ID: 902616380

View in Genome Browser
Species Human (GRCh38)
Location 1:17625746-17625768
Sequence GAGGGTGCGCGGCCATGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902616371_902616380 27 Left 902616371 1:17625696-17625718 CCAGTTATGCCTTTAGTTCAGAG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 902616380 1:17625746-17625768 GAGGGTGCGCGGCCATGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 195
902616370_902616380 28 Left 902616370 1:17625695-17625717 CCCAGTTATGCCTTTAGTTCAGA 0: 1
1: 0
2: 1
3: 9
4: 199
Right 902616380 1:17625746-17625768 GAGGGTGCGCGGCCATGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 195
902616373_902616380 3 Left 902616373 1:17625720-17625742 CCTTAAGATGACTGCTTTAGTCT 0: 1
1: 0
2: 1
3: 6
4: 138
Right 902616380 1:17625746-17625768 GAGGGTGCGCGGCCATGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 195
902616372_902616380 18 Left 902616372 1:17625705-17625727 CCTTTAGTTCAGAGACCTTAAGA 0: 1
1: 0
2: 0
3: 11
4: 154
Right 902616380 1:17625746-17625768 GAGGGTGCGCGGCCATGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902616380 Original CRISPR GAGGGTGCGCGGCCATGCAG GGG Intronic