ID: 902616107

View in Genome Browser
Species Human (GRCh38)
Location 1:17624391-17624413
Sequence CACATCTAGCACCATGGACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902616107_902616110 29 Left 902616107 1:17624391-17624413 CCAAGTCCATGGTGCTAGATGTG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 902616110 1:17624443-17624465 TGCCATGTCCATCATCAAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902616107 Original CRISPR CACATCTAGCACCATGGACT TGG (reversed) Exonic
902616107 1:17624391-17624413 CACATCTAGCACCATGGACTTGG - Exonic
903219205 1:21859724-21859746 CACATCCAGCCCCATGCACAAGG + Intronic
907586291 1:55620808-55620830 CACAGCTCGCACCATGCACCTGG + Intergenic
907848569 1:58232295-58232317 CACTTCTAGCTCCATGGCATGGG - Intronic
907871802 1:58450305-58450327 GAAATCTAGAACCATGCACTGGG + Intronic
908325386 1:63018403-63018425 CACATCTGGCCCCAAGGATTTGG - Intergenic
909675617 1:78236165-78236187 CACCACTACCACCATAGACTTGG - Intergenic
911459220 1:98168557-98168579 CATATCTACCAACATGGACATGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
915971794 1:160360391-160360413 CACAGCTGCCACCATCGACTGGG + Intergenic
917004020 1:170391824-170391846 CTCATCTATCACCAAGGAGTTGG - Intergenic
918281428 1:183010164-183010186 CACATCAAGTACCATAGACTGGG + Intergenic
919097492 1:193055414-193055436 CACCTCCAGCCTCATGGACTTGG + Intronic
919129202 1:193432739-193432761 CACAGCTAGCACCATGCACCTGG - Intergenic
919214736 1:194537441-194537463 CACATCTAGCACCAAGACTTTGG - Intergenic
919337449 1:196255492-196255514 CACATCTAGCTCCAAGGGATTGG - Intronic
919630049 1:199951581-199951603 CACCTGTAGCACCATCTACTTGG + Intergenic
919880084 1:201895407-201895429 CACAGCCAGCACCAGGGCCTAGG + Intergenic
920492944 1:206432162-206432184 CACAGCTAACACCCTGGTCTAGG - Intronic
921170757 1:212546574-212546596 CACATCTAACACAAAGGAATCGG + Intergenic
1065825199 10:29564361-29564383 CACATCAAAGACCATGGAGTTGG - Intronic
1066514408 10:36140991-36141013 CCCATCTAGCTCCTTGGACTAGG - Intergenic
1068972464 10:62974283-62974305 AACAGCTTGCACCATGCACTTGG - Intergenic
1069077320 10:64051995-64052017 CACAGCTTGCACCATGCACCTGG - Intergenic
1069805234 10:71118226-71118248 GACAGCTTGCACCATGCACTTGG + Intergenic
1069815005 10:71188234-71188256 CACAGCTACCACTCTGGACTTGG - Intergenic
1073926154 10:108518979-108519001 CACAGCTTGCACCATGCACCTGG + Intergenic
1075727771 10:124619273-124619295 CACAGCTGGCACCAGGCACTTGG + Exonic
1076052203 10:127344564-127344586 CTCAGCTAGCAGCATGGAGTTGG - Intronic
1079952636 11:26823716-26823738 AACAGCTTGCACCATGCACTTGG - Intergenic
1080817478 11:35772399-35772421 GACAGCTTGCACCATGCACTTGG + Intronic
1085718115 11:78890659-78890681 CACAGCTTTCACCTTGGACTTGG - Intronic
1089050856 11:115544590-115544612 CTTATCTAACACAATGGACTGGG - Intergenic
1089932611 11:122329228-122329250 CACAACAAACACCATAGACTGGG - Intergenic
1094549064 12:31433104-31433126 CACAGCAAGCGCCATGAACTAGG - Intronic
1100771130 12:97923749-97923771 CACATCTAGCACCCAAGGCTAGG + Intergenic
1102528713 12:113530585-113530607 GACAGCTTGCACCATGCACTTGG + Intergenic
1102816219 12:115868535-115868557 CACCTCCAGGACCAGGGACTGGG - Intergenic
1103042002 12:117703441-117703463 AACATCTAGCACCAGGGCCAGGG - Intronic
1104115984 12:125749290-125749312 AACAGCTTGCACCATGCACTTGG + Intergenic
1104386815 12:128357877-128357899 CACATCCCCAACCATGGACTGGG + Intronic
1106484032 13:30156983-30157005 CACCTCTGGGACCATGGACTGGG - Intergenic
1106695025 13:32163747-32163769 CACGCCTGGCACCATGGTCTGGG - Intronic
1106783313 13:33081889-33081911 CACATCTGTCTCCATTGACTGGG - Intergenic
1111889109 13:94059657-94059679 CAAATCTAGCACCTTGATCTTGG - Intronic
1112882395 13:104123567-104123589 CACAGCTTGCACCATGCACCTGG + Intergenic
1114973673 14:28066975-28066997 AACAGCTTGCACCATGGACCTGG + Intergenic
1115644545 14:35359293-35359315 CACATCTAGCACCCAGATCTTGG + Intergenic
1116991366 14:51280380-51280402 CACATCTAGCTCTATGATCTTGG - Intergenic
1117414552 14:55481696-55481718 CACATCTAGCACCCAGATCTTGG + Intergenic
1118400089 14:65371823-65371845 CACATCTAGCACCCAGATCTCGG - Intergenic
1119786337 14:77317076-77317098 AACATCTACCATCATGGGCTAGG + Intronic
1120686728 14:87546528-87546550 CACATCTTGCCCCATGGGGTGGG + Intergenic
1122586149 14:102807896-102807918 GAAAACTAGCACCATGGCCTTGG + Intronic
1124473249 15:30007513-30007535 TCGCTCTAGCACCATGGACTTGG + Intergenic
1125820046 15:42621837-42621859 CACATCTAGCACCCAGAACTTGG - Intronic
1126693245 15:51304246-51304268 CAAATTTAGCACCAGGGAGTGGG - Intronic
1127422736 15:58823537-58823559 CACCTCTAGCTCCACGTACTTGG + Intronic
1128278223 15:66372264-66372286 AACTTCTACCACCATAGACTAGG + Intronic
1131879255 15:96845155-96845177 CACATCTGGCACCATTGAGTAGG + Intergenic
1132547692 16:540810-540832 CACAGCTGTCACCATGGCCTTGG + Intronic
1132811249 16:1798898-1798920 AACAGCTTGCACCATGGACCTGG + Intronic
1132869070 16:2107563-2107585 CACATCCAGCAACAGGGACATGG + Intronic
1133346926 16:5077527-5077549 CACATCAGGTACCATGGCCTGGG + Exonic
1133424759 16:5678553-5678575 ACCATCCAGCACCATGGACAAGG - Intergenic
1134075628 16:11289379-11289401 CACATCTTGCACCCTGATCTTGG - Intronic
1134448165 16:14346308-14346330 CATATGTAGCACAAGGGACTTGG + Intergenic
1134454535 16:14384954-14384976 CACATCTAACACCCAGGTCTGGG + Intergenic
1134550124 16:15134960-15134982 CACATCCAGCAACAGGGACATGG + Intronic
1134718345 16:16368035-16368057 CACATCCAGCAACAGGGACATGG - Intergenic
1134956407 16:18384124-18384146 CACATCCAGCAACAGGGACATGG + Intergenic
1135303553 16:21350548-21350570 CACGTGGAGCACCAGGGACTTGG + Intergenic
1135636044 16:24076567-24076589 CACGTCTAGCTGCATGGTCTGGG + Intronic
1139364277 16:66424191-66424213 CTCTTCTAGGACCCTGGACTAGG - Intergenic
1142062028 16:88036506-88036528 CACGTGGAGCACCAGGGACTCGG + Intronic
1143245099 17:5477912-5477934 CACATCTAGCACCCAGATCTTGG + Intronic
1144470658 17:15538197-15538219 CACTTCACACACCATGGACTTGG + Intronic
1144925685 17:18805473-18805495 CACTTCACACACCATGGACTTGG - Intronic
1147855556 17:43477018-43477040 CAAGTCTATCCCCATGGACTTGG - Intergenic
1148032388 17:44630186-44630208 CATATGTAGCACCAGGGGCTGGG + Intergenic
1149641267 17:58204447-58204469 CACCTCCAGCACCCTGGGCTGGG + Intronic
1150156893 17:62861318-62861340 CAAATCTACCTCCAGGGACTGGG + Intergenic
1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG + Intergenic
1150530445 17:65976070-65976092 CACACTAATCACCATGGACTCGG + Intronic
1151376886 17:73695345-73695367 CTCAGCTGGCACCAGGGACTGGG - Intergenic
1156295331 18:35784192-35784214 CACAGCCAGCACCATGGTGTTGG - Intergenic
1156757475 18:40545988-40546010 CAGCTTTAGCATCATGGACTTGG - Intergenic
1159761258 18:72429811-72429833 GACATCTTGCACCATGCACCTGG - Intergenic
1160066173 18:75576227-75576249 TACATCCAGCAGCATGGAATAGG - Intergenic
1160082478 18:75742152-75742174 GACATCTGGCACCTTGGTCTTGG - Intergenic
1162296192 19:9815401-9815423 CACAGCTTGCACCATGCACCTGG - Intronic
1162496064 19:11024004-11024026 CACAGCAAGACCCATGGACTCGG + Intronic
1165413324 19:35675854-35675876 CACATCTGGTCCCATGGACTGGG + Exonic
1166459527 19:42973857-42973879 CACCTCTATCACCTTGGGCTTGG - Intronic
1166476845 19:43133902-43133924 CACCTCTATCACCTTGGGCTTGG - Intronic
1168452003 19:56474047-56474069 CTCATCTATCATCAGGGACTCGG - Exonic
926067826 2:9858419-9858441 GACATCTTGCACCATGCACTTGG - Intronic
929509299 2:42554343-42554365 TACATCGAGCACCATAGTCTAGG - Intronic
932926286 2:75978808-75978830 CACATCAAGTAACATGGAATAGG - Intergenic
936014471 2:108947333-108947355 GACAGCTTGCACCATGCACTTGG - Intronic
937244723 2:120485254-120485276 CACAGCTGGCAGCAGGGACTCGG + Intergenic
937614848 2:123909559-123909581 CACCTCTCCCACCAGGGACTAGG + Intergenic
941863510 2:170309641-170309663 CAGAACTAGCACCATGGAGCAGG - Intronic
943343453 2:186709166-186709188 CTCATGTAGCACCATGCCCTGGG - Intronic
944371151 2:198985309-198985331 AACAGCTTGCACCATGGACCTGG - Intergenic
944482172 2:200168927-200168949 CACATATGGCAGCAAGGACTGGG + Intergenic
946314488 2:218901032-218901054 CACATCTAGCACCCAGATCTTGG - Intergenic
1174783417 20:53411202-53411224 TACAGCTAGGACCATGGCCTTGG + Intronic
1176591323 21:8652668-8652690 CACAGCTAGAATCATGGAATGGG - Intergenic
1176690119 21:9896502-9896524 CACATCTTGCAACATGAAGTGGG + Intergenic
1177354453 21:19989407-19989429 TATAACTAGCACCATGGTCTTGG - Intergenic
1179624239 21:42639428-42639450 CACACCTAGCACCCAGGCCTTGG + Intergenic
1180274172 22:10629779-10629801 CACAGCTAGAATCATGGAATGGG - Intergenic
1181686971 22:24535999-24536021 CACATCCACCACCATGGACTGGG - Intergenic
1184222114 22:43107709-43107731 CACCTCTAGCGCCATAGATTAGG + Intergenic
950034310 3:9873949-9873971 CATATCTAGCTCCCTGGTCTCGG + Intronic
951196611 3:19830704-19830726 CAGATATGGCATCATGGACTAGG + Intergenic
951537856 3:23755934-23755956 CACAGCAAGCAACATGGATTTGG - Intergenic
952208905 3:31209419-31209441 CACATTTAGCTGCATGGACATGG - Intergenic
954274578 3:49533908-49533930 CAAACCCAGCACCAGGGACTTGG - Exonic
955200525 3:56848021-56848043 TACAATAAGCACCATGGACTCGG + Intronic
956258211 3:67307372-67307394 CACATCTATCAGTATGAACTGGG + Intergenic
957627922 3:82678752-82678774 CACAACTAGCACAATGGCCCTGG - Intergenic
958026704 3:88058569-88058591 CACAGCTGGCACCTGGGACTCGG - Intronic
958474965 3:94569059-94569081 AACAGCTTGCACCATGCACTTGG + Intergenic
959873972 3:111360321-111360343 AACAGCTTGCACCATGCACTTGG + Intronic
959963686 3:112331432-112331454 TACTTCTAACACCATAGACTAGG - Intergenic
960255412 3:115506114-115506136 GACAGCTAGCACCATGCACCTGG + Intergenic
961503772 3:127356603-127356625 AACAGCTTGCACCATGAACTTGG - Intergenic
963386181 3:144598051-144598073 AACATCTTGCACCATGCACCTGG - Intergenic
964545387 3:157828453-157828475 GACAGCTTGCACCATGCACTTGG - Intergenic
964853416 3:161119315-161119337 AACATCTTGCACTATGCACTTGG + Intronic
971987655 4:33847029-33847051 GACATCTAGCAACATGTACTGGG + Intergenic
973687470 4:53387200-53387222 CACCTGTAGTCCCATGGACTTGG + Intronic
973808807 4:54550464-54550486 CACAGCTGGCCCCATGGACAGGG + Intergenic
974430559 4:61791536-61791558 GACATCTTGCACCATGCACCTGG - Intronic
975561854 4:75716043-75716065 CACATCTAGGACTAGGGTCTAGG + Intronic
983469275 4:168136707-168136729 GACATCTTGCACCATGCACCTGG - Intronic
983996616 4:174190147-174190169 CACATCCACCACCAGAGACTGGG - Intergenic
984525257 4:180850439-180850461 CCCATGTTGCACCATTGACTGGG - Intergenic
984780393 4:183520422-183520444 CATATCCAGCACTATGGTCTTGG + Intergenic
985927695 5:3030564-3030586 CACGACTAGCACCATCGTCTTGG - Intergenic
986503220 5:8423401-8423423 CACATCTAGCACCCAGATCTTGG + Intergenic
986940038 5:12937975-12937997 CTCCTACAGCACCATGGACTAGG + Intergenic
988149188 5:27353876-27353898 CAAATCTAGCACCTTGTTCTGGG + Intergenic
989399369 5:40992736-40992758 AACATCTTGCACCATGCACCTGG - Intergenic
993353645 5:86880282-86880304 CACAGCCACCATCATGGACTGGG - Intergenic
995858934 5:116621729-116621751 CTCATCTAGCTCCAGAGACTTGG + Intergenic
999196900 5:149787730-149787752 CACATGTAGGGACATGGACTGGG + Intronic
1004799260 6:19128149-19128171 CACACCTAGCACCAAGATCTTGG + Intergenic
1008366802 6:50690622-50690644 CACCTCTAGCCCCAGGTACTTGG + Intergenic
1008648396 6:53539624-53539646 CACTTATAGAGCCATGGACTTGG - Intronic
1009344358 6:62595480-62595502 GACAGCTTGCACCATGCACTGGG + Intergenic
1013404651 6:109831972-109831994 CACAGCTTGCACCATGCACCTGG + Intergenic
1017554715 6:155550720-155550742 TACATCTAGCCCCATCCACTGGG - Intergenic
1017773691 6:157663272-157663294 CACATCTAGGACCAGAGAGTGGG + Intronic
1021404238 7:20245720-20245742 GAAAGCTATCACCATGGACTGGG + Intergenic
1028278869 7:88895547-88895569 CACATCCAGCACCAAGATCTTGG + Intronic
1028867000 7:95725052-95725074 TACATCCAGACCCATGGACTGGG - Intergenic
1030108450 7:106006758-106006780 GACAGCTAGCACCATGCACCTGG - Intronic
1033254890 7:139791720-139791742 CACATCTATTACCACGGATTTGG + Intronic
1034364761 7:150536563-150536585 CACATCTGGAACCATGGAGATGG - Intergenic
1034573094 7:151972980-151973002 AACAGCTTGCACCATGCACTTGG + Intronic
1036638507 8:10567526-10567548 CACTTCTCCCATCATGGACTCGG + Intergenic
1039590072 8:38738797-38738819 CACATCTAGCACCAAGATTTTGG - Intronic
1042156327 8:65848153-65848175 GACATTTAGCCCCCTGGACTGGG - Intergenic
1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG + Intergenic
1047767109 8:127999010-127999032 CACATCTAGCACCCAGATCTTGG - Intergenic
1048030115 8:130623221-130623243 CACATCTAGCACCTAGATCTTGG - Intergenic
1048350428 8:133611525-133611547 CACATTTATGACCATGGACTAGG + Intergenic
1048882878 8:138884710-138884732 CACCACTAGCACCCTGGACCAGG + Intronic
1053495961 9:38548192-38548214 CACAGCTGCCCCCATGGACTGGG + Intronic
1053779144 9:41584973-41584995 CACATCTTGCAACATGAAATGGG - Intergenic
1053826741 9:42032791-42032813 CTCATCTGGCACCCTGGTCTTGG - Intronic
1054167103 9:61795214-61795236 CACATCTTGCAACATGAAATGGG - Intergenic
1054217041 9:62369656-62369678 CACATCTTGCAACATGAAGTGGG - Intergenic
1054603817 9:67154632-67154654 CTCATCTGGCACCCTGGTCTTGG + Intergenic
1054670444 9:67785684-67785706 CACATCTTGCAACATGAAATGGG + Intergenic
1056236375 9:84598785-84598807 CACTTGTAGCACCAAGGACAAGG - Intergenic
1056499797 9:87197565-87197587 CTCATCTAGCAGCCTAGACTTGG - Intergenic
1058241384 9:102565705-102565727 CACGTGTAGTCCCATGGACTTGG - Intergenic
1058930481 9:109714344-109714366 CACAACTATTGCCATGGACTGGG + Intronic
1061752962 9:132793309-132793331 CCCATCTAACACCATTGTCTTGG + Intronic
1186186897 X:7029510-7029532 CACCTCTATCACCTTGGACTTGG - Intergenic
1187771272 X:22699596-22699618 CAATTCTATTACCATGGACTTGG + Intergenic
1189314436 X:40044247-40044269 CACATCTAGCACTAAGTTCTTGG - Intergenic
1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG + Intergenic
1191621413 X:63219392-63219414 CACATCTAGCACAAAGATCTTGG - Intergenic
1191742299 X:64448916-64448938 CACAGCTTGCACCATGCACCTGG - Intergenic
1191756063 X:64593882-64593904 CTCTTCCAGCACCATGGTCTGGG - Intergenic
1192070300 X:67932416-67932438 CACATCTAGTATCATTGAATGGG + Intergenic
1192335662 X:70217221-70217243 CACAGCTTGCACCATGTACCTGG + Intergenic
1192364849 X:70462962-70462984 TAAATCTAGCACCATGTCCTTGG - Intronic
1192932790 X:75825665-75825687 GACAGCTTGCACCATGCACTTGG - Intergenic
1193421788 X:81292020-81292042 CACAGCTTGCACCGTGGACCTGG - Intronic
1193610435 X:83625227-83625249 CACAGCTAGTACCATGAACGGGG - Intergenic
1194389659 X:93300319-93300341 GACAGCTTGCACCATGGACCTGG + Intergenic
1194484836 X:94473721-94473743 TACAGCTTGCACCATGCACTTGG + Intergenic
1196173689 X:112617208-112617230 GACATCTTGCACCATGCACCTGG + Intergenic
1197075007 X:122343339-122343361 AACAGCTTGCACCATGCACTTGG - Intergenic
1198262293 X:134975589-134975611 CACATCTGGTATCAGGGACTGGG + Intergenic
1199101158 X:143801929-143801951 CACATCAAACACCATTGGCTTGG - Intergenic
1199310008 X:146311232-146311254 GACAGCTTGCACCATGGACCTGG - Intergenic