144641400 ATGCAGACGCAGGCAGATGATGG + Intergenic
1050012246 9:1196732-1196754 ATTAAGAGACTGTCACAAGAAGG + Intergenic
1050160700 9:2716379-2716401 ATGAAGAGGTACTGAGATGATGG + Intergenic
1052060753 9:23958421-23958443 CAGAAGAGAGAGTCAGAAGAAGG + Intergenic
1052384454 9:27807460-27807482 AAGAAGATACAGGCAGATGCTGG + Intergenic
1052843655 9:33315448-33315470 ATGTAGAGAAAGGCAGACGAAGG - Intronic
1053282149 9:36827331-36827353 AGGAAGAGACAGTCAGCTTGAGG - Intergenic
1053647716 9:40132953-40132975 TGGAGGAGACAGTCAGAGGAGGG + Intergenic
1053758015 9:41330890-41330912 TGGAGGAGACAGTCAGAGGAGGG - Intergenic
1054536863 9:66243217-66243239 TGGAGGAGACAGTCAGAGGAGGG - Intergenic
1055262138 9:74449476-74449498 ATGAAGACACAGGGAGAAGATGG - Intergenic
1055264777 9:74482060-74482082 AGTAAGACACAGTCAGAAGACGG + Intergenic
1055738237 9:79356277-79356299 ATGAAGTGACAGTGAAAGGAAGG + Intergenic
1055869828 9:80862454-80862476 ATGAAGATACACTCCTATGAAGG - Intergenic
1056604249 9:88072873-88072895 AAGAAGAGAGAGTGAGATGGTGG + Intergenic
1056615002 9:88157828-88157850 ATAAAGACACATTCAGATGAAGG - Intergenic
1056805025 9:89721803-89721825 ATGATAAGCCAGTGAGATGATGG + Intergenic
1056859388 9:90165812-90165834 ATGTAGACACTCTCAGATGAAGG - Intergenic
1057306034 9:93912484-93912506 ATGAGGAGCCAGTGAGCTGATGG - Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059626454 9:116072272-116072294 AAGAGGAGACAGTCAGAGGTGGG + Intergenic
1059636063 9:116171763-116171785 CTGGAGAGGCAGTCAGATGCTGG + Intronic
1060894182 9:127207177-127207199 ATGATGGGACAATGAGATGATGG - Intronic
1062201269 9:135304090-135304112 ATGAATGGATAGACAGATGATGG + Intergenic
1202795493 9_KI270719v1_random:116245-116267 TGGAGGAGACAGTCAGAGGAGGG + Intergenic
1185498559 X:579075-579097 ATGAATAGAGAGATAGATGATGG + Intergenic
1185773885 X:2786827-2786849 ATGAAGACACAGGGAGAAGACGG + Intronic
1186129250 X:6448581-6448603 ATGAAGACACAGGGAGAAGATGG - Intergenic
1187068958 X:15868946-15868968 ATGAAGACACAGTGAGAAGATGG - Intergenic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1187583686 X:20636637-20636659 ATGAAGAGAAAGAGAAATGAGGG - Intergenic
1187866676 X:23729030-23729052 ATGAATTGAAAGTCTGATGAAGG + Intronic
1188112850 X:26212646-26212668 GTGAGGAGACAGTGAGAAGATGG + Intergenic
1190636655 X:52441441-52441463 AAGAAGTGACAGTCATAAGAGGG + Intergenic
1190821824 X:53980411-53980433 ATGAAGAGGCAGCAAGACGAAGG + Intronic
1193988161 X:88272876-88272898 ATGAAGACACAGGGAGAAGATGG - Intergenic
1195406028 X:104514351-104514373 ATGAAGACACAGTGAGAAGGAGG - Intergenic
1196007412 X:110851167-110851189 ATGCAGGGACTGTCAGATGCAGG + Intergenic
1196371847 X:114987837-114987859 ATGAAGAGAAAGGGAGAGGAGGG + Intergenic
1196375763 X:115030907-115030929 ATGACCAGACAGTCATGTGAGGG + Intergenic
1196746915 X:119079438-119079460 ATGAAGAGAAAGACAGAGAAAGG + Exonic
1198183381 X:134231723-134231745 ATGAAGAGAAAGTGATATAAGGG + Intergenic
1200780341 Y:7209961-7209983 ATGAAGTGACAGTGAGATGCTGG + Intergenic
1200931972 Y:8705127-8705149 GTGAAGATACAGTCTGTTGAGGG - Intergenic
1201295812 Y:12462325-12462347 ATGAAGACACAGGGAGAAGACGG - Intergenic
1202267143 Y:23031481-23031503 ATGAAGAGGCAGTCAGGTCTTGG + Intergenic
1202420135 Y:24665225-24665247 ATGAAGAGGCAGTCAGGTCTTGG + Intergenic
1202450651 Y:25004857-25004879 ATGAAGAGGCAGTCAGGTCTTGG - Intergenic