ID: 902620856

View in Genome Browser
Species Human (GRCh38)
Location 1:17650117-17650139
Sequence ATGGATACCGGGACTGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902620852_902620856 15 Left 902620852 1:17650079-17650101 CCTTCTGGCTGGTGTGTGAGAGT 0: 1
1: 1
2: 3
3: 23
4: 284
Right 902620856 1:17650117-17650139 ATGGATACCGGGACTGAGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902620856 Original CRISPR ATGGATACCGGGACTGAGCG TGG Intronic