ID: 902624042

View in Genome Browser
Species Human (GRCh38)
Location 1:17666639-17666661
Sequence CAGCTGTTCTTGGGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902624042_902624055 27 Left 902624042 1:17666639-17666661 CCTTTCTCCCCCAAGAACAGCTG 0: 1
1: 0
2: 2
3: 30
4: 294
Right 902624055 1:17666689-17666711 CCAGCCCCTGGTTCATGCTGGGG 0: 2
1: 1
2: 1
3: 23
4: 251
902624042_902624051 25 Left 902624042 1:17666639-17666661 CCTTTCTCCCCCAAGAACAGCTG 0: 1
1: 0
2: 2
3: 30
4: 294
Right 902624051 1:17666687-17666709 TCCCAGCCCCTGGTTCATGCTGG 0: 2
1: 1
2: 2
3: 26
4: 225
902624042_902624048 15 Left 902624042 1:17666639-17666661 CCTTTCTCCCCCAAGAACAGCTG 0: 1
1: 0
2: 2
3: 30
4: 294
Right 902624048 1:17666677-17666699 CAGACTCCCTTCCCAGCCCCTGG 0: 1
1: 0
2: 9
3: 139
4: 768
902624042_902624053 26 Left 902624042 1:17666639-17666661 CCTTTCTCCCCCAAGAACAGCTG 0: 1
1: 0
2: 2
3: 30
4: 294
Right 902624053 1:17666688-17666710 CCCAGCCCCTGGTTCATGCTGGG 0: 2
1: 1
2: 1
3: 19
4: 327
902624042_902624056 28 Left 902624042 1:17666639-17666661 CCTTTCTCCCCCAAGAACAGCTG 0: 1
1: 0
2: 2
3: 30
4: 294
Right 902624056 1:17666690-17666712 CAGCCCCTGGTTCATGCTGGGGG 0: 2
1: 1
2: 0
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902624042 Original CRISPR CAGCTGTTCTTGGGGGAGAA AGG (reversed) Intronic
900559069 1:3294722-3294744 GGGCTTTTCTTGGAGGAGAATGG - Intronic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901096710 1:6687152-6687174 GAGCTGTTCTACGGAGAGAAAGG + Intronic
902396203 1:16133599-16133621 CAGTTGTTCTGGAAGGAGAAGGG + Exonic
902511608 1:16969771-16969793 CAGCCGTTCCTGGGGGACAGGGG - Exonic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
902655312 1:17863708-17863730 CATCTGTTCTTCAGGGAGTATGG - Intergenic
902749850 1:18500046-18500068 GAGCTGTTCTTGGGCAAGAGGGG + Intergenic
903814654 1:26056070-26056092 CAGCTGAGGTTGGGGGACAAGGG - Intronic
905178013 1:36150092-36150114 TAGCTGTTCTAGGGGGAGGGAGG - Intronic
906523519 1:46480584-46480606 CAGGTGTTCTTGATGGGGAAGGG + Intergenic
906687697 1:47772946-47772968 CAGCTTTTCTTTGGCAAGAAGGG - Intronic
907273662 1:53305144-53305166 CACCTGTTTTTGTGGGAGAATGG - Intronic
909951306 1:81723206-81723228 CAGCTGCATTTGGGGGAGAAGGG - Intronic
911121102 1:94297566-94297588 CAGATTTTCTTTGGGGACAAAGG + Intergenic
912491714 1:110066109-110066131 CAGCTGTGGTTGGGGGAGGATGG + Intronic
912658171 1:111506030-111506052 TAGATGGACTTGGGGGAGAAGGG - Intronic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913359827 1:117968018-117968040 CTGCTGGACTTGGAGGAGAAGGG - Intronic
914376998 1:147080469-147080491 CAGCTGTCCTTGGGACAGCAAGG + Intergenic
915113652 1:153581626-153581648 CAGCTGTTCTTGGGAAGGGACGG + Intergenic
916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG + Intronic
917119256 1:171631473-171631495 CAGCTGTCAGTGGGGGAGAGTGG + Intergenic
917120465 1:171640886-171640908 CAGCAGTTGTTGGGTGAGGAAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918056688 1:181027391-181027413 CAGAGATTGTTGGGGGAGAATGG - Intergenic
920384180 1:205556421-205556443 CAGCTGTTCTTGAGTAAGCATGG - Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
923370059 1:233300910-233300932 CAGCTGTTCATGGGGGCCCATGG - Intergenic
923648902 1:235853525-235853547 CAGTAGTTCTGGGGGAAGAATGG + Intronic
923777203 1:236990394-236990416 CAGCTGTGATGGGGGGAAAAGGG - Intergenic
924459386 1:244244859-244244881 CACCTGTTCTTGGGAGAAGAGGG + Intergenic
924600397 1:245483504-245483526 CAGCTGGTGTTGGGGGAGCGGGG + Intronic
1063629164 10:7718266-7718288 TAGGTGTTCTTGTGAGAGAAAGG - Intronic
1065662849 10:28023842-28023864 CAAATGATCTTGCGGGAGAATGG - Intergenic
1065893322 10:30139205-30139227 CAGCTGTTGTTTCTGGAGAATGG + Intergenic
1066456235 10:35574715-35574737 CAGCTGTACTTGGGAGAGCTGGG - Intergenic
1066697980 10:38095212-38095234 CAGCTGTTGTGGGGTAAGAAGGG + Intronic
1066994527 10:42551980-42552002 CATCTGTTGTGGGGTGAGAAGGG - Intergenic
1067710622 10:48648675-48648697 CAGCTGTCCTGGGGGGAAAATGG + Intronic
1067897206 10:50196373-50196395 CAGTTTTTCTGGGGGGAGGAGGG - Intronic
1067951766 10:50745652-50745674 CAGTTTTTCTGGGGGGAGGAGGG + Intronic
1070465838 10:76722906-76722928 AAGCTGGTCTTGGGGGAGTGTGG - Intergenic
1071979985 10:90995711-90995733 TAGCTATTCTTGCAGGAGAAAGG - Intergenic
1072409269 10:95184871-95184893 CAGCTGGAGTTGGAGGAGAAGGG - Intergenic
1073177223 10:101563988-101564010 TAGCAGTTCTTGGGGGTGATGGG + Intergenic
1074881566 10:117663446-117663468 CAGCTGTTCTTGGGGGCTCTTGG + Intergenic
1075586968 10:123665483-123665505 CAGCTGTTCTTGGGACAGACAGG + Intergenic
1076574585 10:131455433-131455455 CAGTTCTTCATGGGAGAGAATGG + Intergenic
1079130616 11:17744906-17744928 CAGCTGTGCTGAGGGGTGAAGGG - Intronic
1079189134 11:18263225-18263247 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
1080370797 11:31640077-31640099 CAACTGTTCTGGGAGCAGAAGGG + Intronic
1080593114 11:33740757-33740779 TAACTGTTCTTGGGGGAAAATGG + Intergenic
1083989534 11:66238360-66238382 CAGCTCTTCTCTGGGGATAAAGG - Intronic
1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG + Intronic
1085513781 11:77100759-77100781 CAGCAGTTCTTGGGGTAGAATGG - Intronic
1086854939 11:91854871-91854893 CAGATGTTCTGTTGGGAGAATGG - Intergenic
1086911403 11:92476572-92476594 CAGCCGTACTTGGGGGTGAATGG + Intronic
1087156967 11:94914275-94914297 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
1088314002 11:108488802-108488824 CATATGTTCTTGGGGAAGACAGG + Intronic
1088842030 11:113635401-113635423 CAGCTGCTCTGGGGTGAGAGGGG - Intergenic
1088890007 11:114036706-114036728 CTGCTGTTTTTGCTGGAGAAGGG + Intergenic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1089231845 11:116984110-116984132 CAGCGGTTTGTGGGGGAAAAGGG + Intronic
1089369224 11:117942362-117942384 CGGCTGGCCTCGGGGGAGAATGG - Intergenic
1089776957 11:120844526-120844548 CTGGAGTTCTTGGGGTAGAAGGG + Intronic
1092312468 12:7373481-7373503 CAGCTGGGCTGTGGGGAGAATGG - Exonic
1096647964 12:53048477-53048499 CAGCCCTGCTTGGGGGAGATGGG - Intronic
1096776121 12:53965462-53965484 CAGGTGTTCCTGGGGGAGAGGGG - Intergenic
1097156675 12:57016876-57016898 TAGCTGGTCTTGGGGGAGAATGG - Intronic
1097157286 12:57022251-57022273 TAGCTGGCCTTGGGGGAGAATGG - Intronic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1099467523 12:83005679-83005701 CAGCTGTGCTTGGTGGAGGCAGG + Intronic
1100039034 12:90289606-90289628 TAGCTGTTTTTTGGGGGGAAAGG + Intergenic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1101578190 12:106017141-106017163 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
1103474550 12:121209329-121209351 CAGCTGTGGTTGGGGGAGCTGGG - Intergenic
1104039475 12:125120369-125120391 AATCTGTTCTTGGGGGAAACAGG + Intronic
1104410656 12:128554939-128554961 CATCCGTTCTTGGAGGAGACTGG + Intronic
1104460447 12:128951710-128951732 CAGCTGGTCCTGAGGGAGACGGG - Intronic
1105892195 13:24689771-24689793 CAGGGGTTTTTGGGGAAGAAGGG - Intronic
1106027538 13:25969249-25969271 CAGCTGTTCCTTGTGGGGAAGGG - Intronic
1106703850 13:32259382-32259404 AAGCTGTTCTTGGAGGAATAAGG - Intronic
1108413445 13:50173321-50173343 CAGCTGCATTTGGGGGAGAGGGG - Intronic
1109239841 13:59872508-59872530 CATTTGTTCTTGGGGGACAGGGG - Intronic
1110689573 13:78416565-78416587 CAGCTGGTCTTCAGGGACAAAGG + Intergenic
1111220651 13:85201458-85201480 CAGCTGTTAGTGTGAGAGAAAGG - Intergenic
1111922205 13:94424250-94424272 CAGCTGATCTTGGGTAAGCAAGG - Intergenic
1112042170 13:95557603-95557625 CTGCTGTTCATGCTGGAGAAAGG + Intronic
1112238320 13:97656373-97656395 GAGCTTTTCTTGGGGTAGGAAGG + Intergenic
1112302203 13:98240441-98240463 CAGCTGTTCTGAGAGAAGAAGGG + Intronic
1113317803 13:109202389-109202411 TGGCTATTCTTGTGGGAGAAAGG + Intronic
1113751251 13:112777883-112777905 CATCTGGCGTTGGGGGAGAAAGG - Intronic
1118196256 14:63629486-63629508 AAACTGTTCCTGAGGGAGAAAGG - Intronic
1121038849 14:90728637-90728659 AGCCTGTTCTTTGGGGAGAAAGG - Intronic
1121235575 14:92389425-92389447 AATCTGTTCATGGGGAAGAACGG - Intronic
1121641264 14:95486219-95486241 CAGATCTTCTTGGGGGTGATGGG - Intergenic
1121697221 14:95923637-95923659 CATCTGTAGTTGGGGGAGGAGGG - Intergenic
1122831489 14:104399445-104399467 AAGCTGCTCTCCGGGGAGAAGGG - Intergenic
1125973813 15:43933911-43933933 CAGCAGATCTGGGGTGAGAAGGG - Intronic
1126045187 15:44633165-44633187 CAGCTATTCTTTGTAGAGAATGG - Intronic
1126117661 15:45223512-45223534 CAGGTGTTCTTGTAAGAGAAAGG - Intergenic
1128377610 15:67088617-67088639 CAGCTGCTCTAGGGTGGGAAGGG + Intronic
1129412718 15:75358859-75358881 CAGCTGCTCTTGGTGGGGTAGGG + Intronic
1130331391 15:82925039-82925061 CAGCTGATCTTGGGGTAAACAGG + Intronic
1130552961 15:84903700-84903722 CCTCTGACCTTGGGGGAGAAAGG - Intronic
1131290601 15:91103644-91103666 CAGCTGTCCTTGGTGCAGAAGGG + Intronic
1133020155 16:2963615-2963637 CAGCTGGTGTCTGGGGAGAAAGG - Intergenic
1133405843 16:5523851-5523873 CAGGTGTCCTTGGGGCAGCATGG + Intergenic
1134625458 16:15719749-15719771 CAGCAGAACTTGGGGGAGTAAGG - Intronic
1135930309 16:26730688-26730710 CAGCTTTTCCTGGGGGAATATGG - Intergenic
1136153305 16:28366046-28366068 CAGCTGGAGTTGGAGGAGAAGGG - Intergenic
1136209781 16:28749221-28749243 CAGCTGGAGTTGGAGGAGAAGGG + Intergenic
1137572302 16:49574813-49574835 CAGCTGTTCTGAGGGCAGCAGGG - Intronic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1138632040 16:58304499-58304521 CAGCTATTCTTGCAGGAGTAAGG + Intronic
1140933670 16:79651481-79651503 CTGCTGCTCTTTGGGGAGAAGGG + Intergenic
1141797420 16:86284705-86284727 CAGCTGGTCATGGGGGAGGCAGG + Intergenic
1142026648 16:87817995-87818017 CAGATGTGCCTGGGGGAGAAGGG + Intergenic
1142414051 16:89931836-89931858 CACCTGCTCTAGGGGGAGAGAGG + Intronic
1142610869 17:1108778-1108800 CAGCTGTTCCCGGGGGAGAGGGG - Intronic
1142807104 17:2376944-2376966 CAGCTGATCTGAGGGGAGACAGG - Exonic
1143469260 17:7161553-7161575 TAACTGTGCTTGGGGGATAAAGG - Intergenic
1144410259 17:14993957-14993979 CAGAGGTTCTTGGGGAAGGATGG - Intergenic
1145790500 17:27623803-27623825 CAGCTGTTCTTGGGGTAGGGCGG + Exonic
1148447041 17:47744120-47744142 CAGCTGTTGGTGGGGGTGATGGG + Intronic
1148842474 17:50508138-50508160 CAGCGGTTCTGGGGGGGGATCGG - Intergenic
1149682401 17:58515183-58515205 AAGCCCTTCTTGGAGGAGAAAGG + Intronic
1153264463 18:3256131-3256153 CCACAGTTATTGGGGGAGAAGGG - Exonic
1153774795 18:8442999-8443021 CCTCTCTTCTTGGGGGAGAGGGG - Intergenic
1155340089 18:24805155-24805177 CGGCTAGCCTTGGGGGAGAATGG - Intergenic
1156409003 18:36810152-36810174 CAGGGGTGCTTGGGGCAGAAGGG - Intronic
1157406844 18:47428864-47428886 CGGCTGCTCTGGTGGGAGAAGGG + Intergenic
1157763579 18:50281997-50282019 CAGCTGTTCGGCGGGGAGGAGGG - Intergenic
1159922894 18:74242153-74242175 CAGGTTTGCTTGGGTGAGAAGGG + Intergenic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1163553828 19:17981706-17981728 CAGCTGTTCATGGTGGACAACGG + Exonic
1164041589 19:21497408-21497430 TAGCTGGTCTTGGGAGAGTAGGG - Intronic
1164703761 19:30304426-30304448 CAGCTTTCCTTGCAGGAGAATGG - Intronic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1165725555 19:38110293-38110315 CGGATGTTCTTGGGGGTGAACGG - Exonic
1165764332 19:38341266-38341288 CTCCTGTTGTTGGGGGAGCAGGG + Intronic
1166155613 19:40909272-40909294 CAGCACTTCCTGGGTGAGAAGGG - Intergenic
1167115705 19:47488023-47488045 CAGCTGGTTTTGGGGGTGAAGGG + Exonic
1167493892 19:49806968-49806990 CCTCTGTGCTTGGGGGGGAAAGG - Exonic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926215154 2:10901790-10901812 CAGCTCTTCTTGGTGGAGGTGGG + Intergenic
926354209 2:12024773-12024795 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
926802486 2:16671354-16671376 CTTCTCTTTTTGGGGGAGAAAGG - Intergenic
928204478 2:29274124-29274146 CAGCTTTTCATGGGACAGAAAGG + Intronic
929020723 2:37549992-37550014 CAGCTGTTAGTGCTGGAGAAAGG - Intergenic
929621397 2:43358466-43358488 AGGCTGTTCATGGGGGAGATAGG + Intronic
929837450 2:45418454-45418476 CAGCTGTTCTCGGTTGATAAAGG + Exonic
929862334 2:45690332-45690354 CTGCTTCTCTTGGGGGATAAAGG + Intronic
930235786 2:48887807-48887829 CAGCTGTTGTAGGGGGGAAAAGG + Intergenic
930536793 2:52653674-52653696 AAGGTCTTCTTGGGGAAGAATGG + Intergenic
932342563 2:70975552-70975574 CAGGTGATTTTGAGGGAGAAGGG - Intronic
932448561 2:71795379-71795401 CAGCTGAGCTTACGGGAGAAAGG - Intergenic
935210365 2:100934747-100934769 CAGCTGTGGTTGGGGGAGATGGG + Intronic
935316744 2:101842393-101842415 CAGCTTTTCTGTGGGGAGTAAGG + Intronic
935447974 2:103176494-103176516 CAGCTGTTATTAGGAAAGAAAGG - Intergenic
936861548 2:117026340-117026362 CTCCTGCTGTTGGGGGAGAAAGG + Intergenic
937218064 2:120325163-120325185 CAGCTGTTGTGCAGGGAGAAGGG + Intergenic
939765485 2:146243498-146243520 CCGCTCTTCTTGTGGGAGACGGG + Intergenic
940750764 2:157625207-157625229 AAGCTGGTCTGGGGAGAGAAGGG - Intronic
941557596 2:167001271-167001293 CATGTGTTCTTGGGGGAGGTAGG - Intronic
941983390 2:171485353-171485375 CAGCAGTTCCTGGGGAAGGAAGG - Intergenic
942046502 2:172102216-172102238 TAGCTGCTCTTGGCGGAGTAAGG + Exonic
942997562 2:182282260-182282282 CATCTCTTCTTGGAGCAGAAAGG - Intronic
943110153 2:183594671-183594693 CAGTTCTCCTTGGGGGATAAGGG - Intergenic
946420765 2:219563291-219563313 CAGCTGTTCCAGTGGGAGCAGGG + Intronic
947761011 2:232604040-232604062 CAGCTGTTTTTAGCTGAGAAAGG - Intergenic
948710113 2:239820070-239820092 CAGATGTGCTTGGAGGAGAGGGG + Intergenic
948789513 2:240370083-240370105 CAGCTGTGTCTGGGGGAGGAGGG + Intergenic
1169252883 20:4073599-4073621 GAGCTGTTCTTGGGGATGGAGGG + Intronic
1170759152 20:19234547-19234569 CAGACCTTCTTGGGGTAGAAAGG + Intronic
1170993107 20:21323318-21323340 CATGTGGTCTTGGGGTAGAAAGG + Intronic
1171453694 20:25254109-25254131 CTGCCGTTTTTGGGGGTGAAGGG - Intronic
1172601248 20:36185049-36185071 CAGCTGTGCTTGGGGGATCTAGG + Intronic
1172727736 20:37059323-37059345 CAGCTTTTCTTGGAGGACCAGGG + Intronic
1173455990 20:43201768-43201790 CAGCTGTTCCTGAGGGAGTGAGG - Intergenic
1173595560 20:44256936-44256958 CAGTTCTGCTTGGGGGACAAAGG - Intronic
1173723968 20:45284015-45284037 CAGAGGTTCTTGGAGGAGAGAGG - Intergenic
1174239471 20:49121787-49121809 CAGCTCTTCTTCGGGGAGGGTGG - Intronic
1175400927 20:58699445-58699467 CAGCCGTCCCTGGGGGAGAAGGG + Intronic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1175974184 20:62702156-62702178 AAGCTGTGCTTCGGGGAGTAAGG - Intergenic
1175998683 20:62822371-62822393 CACCTGTCCTTGGGGCAGGATGG - Intronic
1176076818 20:63252375-63252397 ACACTGTTCTTTGGGGAGAAAGG + Intronic
1176143933 20:63557173-63557195 CAGCTGATCCTGGAGGAGAGAGG - Intergenic
1178084143 21:29095419-29095441 GAGCTGTTCCAGGGGGATAAGGG + Intronic
1178598508 21:33976114-33976136 CAGCTTTTTTCGGGGGAGCAGGG + Intergenic
1179379619 21:40886423-40886445 CAGCTGTACCTTGGGGAGAATGG + Intergenic
1182219628 22:28747872-28747894 CAGATTTTTTTGGGGGGGAAAGG - Intronic
1183086267 22:35489212-35489234 CAGCAGCCCGTGGGGGAGAAGGG - Intergenic
1183880743 22:40826381-40826403 CAGCTGCATTTGGGGGAGAGGGG + Exonic
949887701 3:8709569-8709591 AAGTTGTACTTGGGGCAGAAGGG + Intronic
950280177 3:11700533-11700555 CAGGAGTTTTTGGGGGTGAAGGG - Intronic
952298503 3:32083367-32083389 CACCTGTCCATGGGGAAGAAGGG + Intergenic
953411459 3:42692698-42692720 CAGCTATTCTTGGGCCAGATGGG - Exonic
955062230 3:55503210-55503232 CAGTGGTTCTTGTGAGAGAATGG + Intergenic
955305145 3:57823001-57823023 CAGCAGTCCTGGGGAGAGAAGGG + Intronic
957544207 3:81615294-81615316 CAGATGTTATTTGGGGAAAATGG - Intronic
959112016 3:102133579-102133601 CAGGTGTTTTTGGAGGAGATTGG + Intronic
961044257 3:123698117-123698139 CAGCTGTTCTTGGGCTTGCATGG - Intronic
961410040 3:126713660-126713682 CCCCTGTTCATGGGGCAGAAAGG - Intronic
961487084 3:127224179-127224201 TAGCTGTTCTTGTGGGCTAATGG - Intergenic
961504715 3:127362493-127362515 CAGCAGTGCTGGGGGCAGAAAGG + Intergenic
962614244 3:137108994-137109016 CAGGGGTTCGTGGGGGAGAAAGG - Intergenic
964880305 3:161416483-161416505 GAGCTGTTCTTGTGGTAGGAAGG + Intergenic
966268925 3:178081629-178081651 AAGCTGTTTTGGAGGGAGAAAGG - Intergenic
966680367 3:182635839-182635861 CAGCTGATCTTGGGGAAGGCTGG - Intergenic
966829182 3:183991440-183991462 CCGCTGTTCTTTGGTGGGAAAGG - Intronic
968607791 4:1543693-1543715 CAGCTCTTCTTGGGGGAAGTGGG - Intergenic
969574506 4:8029150-8029172 CAGCTGTCCTCACGGGAGAATGG - Intronic
969582514 4:8073396-8073418 GGGCTGTTCTTCGCGGAGAACGG + Intronic
970406961 4:15773107-15773129 AAGCTCTTCCTGGGTGAGAAAGG + Intergenic
970825618 4:20269853-20269875 TGGCTATTCTTGGGGGTGAAGGG - Intronic
971168855 4:24212811-24212833 CAGCTTTCCTTGGGTAAGAATGG - Intergenic
971470856 4:27024973-27024995 CTGCTGCTCCTGGGTGAGAAGGG + Intronic
971501817 4:27326392-27326414 CATCTGTGTTTGGGGGAGAAAGG + Intergenic
972696493 4:41451558-41451580 CAGCACTCCATGGGGGAGAAGGG - Intronic
974364345 4:60926961-60926983 CAGCTGCTTCTGGGGCAGAAAGG - Intergenic
975016332 4:69425150-69425172 CAGCAATTTTTAGGGGAGAAGGG - Intergenic
977302457 4:95282943-95282965 TGGCTGGTCTTGGGGAAGAATGG + Intronic
977745200 4:100538741-100538763 CATCTGTTCATGGGGGAGCCTGG + Intronic
978966661 4:114749519-114749541 GAGCTCTTCTTGGGGAAGAATGG - Intergenic
979602757 4:122604388-122604410 CAGCTGTGCTTGGAGGCAAAGGG - Intergenic
982545059 4:156724044-156724066 CAGCTGTGCCTGGGAGAGAGGGG - Intergenic
982791041 4:159591928-159591950 TAGCTGTCCTTGGGAGGGAAAGG + Intergenic
982890592 4:160844495-160844517 CAGCTGGTTTTGTGGGTGAATGG + Intergenic
983417413 4:167476259-167476281 CAGCTGTCCTTGGGAGGGAAAGG + Intergenic
983534697 4:168844966-168844988 CAGCTCTGCCTGGGGGAGTAAGG + Intronic
983935513 4:173500299-173500321 CCGCAGCTCTTGGGGGAGCAGGG - Intergenic
987055077 5:14183551-14183573 GGGCTTTTCTTGGGGGGGAAGGG - Intronic
987138368 5:14920709-14920731 TGGCTGGTCTTGTGGGAGAATGG - Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
989962616 5:50434421-50434443 AGGGTGTTCTTGGGAGAGAAGGG - Intronic
992737160 5:79733908-79733930 CTGATGATCTTGGGAGAGAAAGG - Exonic
995654048 5:114404435-114404457 CAGTTGTTCATGGTGGACAATGG + Exonic
996124477 5:119708329-119708351 CAGCTGTTGTGGGTGGAGATGGG + Intergenic
996432273 5:123394984-123395006 CAGCTGTTGTTATGTGAGAATGG + Intronic
1000697170 5:164401384-164401406 CAGCTGTGGCTGGGAGAGAATGG - Intergenic
1002327489 5:178419368-178419390 CAGCTTTGCATGGGAGAGAAGGG - Intronic
1003500909 6:6702078-6702100 CAGCTGTCCCTCGGGGAGATGGG - Intergenic
1005790506 6:29295567-29295589 CAGCTGTGCTTGGGGGTGTGGGG - Intergenic
1007836111 6:44674948-44674970 CAGCTGAGCTTCGGAGAGAAAGG - Intergenic
1008400094 6:51054072-51054094 GAGATCTTCTTGGGGGAGGATGG - Intergenic
1009797648 6:68492619-68492641 GAACTGTTCTTGGGAGAAAACGG + Intergenic
1010456671 6:76064145-76064167 CAGCCATTCTAGGGGTAGAATGG + Intronic
1010887709 6:81263939-81263961 CAGCTGTGCTTGGGAGAGTGGGG + Intergenic
1011228082 6:85129688-85129710 CAGATGTTCTGGGAGGAGACAGG - Intergenic
1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG + Intronic
1013624061 6:111919827-111919849 CAGCTGGTTTGGGGGAAGAAAGG - Intergenic
1013932569 6:115551762-115551784 CAGCTTTTCATGGGTGTGAAAGG - Intergenic
1014088809 6:117379058-117379080 CAGCTGTTCTTCGGGGACAGAGG - Exonic
1015275063 6:131375667-131375689 CAGAGGTCCATGGGGGAGAAGGG - Intergenic
1015562592 6:134532798-134532820 GAGAGGTTCTTGTGGGAGAAAGG + Intergenic
1018039408 6:159908878-159908900 CACCTCTTCATGGGGGAGGAAGG - Exonic
1018284712 6:162224941-162224963 CTGGTGTTCTTGGGAGAGACAGG + Intronic
1018386835 6:163312199-163312221 CAGCTATAATTTGGGGAGAAGGG + Intronic
1018628917 6:165805502-165805524 CAGGGGCTCTTGGTGGAGAAAGG - Intronic
1019504955 7:1386092-1386114 CAGCTGCCCTTGGCAGAGAAAGG + Intergenic
1020361293 7:7329525-7329547 CAGCAGTGCCTGGGGGACAAAGG - Intergenic
1022398439 7:30012506-30012528 CAGCTGATTTTGTTGGAGAAAGG + Exonic
1026011507 7:66639753-66639775 CAACTATTCTTGGAGGAGAAGGG - Exonic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1028471717 7:91213191-91213213 CAGCCTTTCTTGAGGAAGAAAGG - Intergenic
1029745328 7:102513006-102513028 GAGCTGTTCTGGGGGGAGGCAGG - Intronic
1029763268 7:102611985-102612007 GAGCTGTTCTGGGGGGAGGCAGG - Intronic
1030079758 7:105767255-105767277 CAGCTTTCCTGGGGGTAGAAGGG + Intronic
1030113580 7:106046733-106046755 CAGTTTTTCTTAGGCGAGAATGG + Intergenic
1031401201 7:121328187-121328209 CAACTGAGGTTGGGGGAGAAGGG + Intronic
1031544610 7:123035736-123035758 GAGCTTTTCTTTGGGAAGAATGG + Intergenic
1032466225 7:132147086-132147108 CAGCGGTTATTGAGGGAGACAGG - Intronic
1033050201 7:137997148-137997170 CAAGTGTTCTTGGGGGAAAAAGG - Intronic
1034636936 7:152575103-152575125 CAGCTGTGCTTGGGGCTGATCGG + Intergenic
1035226018 7:157432626-157432648 CAGCCGTCCTTAGAGGAGAAGGG + Intergenic
1035634777 8:1136371-1136393 CAGATGCTCGTGGGAGAGAAGGG + Intergenic
1036812696 8:11878577-11878599 AGGCTGTTCTTGGGGGAACAGGG - Intergenic
1037915936 8:22773561-22773583 CAGCTGTTCTGTAGGGAGAGGGG - Intronic
1038563427 8:28599908-28599930 CAGCTGCATTTGGGGTAGAAGGG + Intergenic
1038976177 8:32698678-32698700 CACCAGTGCTTGGGGAAGAATGG + Intronic
1039182865 8:34886029-34886051 CAACAGATCTTGGGGGAGGAAGG - Intergenic
1039333228 8:36561923-36561945 TTGCTAGTCTTGGGGGAGAATGG - Intergenic
1039771775 8:40694735-40694757 AGGCTATCCTTGGGGGAGAATGG - Intronic
1042278447 8:67029228-67029250 CAGCTGTTTGGGGGGAAGAAAGG - Intronic
1043758237 8:84031401-84031423 CAGCTGTTCCTGTGAGAGCAAGG - Intergenic
1043826807 8:84938924-84938946 AAGTTGTTCATGGAGGAGAAGGG - Intergenic
1044117877 8:88356499-88356521 CAGCTGTTCTTAGTTGAGAATGG + Intergenic
1044301006 8:90582806-90582828 CAGCTGTTGATGAGGGAAAAAGG - Intergenic
1044680749 8:94775141-94775163 CAGCTGATCTAGGGGCACAATGG - Intronic
1045049450 8:98309527-98309549 CTGCTGTCTTTGGAGGAGAATGG - Intergenic
1045496559 8:102714397-102714419 CAGGTGTTCTTATGAGAGAAAGG - Intergenic
1045583210 8:103500726-103500748 CTGCTTTTCTTGGGGGAGGGGGG + Intronic
1046092820 8:109523367-109523389 CACCTGTTCTAAGGGGAGTAAGG - Exonic
1047190775 8:122677348-122677370 CAGGGGTTGGTGGGGGAGAAAGG + Intergenic
1047510806 8:125513772-125513794 CCGCTGAGCTTGGGGGAGCAAGG - Intergenic
1047885874 8:129249478-129249500 GAGCTGTTCTTGGAGGTGCAGGG - Intergenic
1048322266 8:133409242-133409264 CAGCTGTATTTGGGGGAGAGGGG - Intergenic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1049032157 8:140046076-140046098 CAGGTGTTCCTCAGGGAGAAGGG - Intronic
1049491777 8:142907944-142907966 CAGGTGTCCTTGGAGGAAAAGGG - Intronic
1056201145 9:84278000-84278022 TAGCAGTTCTTGGTGGGGAAGGG + Exonic
1056809816 9:89755554-89755576 CAGTTGTTTTTTGGGGGGAAGGG + Intergenic
1056964554 9:91155025-91155047 CAGCAGGTGTTTGGGGAGAAGGG + Intergenic
1059988159 9:119839852-119839874 CAGCTCTTCTGATGGGAGAAGGG - Intergenic
1061258777 9:129467758-129467780 CAGCTGTACTTGGGGGTGGCTGG - Intergenic
1061746530 9:132744220-132744242 CAGCTGTGATTGGGGACGAAGGG - Intronic
1062720048 9:138036112-138036134 AAGCTGTTCTTCAGGCAGAAGGG - Intronic
1186336691 X:8597234-8597256 TAGCTCTTCTTGGGGAAGAGAGG + Exonic
1186868625 X:13747343-13747365 CAGCTGTGGTTGGGGGAGCCTGG + Intronic
1188725522 X:33577882-33577904 CAGCAGTGGTTGGGGGAGCAGGG + Intergenic
1188974764 X:36659922-36659944 CAGCTGCTGTTGGGGGATGAGGG - Intergenic
1189024742 X:37381078-37381100 CTGCTGTTCTTTTTGGAGAAGGG + Intronic
1189270298 X:39746806-39746828 CAGCTCTTCCTGGGGGAGCCTGG - Intergenic
1192677532 X:73214316-73214338 CCGCTGGGCTTGGGGAAGAAGGG - Exonic
1192838383 X:74827110-74827132 CAGCTGTTCTTGTCAGTGAAAGG - Intronic
1193053228 X:77123758-77123780 GAAGTGTTCTTGGGGAAGAATGG - Intergenic
1194088200 X:89554790-89554812 TAGCTGTTCATGGAAGAGAATGG - Intergenic
1194388493 X:93287576-93287598 CAGCTGCATTTGGGGGAGAGGGG + Intergenic
1195809856 X:108817246-108817268 GAGGTCTTCTTGGGGAAGAATGG + Intergenic
1195903665 X:109823532-109823554 AAAATATTCTTGGGGGAGAAAGG + Intergenic
1197412995 X:126141197-126141219 CAGCTGTTTTTTGGGGAGGTAGG + Intergenic
1199576013 X:149314693-149314715 CAGCTGTTCTTCTGAGAAAAAGG + Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic