ID: 902622550

View in Genome Browser
Species Human (GRCh38)
Location 1:17658962-17658984
Sequence CTTGATTTGGTGGGGGAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902622544_902622550 -6 Left 902622544 1:17658945-17658967 CCAGAGGCAGGAGAATGCTTGAT 0: 1
1: 1
2: 18
3: 110
4: 476
Right 902622550 1:17658962-17658984 CTTGATTTGGTGGGGGAACCCGG 0: 1
1: 0
2: 0
3: 7
4: 108
902622543_902622550 -5 Left 902622543 1:17658944-17658966 CCCAGAGGCAGGAGAATGCTTGA 0: 1
1: 0
2: 5
3: 46
4: 353
Right 902622550 1:17658962-17658984 CTTGATTTGGTGGGGGAACCCGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902622550 Original CRISPR CTTGATTTGGTGGGGGAACC CGG Intronic
901054656 1:6443575-6443597 CCTGCTTGGGTGAGGGAACCAGG - Intronic
902172863 1:14627160-14627182 CTTGTTTTGATGGGGGCATCAGG + Intronic
902622550 1:17658962-17658984 CTTGATTTGGTGGGGGAACCCGG + Intronic
905183569 1:36180558-36180580 CTTGATTTGGTGGGGTACAGTGG + Exonic
906355455 1:45102867-45102889 ATTTATTTGGTGGGGGTACAGGG + Intronic
914758276 1:150579079-150579101 CTGGAGTTGGTCGGGGAATCTGG - Exonic
915594312 1:156887671-156887693 CTGGATGTGGTGGGGGTACTGGG - Intergenic
916118815 1:161510596-161510618 ATTCATTTGGTGGAGAAACCTGG + Intronic
918288558 1:183083051-183083073 CTTGTTCTGGTGGGAGAACTTGG + Intronic
924322623 1:242865047-242865069 CTAGCTGTGGTGGGGGAAACTGG + Intergenic
924328903 1:242923019-242923041 CTTGGTTTAGTGGCGGAACCAGG - Intergenic
1066617595 10:37311199-37311221 CTTGTTTTGTTGAGGGGACCGGG + Intronic
1066649373 10:37640339-37640361 CTGGATATGCTGGGGGCACCAGG + Intergenic
1067032260 10:42885881-42885903 CTGGATGTGCTGGGGGCACCAGG + Intergenic
1068706958 10:60087714-60087736 CTTGATTTGGTTTGGAAAGCTGG - Intronic
1075498942 10:122954309-122954331 CTTGCTTTGGTGGGGAGAGCAGG + Exonic
1075794280 10:125107650-125107672 CTTGATCTGCTGTGGGAACTAGG - Intronic
1082861101 11:57857568-57857590 TTTTATTTGGTGGGGGAAGGAGG - Intergenic
1083759411 11:64807488-64807510 CTTGACTTGCTGTGGGACCCTGG - Intronic
1084436081 11:69141001-69141023 CTTGATTTTGTGGCTGAAACAGG + Intergenic
1087098566 11:94343736-94343758 CTTGATTTTCTAGGGGAAGCTGG - Intergenic
1094695287 12:32812045-32812067 CTTGCTTGCGTGGGGGAAACTGG + Intronic
1103344482 12:120240315-120240337 CTTGCTCTGGTGGGGCAATCAGG - Intronic
1103844742 12:123893513-123893535 TTTGCTTTGCTGGGGGAACCTGG - Intronic
1108124936 13:47232243-47232265 TTTGTTTTGGTGGGGGAAATGGG + Intergenic
1108165630 13:47690121-47690143 CTTGGTGTGGTGGGAGCACCAGG - Intergenic
1109700622 13:66020207-66020229 CTTGATTTCGTAAGGGAACTTGG - Intergenic
1110218675 13:73050607-73050629 CTCGATTTGTTGGGGGCAACAGG + Intergenic
1113292887 13:108925561-108925583 GAAGACTTGGTGGGGGAACCAGG - Intronic
1113635743 13:111917956-111917978 CTTCATGTGCTGGGGGGACCAGG + Intergenic
1119513104 14:75227159-75227181 TTGGATTTGGTGGGGAAATCAGG + Intergenic
1121767970 14:96503292-96503314 TTTGTTTTGATGGGGTAACCAGG + Intronic
1122940876 14:104980865-104980887 CTTCATTTGGATGGGGACCCAGG - Intergenic
1123921415 15:25072384-25072406 TTTGATTTGTTGGGGGGATCAGG + Intergenic
1127624323 15:60765266-60765288 TTCGGTTTGGTGGGGGATCCTGG - Intronic
1128876429 15:71205113-71205135 CTAGGTTTGGTGTAGGAACCAGG + Intronic
1129844510 15:78762107-78762129 CCTGATTTGCTGTGTGAACCTGG - Intronic
1130257300 15:82331756-82331778 CCTGATTTGCTGTGTGAACCTGG + Intergenic
1130395590 15:83498311-83498333 CTTGATTAGCTGGGTGAGCCTGG + Intronic
1130597647 15:85258233-85258255 CCTGATTTGCTGTGTGAACCTGG - Intergenic
1138232273 16:55347234-55347256 CTGGATTCAGTGGGGGATCCCGG - Intergenic
1143213967 17:5210265-5210287 CGAGATGTGGTGTGGGAACCTGG + Exonic
1143537746 17:7551166-7551188 AGTGATTTGCTGGGGGAACTGGG - Intronic
1144639319 17:16928829-16928851 CTTGATGCGGTGGGTGATCCTGG + Intergenic
1145914945 17:28567416-28567438 ATTGATTTGTTGGAGAAACCAGG - Intronic
1149854541 17:60069099-60069121 CGTGCTTTGGTTGGAGAACCTGG - Intronic
1151333763 17:73427541-73427563 ATTGATTTGTTGGAGAAACCAGG - Intronic
1154961571 18:21314831-21314853 CTAGATTTGGTGGGAGAGCATGG + Intronic
1158275097 18:55758385-55758407 CTTCCTTTGGTGGGGCAATCAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158881736 18:61785374-61785396 TTTGGTTTGGAGTGGGAACCAGG + Intergenic
1160298095 18:77655891-77655913 TTTTTTTTGGTGGGGGAACAGGG + Intergenic
1161751026 19:6096859-6096881 CTTAAGATGGTGGGGGACCCTGG - Intronic
1166949492 19:46416987-46417009 TTTTATTTGGTGGGGGAGCAGGG + Intergenic
1168477103 19:56684284-56684306 CATGACCTGGTGGGGGAAACAGG - Intergenic
1168716653 19:58532502-58532524 CTTGCTGTGTTGGGGGAAGCTGG + Intronic
1168724892 19:58575648-58575670 CTTGGTTCGGTCGGGGAACTGGG + Intergenic
926266628 2:11328298-11328320 CTACATTTGGGGGGGGAAACAGG + Intronic
928894726 2:36247512-36247534 CTTGATTTGGGTTTGGAACCAGG - Intergenic
930884928 2:56314641-56314663 GTTGATTTGGTGAGGGATTCTGG + Intronic
930907118 2:56584120-56584142 CCTGATGTGTTTGGGGAACCAGG + Intergenic
932708996 2:74048169-74048191 CTTGATTTGCTTGGGGGAACGGG - Exonic
933118013 2:78498493-78498515 CTTCATTGAGTGGTGGAACCAGG - Intergenic
934565483 2:95337961-95337983 CTGGAGGTGGTGGGGGAAGCAGG + Intronic
936491340 2:112975218-112975240 CTTAAATTGGTGGGGCAACATGG - Intronic
936504912 2:113098476-113098498 CTTGCTTTGGTGGAGGCAGCAGG + Intergenic
937622060 2:124000030-124000052 TTTGATTTCGTGGTGGAACAGGG - Intergenic
938710200 2:133970101-133970123 GTGGATGTGGTGGGGCAACCGGG - Intergenic
939054394 2:137345959-137345981 CTTGTTGTGGTGGGGGAATAGGG + Intronic
947094558 2:226551282-226551304 CTTGTTTGGGAGGGGGAACCTGG - Intergenic
1176075475 20:63246376-63246398 CTGGCTTTGGTGGGAGAAACAGG + Intronic
1181646525 22:24234149-24234171 CTGGATTTGATGGGGAAGCCTGG - Intronic
1185373385 22:50471000-50471022 CTTCAGTGGGTGGGGGACCCTGG - Intronic
951845405 3:27079534-27079556 CCTGATCTGGGGTGGGAACCTGG - Intergenic
963730910 3:148971067-148971089 CTTGATTTGGAGGTGGTATCAGG - Intergenic
967421322 3:189276272-189276294 CTTGATTTGGTGCTGGAAGTAGG + Intronic
970818398 4:20185384-20185406 CCTGCTTGGGTTGGGGAACCTGG - Intergenic
974374114 4:61054646-61054668 GTTGATTTGGTGGAGTTACCAGG - Intergenic
976023482 4:80660236-80660258 ATTGATTTGTTGGAGAAACCAGG - Intronic
976039997 4:80872011-80872033 ATTGATTTGTTGGAGAAACCAGG + Intronic
977276167 4:94979947-94979969 CTAGTTTTTGTGGGGGTACCAGG + Intronic
979841849 4:125451618-125451640 CTTGATTTGGAGGGAGATCAGGG - Exonic
982771516 4:159401261-159401283 CATGATTTTGTGGGGGAAGCAGG + Intergenic
986654460 5:9997397-9997419 CCTGACTTGGTGGGGGACCTGGG - Intergenic
991420755 5:66438936-66438958 TGTGTTTTGGTGGGGGAACAAGG - Intergenic
991667296 5:69011961-69011983 ATTGATCTGATGGGGGATCCAGG + Intergenic
998869386 5:146537218-146537240 CTTGATTGAGTTGGGGAACAGGG + Intergenic
999014959 5:148092527-148092549 ATTGTTTTGGTGGGGTCACCGGG + Intronic
1001647775 5:173295070-173295092 CTTGATTTGGTGGCTGCCCCAGG - Intergenic
1007033267 6:38648526-38648548 AATGATTTGATGGGAGAACCTGG - Intergenic
1009613846 6:65980257-65980279 TTAGATTTGGGGGGGAAACCAGG - Intergenic
1014566615 6:122956681-122956703 CCTGATTTGGTGGAGGTAGCAGG - Intergenic
1020175438 7:5878311-5878333 CTGGACTAGGTGGGGGAACAGGG + Intergenic
1020642960 7:10779362-10779384 CTTGATTTTATGGGGGAAATGGG - Intergenic
1021888906 7:25168294-25168316 ATGGATTTGGTGGAGAAACCTGG - Exonic
1026006036 7:66601110-66601132 CTGGCTTATGTGGGGGAACCTGG - Intergenic
1028197804 7:87927217-87927239 CTTGCTTTGGTGGAGGTAGCAGG - Intergenic
1028394016 7:90347646-90347668 CTTGATTTAGTGAAGGAAACAGG + Intronic
1029203931 7:98857320-98857342 ATTGAGATGTTGGGGGAACCTGG - Intronic
1031529487 7:122858964-122858986 ATTGATTTGGTCAGGGAACAGGG + Intronic
1033153451 7:138936553-138936575 CTGGGTTTGGTTTGGGAACCAGG + Intronic
1039942691 8:42104664-42104686 CATGATTTGGTGGGGGATTCTGG - Intergenic
1042906429 8:73776812-73776834 CTTTTTTGGGTGGGGGAACAGGG - Intronic
1044572777 8:93738461-93738483 CTTTCTTTGGTGGGGGAGACAGG + Intronic
1044791845 8:95855930-95855952 GTTGATTTGTTGGAGAAACCAGG - Intergenic
1050836557 9:10087667-10087689 CTTGCTTTGAAGGTGGAACCGGG + Intronic
1052638998 9:31139845-31139867 GTTGCTTTGGTGGAGGAACTGGG + Intergenic
1056501601 9:87215153-87215175 CTTTATTTGGTGGGAGTACTGGG - Intergenic
1057758841 9:97856943-97856965 CTGGCTTTGGTGGTGGTACCTGG + Intergenic
1062312743 9:135948033-135948055 CTTGATGAGCTGGGGGAGCCTGG + Intronic
1189554075 X:42124063-42124085 CCTGAATTGGTGGTGGCACCTGG + Intergenic
1190648421 X:52544460-52544482 CTCGATTTTGTGGGGGAAATGGG + Intergenic
1191000641 X:55657370-55657392 CTTGATTTTAGGGGGGAAACGGG - Intergenic
1192552459 X:72065114-72065136 CTTGGGTTGGTGGGGGAACAAGG + Intergenic
1199170118 X:144725839-144725861 CCTGATTTGGTGGGTAGACCGGG + Intergenic
1201226291 Y:11822117-11822139 CTTGGTTTAGTGGAGGAACCAGG - Intergenic