ID: 902618464

View in Genome Browser
Species Human (GRCh38)
Location 1:17636822-17636844
Sequence CTGAGGTCTTATGAAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902618464_902618469 25 Left 902618464 1:17636822-17636844 CCTGGGGCTTCATAAGACCTCAG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 902618469 1:17636870-17636892 ACAGTCCAAATTCCTAGCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 148
902618464_902618470 26 Left 902618464 1:17636822-17636844 CCTGGGGCTTCATAAGACCTCAG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 902618470 1:17636871-17636893 CAGTCCAAATTCCTAGCCCAGGG 0: 1
1: 0
2: 2
3: 15
4: 137
902618464_902618471 27 Left 902618464 1:17636822-17636844 CCTGGGGCTTCATAAGACCTCAG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 902618471 1:17636872-17636894 AGTCCAAATTCCTAGCCCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 136
902618464_902618465 -8 Left 902618464 1:17636822-17636844 CCTGGGGCTTCATAAGACCTCAG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 902618465 1:17636837-17636859 GACCTCAGTGTGCAAAACCACGG 0: 1
1: 0
2: 1
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902618464 Original CRISPR CTGAGGTCTTATGAAGCCCC AGG (reversed) Intronic
901126357 1:6931459-6931481 CCGAGGGCTTAGGAAGCGCCAGG + Intronic
902618464 1:17636822-17636844 CTGAGGTCTTATGAAGCCCCAGG - Intronic
902924451 1:19686872-19686894 CTGAGTTCCTATGAAGTGCCAGG - Intronic
903944035 1:26950681-26950703 CTGAGGCCTTATGGAGCTCCAGG - Exonic
906949552 1:50323347-50323369 CTGAAGTCTCTAGAAGCCCCTGG + Intergenic
910069944 1:83200895-83200917 CTGAGCTCATAAAAAGCCCCAGG + Intergenic
911776199 1:101815873-101815895 CTGAGGCAATATGTAGCCCCTGG - Intronic
916732227 1:167576523-167576545 CTGATGGCTAATGAAGCCACAGG - Intergenic
916736294 1:167609703-167609725 CTGAGGTCCTTTGAGGCACCAGG + Intergenic
921264603 1:213411831-213411853 CTTAGGTCTAATGCAGTCCCTGG - Intergenic
923686077 1:236154657-236154679 CTGAGGTTTTAGGATGCCCTGGG - Intronic
1070554293 10:77516110-77516132 CTGTGATCCTCTGAAGCCCCTGG - Intronic
1070650859 10:78235198-78235220 CTGAGCACCTATCAAGCCCCAGG + Intergenic
1072212371 10:93258223-93258245 CTGAGATCTTAAGCAGCCTCTGG + Intergenic
1072453502 10:95557757-95557779 CTGAGCTCTTCTGCAGCCCTTGG - Intronic
1075562783 10:123480568-123480590 CTGAGGATCTATGAAGCACCAGG + Intergenic
1076015195 10:127022080-127022102 CTGAGAACATAGGAAGCCCCTGG - Intronic
1076624803 10:131815207-131815229 CTGAGGTGTCAGGAGGCCCCGGG - Intergenic
1077396705 11:2327383-2327405 CCGAGGTCTCATGGAGGCCCTGG + Intergenic
1078067597 11:8088627-8088649 CTGAGCTCTGGGGAAGCCCCAGG - Intronic
1081380844 11:42412810-42412832 CTGAGGTCTTATTTATGCCCTGG + Intergenic
1082300189 11:50495343-50495365 CTGAGGTTTTATGTCGCCTCAGG - Intergenic
1082933909 11:58637186-58637208 AAGAGGTCTTATGAAGCCTCAGG - Intergenic
1085013059 11:73154663-73154685 CTGAGGGCTTATGATTCTCCAGG - Intergenic
1089472792 11:118734304-118734326 CTGAGGCATTAAGAAGCCACTGG + Intergenic
1090858366 11:130631435-130631457 CTGAGTTCTTATGATGTCGCTGG + Intergenic
1094766080 12:33596174-33596196 CTGAGATCTCATCAAGCCCTAGG - Intergenic
1096801246 12:54112103-54112125 CTGAGATCTTATTAGGCACCAGG + Intergenic
1102944983 12:116978906-116978928 CTGAGCTCTTATGACTCCACCGG + Intronic
1102999505 12:117374689-117374711 CTGAGGTCTCAGGAAACCACAGG + Intronic
1104276541 12:127333696-127333718 CTGAGGTCTCATTCAGCACCAGG - Intergenic
1107054251 13:36086312-36086334 CTGAGGTGTTCTGGAGCCCAGGG - Intronic
1107326881 13:39253777-39253799 CGGTTGTCTCATGAAGCCCCAGG + Intergenic
1111973916 13:94945900-94945922 CTGATGTCTTAGGAAGCAGCAGG - Intergenic
1113910606 13:113839573-113839595 CTGAGGTATCCTGGAGCCCCAGG - Intronic
1114398547 14:22388474-22388496 TGAAGGCCTTATGAAGCCCCTGG - Intergenic
1116596554 14:46855614-46855636 CTGACTTCTTCTGAAGCTCCAGG - Intronic
1117111185 14:52456739-52456761 CTGAGGTTTTATTTACCCCCTGG - Intronic
1118860444 14:69658872-69658894 CTGAGGTCTAATGAGTCACCTGG + Intronic
1119892726 14:78195000-78195022 CAGAGGTGTTAAGAAGCCCTTGG + Intergenic
1121107587 14:91291289-91291311 CTGAGATTTACTGAAGCCCCTGG + Intronic
1121338159 14:93089687-93089709 CTGGGGTCCTCTGAGGCCCCAGG - Intronic
1121508424 14:94493925-94493947 CTGAGGCCCTCTGCAGCCCCTGG - Intronic
1122791892 14:104187502-104187524 CTGAGGTGAGATGAGGCCCCTGG + Intergenic
1124864863 15:33479390-33479412 CTGAGATCTTATGAAAGACCAGG + Intronic
1125769439 15:42155456-42155478 CTGAGCTCTGAGGAAGCCGCAGG + Intronic
1125833581 15:42732505-42732527 CTGAGGTCTGCTCAAGTCCCTGG - Intronic
1127500501 15:59549969-59549991 CTGAGGGATTGTGAAGCCCTAGG + Intergenic
1127799622 15:62466566-62466588 TAGAGGACTTATGATGCCCCTGG + Intronic
1129568039 15:76645492-76645514 CTGAGCTCTTATTATGCCTCAGG - Intronic
1130033885 15:80340925-80340947 GTGAGGGGTTGTGAAGCCCCAGG + Intergenic
1130554353 15:84912438-84912460 CTGAGGGCTGAAGAAGCCCTAGG - Intronic
1131340763 15:91598645-91598667 CTGGAGTCTTAGGTAGCCCCAGG - Intergenic
1132070164 15:98769452-98769474 CTGAGGCCTTAGAAGGCCCCTGG - Intronic
1132676532 16:1123498-1123520 TTGTGGTCTTCGGAAGCCCCTGG + Intergenic
1134216655 16:12321702-12321724 CCCAGGTCTTATGAGGGCCCCGG + Intronic
1134845034 16:17433028-17433050 CTTAGGTCTTTGGAAGCTCCTGG - Intronic
1135304457 16:21356271-21356293 GTGAGGTCGGATGGAGCCCCCGG + Intergenic
1137012134 16:35332092-35332114 CTGGGGTCTTATTCATCCCCAGG + Intergenic
1137750452 16:50857774-50857796 CTGAGTTCTTACCAAGTCCCAGG + Intergenic
1140955525 16:79861479-79861501 CTGCGCTCTTCTGCAGCCCCTGG - Intergenic
1145824948 17:27869885-27869907 CTGAGGCCATAAAAAGCCCCAGG + Intronic
1145879700 17:28344269-28344291 CGGAGGCCTTATGGAGCCTCAGG + Intronic
1146673326 17:34756781-34756803 CTGTGTTCTTATTAAGCACCAGG + Intergenic
1148861774 17:50608241-50608263 CTGAGGTCCTGGGAGGCCCCAGG - Intronic
1151667370 17:75553050-75553072 CTGAGGTCTGGTGGGGCCCCTGG + Intronic
1152887607 17:82861517-82861539 CTCAGGTCTCTTGACGCCCCTGG - Intronic
1154501945 18:15001567-15001589 CTAAGGCCTTCTGAAGCCCACGG + Intergenic
1155197734 18:23490527-23490549 CTGAGGTTCTATGATGCCTCAGG - Intergenic
1158232138 18:55268926-55268948 CTGAGGTTTTAATAAGACCCTGG + Intronic
1160512364 18:79459671-79459693 CTGTGGTCCTCTGAAGCTCCCGG - Intronic
1161136171 19:2621103-2621125 CTCAGGTCTCAGGAAGCTCCTGG - Intronic
1161734006 19:5979098-5979120 CTGCATTCTTTTGAAGCCCCAGG + Intergenic
1163208338 19:15820953-15820975 CTGAGCTCTTATGTAGCTGCAGG + Intergenic
1163239387 19:16050841-16050863 CTGTGGTCAGATGAAGCCCTCGG + Intergenic
1163949007 19:20566962-20566984 GAGAGGTCTTATGAAGCTTCAGG - Intronic
1164919423 19:32077677-32077699 CTGAGGTCCTTTTCAGCCCCAGG - Intergenic
1165956404 19:39504352-39504374 CTGGTGTCTCATGGAGCCCCAGG - Intronic
1167300212 19:48673540-48673562 CTGAGGTCTTTTGAATTCCAGGG - Intergenic
1167437189 19:49486335-49486357 CTGAGGTCCCCTGGAGCCCCGGG + Intergenic
926088211 2:10033246-10033268 CGGAGGCCTCAGGAAGCCCCTGG + Intergenic
927904255 2:26846298-26846320 CTGAGGACATATGCAACCCCCGG + Intergenic
932095695 2:68846405-68846427 CTAAGCTCTTACGAAGTCCCAGG - Intergenic
933739724 2:85524009-85524031 CTGAGGGCTTCTAAAGGCCCTGG + Intergenic
934526647 2:95056241-95056263 TTGAGGTCATATCAAGCCCAGGG - Intergenic
937106933 2:119324657-119324679 CTGAGGTCTCAAGAAGTGCCTGG + Intronic
937531837 2:122838181-122838203 CTGAGGTCTTGTGAACTCCTTGG + Intergenic
937910123 2:127071508-127071530 CTGCTGTCTCAGGAAGCCCCTGG - Intronic
941428527 2:165382718-165382740 CTGAAGTCATATGAAGGCACTGG + Intronic
944242892 2:197502384-197502406 CTGAGATCTTTAGAAGCCCGAGG - Intronic
1169642189 20:7765364-7765386 CTGAGGTCTTATACTTCCCCAGG - Intergenic
1169803276 20:9533168-9533190 TTGAGGACTCATGAAGCACCTGG + Intergenic
1170626717 20:18035662-18035684 CTGATGTGTCAGGAAGCCCCCGG + Intronic
1170766214 20:19291755-19291777 CTGAGGTCTCCTGCAGGCCCAGG - Intronic
1170808883 20:19658140-19658162 CTGAGGTCTGAAGAACCCCTTGG - Intronic
1171795436 20:29562360-29562382 CTGAGATCTTATTAGGCGCCAGG - Intergenic
1171853014 20:30321903-30321925 CTGAGATCTTATTAGGCGCCAGG + Intergenic
1173940783 20:46909380-46909402 CTCAGGTCTTAAAAAGCTCCTGG - Intronic
1176045125 20:63088561-63088583 CTGGGGTCTCAGGCAGCCCCCGG + Intergenic
1178287417 21:31337237-31337259 CTGAGGTCTTATCTTGCCCTGGG - Intronic
1179180296 21:39038953-39038975 CCGAGGTCTCAGGCAGCCCCCGG + Intergenic
1180038994 21:45266136-45266158 CTGAGGTCTGGAGAAACCCCTGG - Intronic
1180178922 21:46109323-46109345 CTGAGGCCTTTAAAAGCCCCAGG - Intronic
1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG + Intronic
951577607 3:24129858-24129880 TTTAGATCTTGTGAAGCCCCTGG + Intronic
952916366 3:38247533-38247555 CTGAGGTCATACTAATCCCCAGG - Intronic
954992105 3:54850373-54850395 TTGAGTTGTTATGATGCCCCTGG + Intronic
955408325 3:58639808-58639830 GTGGGGTCTTATGAAGCCCTGGG + Intronic
960550104 3:118966369-118966391 CTGAGGTGTTAAAAGGCCCCTGG + Intronic
960971464 3:123142923-123142945 AGGAGGTCTTCTCAAGCCCCTGG + Intronic
963846466 3:150163732-150163754 CAGAGCTTTTATCAAGCCCCAGG + Intergenic
966650089 3:182290922-182290944 ATGAGGTCTTAGGAGGGCCCAGG + Intergenic
966947747 3:184789263-184789285 CTCAGCTCTTATAAAGGCCCAGG - Intergenic
969593371 4:8134234-8134256 CTGAGCTCTCAGGCAGCCCCAGG + Intronic
970032394 4:11691445-11691467 CTAAGGTCTTATAAATCCCAAGG + Intergenic
970287210 4:14531146-14531168 CTGATGTTTGATTAAGCCCCTGG + Intergenic
972566317 4:40272532-40272554 CTGAAGTCTTAGGGAACCCCAGG + Intergenic
980969141 4:139553051-139553073 CTGAGGTCCTCTGAGGCCCAGGG + Intronic
981877678 4:149568059-149568081 ATGAGGTCTTTTATAGCCCCAGG - Intergenic
982132468 4:152243003-152243025 CAAATGTCTTATGAAGCCCAAGG - Intergenic
982307385 4:153947259-153947281 CTGAGGGGTAGTGAAGCCCCTGG + Intergenic
986013297 5:3736597-3736619 CTGAGGCCTTAAGAAGGCCGAGG + Intergenic
986077260 5:4350818-4350840 CTGAGGCTTTGTGAAGCCCTAGG + Intergenic
987000854 5:13658052-13658074 CTGAGGCATTAGGAAGCCCAGGG + Intergenic
991922023 5:71666536-71666558 CTGAGCTTTTAGGAAGCCCCTGG + Intergenic
992027187 5:72681739-72681761 CTGAGGTGTTATGGAAACCCAGG - Intergenic
995653690 5:114400707-114400729 CTAAGCTTTTATGAAGCCCAGGG + Intronic
995700655 5:114931123-114931145 CTGTGGTCTCAGGAAGACCCAGG + Intergenic
997247203 5:132359857-132359879 CTGAGGTTTCAGGAATCCCCTGG - Intergenic
999079593 5:148830296-148830318 CTGAGATCTTATGAGGCTACAGG - Intergenic
999851313 5:155542408-155542430 CTGAGGTATTAGGCAGCCACTGG + Intergenic
1000374619 5:160567777-160567799 CAGAGGTCTTGGGAAGCCCTTGG + Intronic
1000986339 5:167864841-167864863 CTGAGCTCTTATGAGGTACCAGG - Intronic
1001681603 5:173561906-173561928 CTGAGTTCTTCTGAAGCCAGTGG + Intergenic
1002093589 5:176818177-176818199 CCGGGGTCTTCGGAAGCCCCAGG - Intronic
1004741581 6:18466586-18466608 CATAGGTCTCATGAAGCACCAGG - Exonic
1005812763 6:29529563-29529585 CTGAGAGCTTATGAAGCACATGG + Intergenic
1006677353 6:35774023-35774045 CTGAGGGGTGGTGAAGCCCCTGG - Intergenic
1007844463 6:44741916-44741938 TTAAGTTCTTAGGAAGCCCCTGG - Intergenic
1008024626 6:46620549-46620571 CAGAGGTCTAATGAATTCCCAGG + Intronic
1010128618 6:72465126-72465148 CTGAGATGTTATTTAGCCCCAGG + Intergenic
1022379944 7:29850591-29850613 GTGAGGTCTAAAGAAGTCCCCGG - Intronic
1023966758 7:44966902-44966924 TTGAGGGGTTAGGAAGCCCCTGG - Intronic
1024329111 7:48139118-48139140 CTGAGGTCTGCTGGACCCCCGGG + Intergenic
1027287716 7:76666054-76666076 CTGAGCTCATAAAAAGCCCCAGG + Intergenic
1031942624 7:127805307-127805329 CTGAGCTCTGATCAAGGCCCAGG - Intronic
1032492523 7:132334203-132334225 CTGAAATCTTATAAAGCACCAGG - Intronic
1035730137 8:1848451-1848473 CTGTGTTATTCTGAAGCCCCCGG - Intronic
1039504731 8:38043732-38043754 CAGGGGTCTTATGAAGCTGCTGG - Intronic
1040384661 8:46906178-46906200 CGGTGATCTTAGGAAGCCCCAGG + Intergenic
1045975644 8:108128115-108128137 CTCTGGTCTTATGAACTCCCAGG - Intergenic
1046131080 8:109969471-109969493 CTGAGGATTTATTAAACCCCAGG + Intronic
1047730960 8:127727687-127727709 CTGAATTCATATGATGCCCCGGG - Intergenic
1049037811 8:140090388-140090410 CTCAGCTCTTACGATGCCCCAGG + Intronic
1049099807 8:140570666-140570688 CTGAAGTCTCACAAAGCCCCTGG + Intronic
1049653386 8:143787093-143787115 CTGAAGGCTTTTGTAGCCCCAGG + Intergenic
1051367773 9:16333416-16333438 CTGCGGCCCTCTGAAGCCCCAGG + Intergenic
1051658429 9:19404541-19404563 CTGAGGGCTTATGAAGCCAAAGG + Intergenic
1053311172 9:37021135-37021157 CTGAGGTCTAAGGAAGATCCTGG + Intronic
1053426517 9:38013811-38013833 CTGAGGTCCCATGGAGCCACAGG - Intronic
1053456860 9:38239882-38239904 CTGAGATCTTCTGCAGACCCAGG - Intergenic
1053790815 9:41685202-41685224 CTGAGATCTTATTAGGCGCCAGG + Intergenic
1054154345 9:61629570-61629592 CTGAGATCTTATTAGGCCCCAGG - Intergenic
1054179162 9:61896896-61896918 CTGAGATCTTATTAGGCGCCAGG + Intergenic
1054474124 9:65560690-65560712 CTGAGATCTTATTAGGCACCAGG - Intergenic
1054658376 9:67683925-67683947 CTGAGATCTTATTAGGCGCCAGG - Intergenic
1058446448 9:105059310-105059332 CTGAGGTATGATCAAGCCCAGGG + Intergenic
1061425257 9:130494474-130494496 CTGAGGTCTTCTGCCTCCCCCGG + Intronic
1061585808 9:131567693-131567715 CAGAAGCCTTATGAACCCCCAGG - Intergenic
1195244287 X:102981555-102981577 CTGAGGTTTACTGAAGCCCTAGG - Intergenic
1196008631 X:110862792-110862814 CTGAGGTATTATGAAACTCTGGG + Intergenic
1196066671 X:111471615-111471637 CTGATGACCTATGCAGCCCCAGG - Intergenic
1196370329 X:114971174-114971196 CTGTGGTCTTCTGAATTCCCAGG - Intergenic
1199721202 X:150543768-150543790 CTTGGGTCTTCTGTAGCCCCAGG - Intergenic
1200359904 X:155593307-155593329 CTGAGGTCATATGAGGCTGCTGG - Intronic