ID: 902615837

View in Genome Browser
Species Human (GRCh38)
Location 1:17623134-17623156
Sequence TGGGATTCCACCGAGAAGAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 98}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902615834_902615837 -6 Left 902615834 1:17623117-17623139 CCTCCCGCGTGGCTGAGTGGGAT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615828_902615837 8 Left 902615828 1:17623103-17623125 CCAGATCGCCCTGTCCTCCCGCG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615830_902615837 0 Left 902615830 1:17623111-17623133 CCCTGTCCTCCCGCGTGGCTGAG 0: 1
1: 0
2: 3
3: 67
4: 1335
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615836_902615837 -10 Left 902615836 1:17623121-17623143 CCGCGTGGCTGAGTGGGATTCCA 0: 1
1: 0
2: 0
3: 8
4: 249
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615826_902615837 20 Left 902615826 1:17623091-17623113 CCACTCCATGTTCCAGATCGCCC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615831_902615837 -1 Left 902615831 1:17623112-17623134 CCTGTCCTCCCGCGTGGCTGAGT 0: 1
1: 0
2: 0
3: 7
4: 96
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615835_902615837 -9 Left 902615835 1:17623120-17623142 CCCGCGTGGCTGAGTGGGATTCC 0: 1
1: 0
2: 1
3: 56
4: 1583
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615827_902615837 15 Left 902615827 1:17623096-17623118 CCATGTTCCAGATCGCCCTGTCC 0: 1
1: 0
2: 1
3: 7
4: 329
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98
902615825_902615837 29 Left 902615825 1:17623082-17623104 CCTGCACTGCCACTCCATGTTCC 0: 1
1: 0
2: 2
3: 28
4: 260
Right 902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG 0: 1
1: 0
2: 0
3: 2
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902615837 Original CRISPR TGGGATTCCACCGAGAAGAT CGG Exonic
902615837 1:17623134-17623156 TGGGATTCCACCGAGAAGATCGG + Exonic
903351724 1:22720900-22720922 TGGGATTGAACTGAAAAGATGGG + Intronic
905788497 1:40776675-40776697 TGGGAGTTCACAGAGATGATGGG - Intergenic
912635635 1:111289939-111289961 TGGGAGTCTACCCAGAAGTTCGG - Intergenic
914509211 1:148316631-148316653 TGATATTCCACTGAGAAGAGAGG - Intergenic
918229378 1:182514317-182514339 TGGGATCCCACTGACGAGATGGG - Intronic
924204485 1:241697792-241697814 TCTGATTCCACAGAGTAGATAGG - Intronic
1065496705 10:26336711-26336733 AGCGATTCCACCGAGTAGCTGGG + Intergenic
1065880825 10:30036512-30036534 TTGGAGGCCACTGAGAAGATGGG - Intronic
1077712800 11:4553168-4553190 TGGGATTCCAATGACGAGATGGG + Intergenic
1084198701 11:67541257-67541279 CGGGATTTCACTGAGATGATGGG - Intergenic
1086425692 11:86680478-86680500 TGGGAGTCCACCTAGCAGAGAGG + Intergenic
1087707573 11:101512089-101512111 TGGGAGTTCACTGTGAAGATGGG - Intronic
1088421310 11:109650549-109650571 GAGAATTCCACCAAGAAGATGGG - Intergenic
1089589291 11:119530294-119530316 TGTGATTTCAAGGAGAAGATAGG - Intergenic
1090184068 11:124724920-124724942 TGGGATTCCAGAGGGAAGACAGG - Intergenic
1095351924 12:41223751-41223773 TGCCATTCCACAGAGAAAATGGG - Intronic
1098757898 12:74388827-74388849 TGGGATCCCAAGGACAAGATTGG - Intergenic
1099274822 12:80561397-80561419 TGGGCTTCAACAGAGAAGGTAGG + Intronic
1110508839 13:76324288-76324310 TGGGATTCCAAGGATAAGAATGG + Intergenic
1111039024 13:82720294-82720316 TGGGTTTCCTCTGAGAGGATTGG - Intergenic
1114484478 14:23054752-23054774 TGGGGGTCCACAGAGAAGAAAGG + Exonic
1120033733 14:79671681-79671703 TGGGAATTCACAGAGAAGAAAGG - Intronic
1121523502 14:94602388-94602410 TGGCCTTCCACAGAGAAGGTGGG + Intronic
1122144972 14:99683791-99683813 TGGGGTTCCAAGGAGAAGTTTGG + Intergenic
1132313629 15:100875502-100875524 TGGGATTCCACTGGCAAGAAAGG + Intergenic
1133804218 16:9111154-9111176 TGGGTTTCCACAGAGAAGAAAGG - Intronic
1135853869 16:25988494-25988516 TGTGTTTTCACCCAGAAGATAGG - Intronic
1137375469 16:47948293-47948315 TGGGATTTCACCCAGAAGCCTGG + Intergenic
1137448403 16:48547617-48547639 TGGGATTCCAGCAAGAGGAAAGG - Intronic
1138153696 16:54683469-54683491 TGGGACTGCACTGAGAAGAAAGG - Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1143476578 17:7206823-7206845 TGACATTTCACCAAGAAGATGGG - Intronic
1146824481 17:36010857-36010879 TGGGATCCCAATGACAAGATGGG + Intergenic
1158884656 18:61815771-61815793 TGAGATCCCAGTGAGAAGATGGG - Exonic
1159832621 18:73295821-73295843 TGGGGTCCCACCATGAAGATCGG - Intergenic
1162412670 19:10515803-10515825 TGGGACTCCACTGAGTAGCTTGG - Intronic
1162564912 19:11440578-11440600 TGGGATTACACCGTGTAGCTGGG + Intronic
1162882470 19:13669991-13670013 TGGTATTCCACCTAGAAGCCTGG + Intergenic
1164564848 19:29318492-29318514 TGGGATTCCAGGGTGCAGATGGG - Intergenic
1166169819 19:41019747-41019769 TGGGATTCCACAGACAAGCTTGG + Intergenic
925021794 2:575447-575469 TGGGCTTCCACTGAGAAGTCTGG + Intergenic
926600173 2:14834293-14834315 TGTGATTCCACAGCAAAGATGGG - Intergenic
932667404 2:73708375-73708397 TGGGCCTCCACCAAGAAGAAGGG + Intergenic
936272714 2:111062251-111062273 TGTCAATCCACCAAGAAGATAGG + Intronic
937102923 2:119285517-119285539 TGGGATACGACAGAGAAAATGGG - Intergenic
938144120 2:128819939-128819961 TGGGATTCCACCAAGATTAGGGG + Intergenic
1170460215 20:16570818-16570840 TAGGATTTCAGGGAGAAGATTGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1178635475 21:34298487-34298509 CTGGATTCCAGCTAGAAGATGGG + Intergenic
1181887194 22:26030673-26030695 TGGGATTCCAGAGAGTTGATGGG + Exonic
949864721 3:8538033-8538055 GGGGATTCCAGCGAGCAGCTAGG - Intronic
950252579 3:11479211-11479233 AGTGATTCCACAGAGAAGACTGG + Intronic
954809970 3:53241652-53241674 TGTGATTCCACCCAGAAGGGGGG + Intronic
957043547 3:75356234-75356256 TGTGATTCCACCTAGATGACAGG + Intergenic
957651645 3:83014085-83014107 TTGGAGTCCACCAATAAGATTGG + Intergenic
958466930 3:94470970-94470992 TGGGATCCCAAAGACAAGATGGG - Intergenic
961583771 3:127904986-127905008 AGGGATTCTACCTAGATGATAGG - Intergenic
962061309 3:131930420-131930442 TGGAAATCCAACTAGAAGATTGG - Intronic
962342119 3:134594481-134594503 GCGGATTCCCCCGAGAAGAACGG + Intergenic
965782004 3:172296036-172296058 TGGGAGTCCACAGAGCAGAAGGG - Intronic
967312862 3:188122328-188122350 TGGGTTTCCACAGGGAAGAGAGG - Intergenic
969329465 4:6465109-6465131 TGGGATTACACAGAAAAGACTGG + Intronic
973550393 4:52029259-52029281 TGGGATGCCACTGACTAGATTGG + Intronic
975386983 4:73769393-73769415 TGGGATCTCACTGACAAGATGGG + Intergenic
986671322 5:10145580-10145602 TGCGAATCCAGCCAGAAGATGGG + Intergenic
989766499 5:45090925-45090947 TGGGATTCCCCAGAGAACAAAGG + Intergenic
992116577 5:73544149-73544171 TGAGATTCCAGGGAGGAGATGGG - Intergenic
1007108342 6:39298396-39298418 TGGGATACCACCTGCAAGATGGG + Intergenic
1012117289 6:95318296-95318318 TGGGAGCCCACAGAGAAGAAGGG + Intergenic
1017990821 6:159488499-159488521 TGGGATTCTCCCGAATAGATTGG + Intergenic
1020982056 7:15082845-15082867 TGGGATTCAACAGAGAGGAGAGG + Intergenic
1021544300 7:21795913-21795935 TAGGTTTTCACCCAGAAGATAGG + Intronic
1032917781 7:136511250-136511272 TGGGATCCCAGTGACAAGATGGG - Intergenic
1034899193 7:154897073-154897095 TGGCATTCCAGGGAGAAAATAGG + Intergenic
1041600595 8:59712759-59712781 TGTCATTCCACTGAGAAGACTGG - Intergenic
1044026649 8:87180926-87180948 TGGGGTTCCACAAAGCAGATGGG + Intronic
1046877544 8:119272613-119272635 TGGGAATCCATTGATAAGATTGG - Intergenic
1052771884 9:32697577-32697599 TGGGATTACACCGGGAAGGGAGG + Intergenic
1055375638 9:75646445-75646467 TGGGATCCCAGTGACAAGATGGG - Intergenic
1061393667 9:130331758-130331780 TGGGATTCCGATGAGGAGATGGG + Intronic
1195275170 X:103274693-103274715 TGGGAGTGCACCTGGAAGATGGG - Intronic
1196311426 X:114171225-114171247 TGGGATTCCTACATGAAGATGGG - Intergenic
1200701166 Y:6403704-6403726 GTGGATTTCACAGAGAAGATAGG + Intergenic
1200708393 Y:6462519-6462541 AGGGATCCCACAGAGAAGACAGG + Intergenic
1200910179 Y:8524900-8524922 TTGGATCCCACAGAGAAGACAGG - Intergenic
1200918638 Y:8593444-8593466 TTGGATCCCACAGAGAAGACAGG - Intergenic
1200928876 Y:8679129-8679151 ATGGATCCCACAGAGAAGATGGG + Intergenic
1200964754 Y:9025862-9025884 TTGCATCCCACAGAGAAGATAGG + Intergenic
1201025719 Y:9702189-9702211 AGGGATCCCACAGAGAAGACAGG - Intergenic
1201032946 Y:9760994-9761016 GTGGATTTCACAGAGAAGATAGG - Intergenic
1202175966 Y:22099158-22099180 GTGGATTTCACAGAGAAGATAGG + Intergenic
1202177536 Y:22111627-22111649 GCGGATTCCACAGAGAAGACAGG + Intergenic
1202178746 Y:22121426-22121448 TTGGATCCCACAGAGAAGACAGG + Intergenic
1202179871 Y:22130539-22130561 ATGGATTCCACAGAGAAGACAGG + Intergenic
1202182378 Y:22150627-22150649 GGGGATCCTACGGAGAAGATAGG + Intergenic
1202208982 Y:22435775-22435797 GGGGATCCTACGGAGAAGATAGG - Intergenic
1202211490 Y:22455855-22455877 ATGGATTCCACAGAGAAGACAGG - Intergenic
1202212615 Y:22464968-22464990 TTGGATCCCACAGAGAAGACAGG - Intergenic
1202213825 Y:22474757-22474779 GCGGATTCCACAGAGAAGACAGG - Intergenic
1202215395 Y:22487226-22487248 GTGGATTTCACAGAGAAGATAGG - Intergenic