ID: 902626023

View in Genome Browser
Species Human (GRCh38)
Location 1:17676819-17676841
Sequence CACCCACTGCTCTCCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 603}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902626015_902626023 6 Left 902626015 1:17676790-17676812 CCTGAGCACTCTGTTCCCCCAGG 0: 1
1: 0
2: 2
3: 27
4: 223
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603
902626011_902626023 26 Left 902626011 1:17676770-17676792 CCAGTCCCCTAAAGGCTCTGCCT 0: 1
1: 0
2: 0
3: 24
4: 206
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603
902626010_902626023 27 Left 902626010 1:17676769-17676791 CCCAGTCCCCTAAAGGCTCTGCC 0: 1
1: 0
2: 1
3: 15
4: 181
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603
902626017_902626023 -9 Left 902626017 1:17676805-17676827 CCCCCAGGCCTTTGCACCCACTG 0: 1
1: 4
2: 24
3: 214
4: 994
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603
902626014_902626023 19 Left 902626014 1:17676777-17676799 CCTAAAGGCTCTGCCTGAGCACT 0: 1
1: 0
2: 1
3: 16
4: 175
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603
902626018_902626023 -10 Left 902626018 1:17676806-17676828 CCCCAGGCCTTTGCACCCACTGC 0: 1
1: 2
2: 9
3: 63
4: 471
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603
902626013_902626023 20 Left 902626013 1:17676776-17676798 CCCTAAAGGCTCTGCCTGAGCAC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603
902626012_902626023 21 Left 902626012 1:17676775-17676797 CCCCTAAAGGCTCTGCCTGAGCA 0: 1
1: 1
2: 0
3: 16
4: 182
Right 902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG 0: 1
1: 0
2: 2
3: 52
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902626023 Original CRISPR CACCCACTGCTCTCCCTGCT GGG Intronic
900137473 1:1124463-1124485 CACCCAGTCCGCTCACTGCTTGG + Intergenic
900571710 1:3361867-3361889 CACCACCTGCCCTCCCTCCTGGG - Intronic
900604695 1:3518782-3518804 CACCCACAGCCCTGCCTTCTAGG + Intronic
900618499 1:3576318-3576340 CAGCCCCAGCTCTCCCTCCTTGG - Intronic
900620079 1:3582703-3582725 CAGACTCAGCTCTCCCTGCTTGG + Intronic
900949231 1:5848356-5848378 CACCCACTGCACTCCAGCCTGGG + Intergenic
901497606 1:9630862-9630884 CCCTCTCTGCCCTCCCTGCTGGG - Intergenic
901769699 1:11524047-11524069 CCCCCAGTGCTCACCCTGCAGGG - Exonic
902164707 1:14560955-14560977 CACACACTTCTCTTCCTGATGGG - Intergenic
902232409 1:15036335-15036357 CTCCCCCTGCCCTGCCTGCTCGG + Intronic
902583534 1:17424250-17424272 CACCAACTGCACTGTCTGCTCGG + Intronic
902626023 1:17676819-17676841 CACCCACTGCTCTCCCTGCTGGG + Intronic
902659194 1:17889630-17889652 CACACACTGTTCCCTCTGCTTGG - Intergenic
902730806 1:18367648-18367670 CACCCACTGCACTCCAGCCTGGG - Intronic
903212164 1:21824407-21824429 CAGCCTCTGCTCTCCAGGCTGGG - Exonic
904035256 1:27555575-27555597 CACCCACTGTCCTCCCTGTGAGG - Intronic
904305159 1:29584101-29584123 CACCCACTACCCTCCCTCCCAGG - Intergenic
904401886 1:30262294-30262316 CAGCCATTCCACTCCCTGCTGGG + Intergenic
904638692 1:31904814-31904836 CAGCCACTGCACTCCATCCTGGG - Intergenic
904737458 1:32645596-32645618 CCCCCACTGCACTCCATCCTGGG - Intronic
904738228 1:32651338-32651360 CACCCACTGCCCTCCTGGGTCGG - Intronic
904842027 1:33379133-33379155 CAGCCACTGCTCCCCATGCAGGG + Intronic
905565771 1:38963390-38963412 CACTCACTGCACTCCATCCTGGG + Intergenic
905616356 1:39403138-39403160 CACCCACTGCACTCCAGCCTGGG - Intronic
905818302 1:40969168-40969190 GAGCCACTGCTCTCCAGGCTGGG + Intergenic
906149792 1:43581027-43581049 GACCCACTGCTCTGCCTCCAGGG - Intronic
906389973 1:45406611-45406633 CACCCACTGCACTCCAGCCTGGG + Intronic
906641770 1:47445205-47445227 CTGCCACTCCACTCCCTGCTGGG + Intergenic
906986444 1:50688091-50688113 CACCCACTGCACTCCAGGCTGGG + Intronic
907359321 1:53902112-53902134 CACCAAGTTCTCTCCCTCCTTGG + Intronic
907623056 1:56001590-56001612 CATCCACTTCCCACCCTGCTGGG + Intergenic
908007292 1:59739950-59739972 CCCCCAGCGCTCTCCTTGCTGGG + Intronic
908195894 1:61745315-61745337 CACCCACTGCACTCCAGCCTGGG - Intronic
908791926 1:67791484-67791506 CCCACACTGCTCTCCCTTCTTGG + Intronic
909030539 1:70534022-70534044 CACCCACTGCACTCCAGCCTGGG - Intergenic
910758360 1:90713386-90713408 CCCCCGCTGCACACCCTGCTAGG + Intronic
910887261 1:91977825-91977847 CATCCACTGCACTCCAGGCTGGG + Intronic
912033176 1:105275033-105275055 CACACACTGCTCTGCCTGAGCGG + Intergenic
912430580 1:109626484-109626506 CACCCCCAGCTCTCCAGGCTGGG - Intronic
914357716 1:146901930-146901952 CACCCACTGCACTCCAGCCTGGG - Intergenic
914833646 1:151189806-151189828 CATCCAGAGCTCTCCCTTCTAGG + Intronic
915119895 1:153623230-153623252 CACCCACTGCACTCCAGTCTGGG - Intronic
915529973 1:156497796-156497818 GGCCCCCTGCTCTCCCTGGTTGG - Intronic
915534667 1:156528126-156528148 CACCCACTGCTCCTCATCCTGGG + Intronic
915583437 1:156829980-156830002 GACTCACTGCTCTCCTTGTTTGG - Intronic
917722036 1:177794934-177794956 CCTCCACTGCTCTACCTGCCTGG - Intergenic
918311740 1:183290033-183290055 CACCCTCTCCTCTCCCTGCCTGG + Intronic
918409458 1:184243775-184243797 CACCCCCTGCCCTCCCTCCCCGG + Intergenic
920192312 1:204201548-204201570 CAGCTTCTGCACTCCCTGCTGGG + Intronic
920938344 1:210456891-210456913 CACACGCTGCTCTTCCTTCTGGG + Intronic
921138898 1:212286312-212286334 CAGCCCCTGCGCTCGCTGCTGGG - Intronic
921580365 1:216889427-216889449 CACCCACTTCTGACCTTGCTGGG + Intronic
923580881 1:235211286-235211308 CAGCCACTGCACTCCAGGCTGGG + Intronic
924308421 1:242715454-242715476 CACCCACTGCACTCCAGCCTGGG + Intergenic
924910760 1:248510812-248510834 AACCCACTGCACTCACTGCTGGG - Intergenic
924913341 1:248537228-248537250 AACCCACTGCACTCACTGCTGGG + Intergenic
1062768434 10:82208-82230 CAGCCCCTCCCCTCCCTGCTGGG - Intergenic
1063270927 10:4509442-4509464 CACGCACTGCTCTCCACGTTTGG - Intergenic
1063383873 10:5603840-5603862 CACACACTGGTAACCCTGCTTGG + Intergenic
1063645659 10:7880193-7880215 CACTCACTGCTCTCCAGCCTGGG + Intronic
1064159887 10:12936398-12936420 CACCCACTGCACTCCAGCCTGGG - Intronic
1064251162 10:13707477-13707499 CACCCGCCGCCTTCCCTGCTGGG - Intronic
1065044315 10:21732350-21732372 CACACATAGCGCTCCCTGCTGGG + Intronic
1065129702 10:22608319-22608341 CCCTCACTGCTCCCCCTGCCTGG - Intronic
1065194358 10:23248189-23248211 CACCCTCTGTTCTGCCTGATGGG - Intergenic
1065255806 10:23866685-23866707 CACCTGCTACTCTCCCAGCTTGG + Intronic
1065521705 10:26579835-26579857 CACCCTCAGCTGGCCCTGCTTGG - Intergenic
1065729004 10:28693520-28693542 GTGCCACTGCTCTCCCTCCTGGG + Intergenic
1067054710 10:43043923-43043945 CACCCCTGGCTCTCCCTGCCGGG + Intergenic
1067188887 10:44053371-44053393 CACCCACTGCACTCCAGCCTGGG + Intergenic
1068337075 10:55647636-55647658 CACCCACTGCACTCCAGCCTGGG + Intergenic
1069175925 10:65287857-65287879 CAAGCACTGCTCTATCTGCTGGG - Intergenic
1069832132 10:71287853-71287875 CACCTTCTGCTCCCCATGCTGGG - Intronic
1069898527 10:71694125-71694147 CACCCACTTCTCTCTCTGGCAGG + Intronic
1069904408 10:71723983-71724005 AAACCTCTTCTCTCCCTGCTGGG + Intronic
1070332688 10:75429754-75429776 CACCTACTGCTGTCTCTGCTTGG - Intergenic
1070384975 10:75916278-75916300 CACCCACTGCTTAGCCTCCTTGG - Intronic
1070418136 10:76209110-76209132 CACCCACTGCACTCCAGCCTAGG + Intronic
1070565406 10:77600335-77600357 CACCTCCTGCTCTCCCCACTAGG - Intronic
1070775341 10:79106535-79106557 CACCCACTGATCGCCAAGCTGGG - Intronic
1070789526 10:79181073-79181095 AACCCACAGCTCTGCCTCCTGGG - Intronic
1070940037 10:80336495-80336517 CACACACTGCACTCTCTCCTAGG + Intronic
1072403887 10:95131559-95131581 CACCTACTGATTTCCCTCCTTGG + Intergenic
1072572710 10:96672736-96672758 CTCCCAGTCCTCTCCCAGCTGGG + Intronic
1072616802 10:97055401-97055423 CACCCCCTGCACTCCCACCTGGG - Intronic
1072687415 10:97546543-97546565 CACCCACTGCGCTCCAGCCTGGG + Intronic
1072813899 10:98486112-98486134 CAGCCATCCCTCTCCCTGCTTGG + Intronic
1073326716 10:102647526-102647548 CACCCCCTCCTCTCCCTCCTGGG - Intronic
1073785041 10:106879701-106879723 CACCCACAGCTCTCCTCACTTGG - Intronic
1074468691 10:113707235-113707257 AGCCCACTGCTCGCCCTGCTGGG - Intronic
1074468719 10:113707350-113707372 AGCCCACTGCTCGCCCTGCTGGG - Intronic
1074940021 10:118226166-118226188 CAACCACTGCACTCCATCCTGGG + Intergenic
1075776488 10:124992276-124992298 CACCCACTGCACTCCAGCCTAGG - Intronic
1076465394 10:130677817-130677839 CTCCCAATGCACTCCCTGCTGGG + Intergenic
1076908989 10:133378180-133378202 CACCCGCCCCTCTCCCTGCCTGG + Intergenic
1077140050 11:1020313-1020335 CACCCTCCCCTCTGCCTGCTTGG + Intronic
1077439374 11:2560851-2560873 CATCCACTGCTGCCTCTGCTGGG - Intronic
1077472347 11:2769951-2769973 GAGCCACTGAGCTCCCTGCTAGG + Intronic
1077487961 11:2847812-2847834 CACCAGCTGCTCTCCTTGCACGG + Exonic
1078262859 11:9727346-9727368 CACCCACTGCACTCCAGCCTGGG + Intronic
1078315591 11:10290575-10290597 CATCTACTCCTCTCCCTGCTGGG - Intronic
1078396984 11:10989833-10989855 CGTCCATTGCTCTCCCTGCTTGG - Intergenic
1078436831 11:11332356-11332378 CACCTGCTGTTCTCCCAGCTGGG - Intronic
1078529674 11:12127351-12127373 CAGGCACTGCTCTCAGTGCTGGG + Intronic
1079056584 11:17211404-17211426 CACACACTGTTCCCTCTGCTGGG - Intronic
1081672926 11:44951499-44951521 CACCCTTCTCTCTCCCTGCTTGG + Intergenic
1081679836 11:44994455-44994477 CACGCACTGGGCTCCCAGCTGGG + Intergenic
1083264728 11:61541430-61541452 CACCCCCTGCTCTCCCTGGAGGG - Intronic
1083306370 11:61764110-61764132 CACCCCCAGCTCGCCCAGCTAGG - Intronic
1083844455 11:65322718-65322740 CACTCCCTGACCTCCCTGCTAGG - Intergenic
1083960040 11:66009871-66009893 CACCCACTGCACTCCAGCCTGGG - Intergenic
1083976579 11:66126846-66126868 CTCCCACTCTTCTCTCTGCTTGG - Intronic
1084511160 11:69605012-69605034 CACCCACTGCACTCCAGCCTGGG - Intergenic
1084647813 11:70470105-70470127 CACCCACTGTTCTCCCCCTTTGG - Intronic
1084728383 11:71057290-71057312 CACCCACTGCCCTCCAGCCTGGG + Intronic
1084739782 11:71132154-71132176 CCCTCGCTGCTCTCCCTTCTGGG - Intronic
1084974173 11:72787552-72787574 CACACCCCGCTCTGCCTGCTGGG + Intronic
1085063398 11:73469952-73469974 ACCCCACTGCTCTCCAGGCTAGG - Intronic
1085211786 11:74787601-74787623 TAGCCACTGCACTCCCTCCTGGG + Intronic
1085222221 11:74884119-74884141 AACCCACTGCACTCCATCCTGGG + Intronic
1085614110 11:77981803-77981825 CACGCACTGCACTCCAGGCTGGG - Intronic
1085868823 11:80326264-80326286 ACACCACTGCACTCCCTGCTGGG + Intergenic
1085915075 11:80876927-80876949 GACCCACTGCTCTTCTTTCTAGG + Intergenic
1086068365 11:82771047-82771069 CAGCCACTGCTCTCCAGCCTGGG - Intergenic
1086250991 11:84814238-84814260 CATCCACTGCTCAACGTGCTGGG - Intronic
1087454088 11:98361690-98361712 CCTCCAGTGCTCTCTCTGCTTGG + Intergenic
1087923774 11:103896227-103896249 CACTTACTGCTCCCTCTGCTTGG + Intergenic
1088170190 11:106987608-106987630 CCCCCACTGCACTCCATTCTGGG + Intronic
1088315053 11:108498559-108498581 CACCCACTGCGCGCCCTGTAGGG + Intergenic
1088768297 11:113007232-113007254 CACCCACTGCACTCCAGCCTGGG - Intronic
1089305827 11:117525501-117525523 CACCCACTGCCCTCCAGGCTGGG - Intronic
1090452195 11:126816697-126816719 TAGCCACTGACCTCCCTGCTGGG - Intronic
1091140283 11:133228651-133228673 CTCCTACTGCTCTCGCTGCCAGG + Intronic
1091223711 11:133945720-133945742 CCAGCACGGCTCTCCCTGCTTGG - Intronic
1091252443 11:134154972-134154994 CACACACTGCTCTTCCTGTTTGG + Intronic
1091445384 12:541919-541941 CCCCCACTGCCCTCCCTCCTGGG + Intronic
1091558907 12:1595262-1595284 CACCCCCTGCTCCCCCGGTTGGG + Intronic
1091696815 12:2633329-2633351 CACCCACTCCTGCCCCTGGTGGG + Intronic
1091772459 12:3161856-3161878 CACCCACTGCACTCCAGCCTGGG - Intronic
1091903361 12:4163420-4163442 CACCCACTGCACTCCAGCCTGGG + Intergenic
1092095807 12:5841060-5841082 CACCCACTGCTCTCCCCGCCAGG + Intronic
1092116714 12:6014130-6014152 CACTCACTCTTCTCTCTGCTTGG - Intronic
1092172707 12:6383882-6383904 CTCCCTCTGCTCTCCCTGCGAGG + Intronic
1092443920 12:8535931-8535953 CACCCACTTCTCTCCTTTCCTGG - Intronic
1092498660 12:9024069-9024091 CACCCACTGCACTCCAGCCTGGG - Intergenic
1093959896 12:25260690-25260712 CACCTGCTGTTCTCCCTGCCTGG + Intergenic
1094493835 12:30977324-30977346 CCCACACTCCTTTCCCTGCTGGG + Intronic
1094591072 12:31821454-31821476 CAACCACTGCACTCCATCCTGGG - Intergenic
1095875746 12:47078965-47078987 CACACTCTGCCCACCCTGCTTGG - Exonic
1096211775 12:49771675-49771697 CACACACTGCACTCCATCCTGGG + Intergenic
1096517810 12:52167205-52167227 CACCCACTGCACTCCAGCCTGGG - Intergenic
1097263551 12:57733171-57733193 CACACACAGCTCACCCAGCTAGG - Intronic
1098366686 12:69710888-69710910 CACCCACTGCACTCCAGCCTGGG + Intergenic
1098658029 12:73057603-73057625 AGCCCGCTGCTCACCCTGCTGGG - Intergenic
1099978054 12:89566937-89566959 CACCTCCTTCTCTCCCTCCTGGG - Intergenic
1100436743 12:94578103-94578125 CACCCACTGCACTCCAGCCTGGG + Intronic
1100531374 12:95464721-95464743 CACCCACTGCACTCCAGCCTGGG + Intergenic
1101481017 12:105097162-105097184 CACCCACTGCACTCCAGACTGGG + Intergenic
1101565628 12:105902271-105902293 AAACCTGTGCTCTCCCTGCTAGG + Intergenic
1102928690 12:116846095-116846117 CACCCACTGTACACCATGCTAGG + Intronic
1103253528 12:119521542-119521564 CACACACTATTCCCCCTGCTTGG - Intronic
1103258412 12:119563301-119563323 CACCCACTGCACTCCAGCCTGGG + Intergenic
1103511107 12:121474911-121474933 CACTCACTGCTCTCCAGCCTGGG + Intronic
1103819477 12:123686088-123686110 CACACACTGCACTCCATCCTGGG - Intronic
1104040339 12:125125997-125126019 CACCCACTGCACTCCAGCCTGGG - Intronic
1105504366 13:20997665-20997687 CACCCTCTGCTCTCTTGGCTTGG + Intronic
1105505594 13:21006841-21006863 CTCCCACAGCTCGCTCTGCTGGG + Intronic
1105508485 13:21031811-21031833 CACCCACTGCACTCCGGCCTGGG + Intronic
1106127443 13:26911910-26911932 CACCCACTGCACTCCAGCCTGGG + Intergenic
1108273961 13:48789409-48789431 AGCCCACTGCTCTCCATACTGGG - Intergenic
1109756956 13:66773819-66773841 CACCCACTGCACTCCAGCCTGGG - Intronic
1109894677 13:68669258-68669280 CACCCACTGCACTCCAGCCTGGG - Intergenic
1109975213 13:69822153-69822175 CACCCACTGCACTCCAGCCTGGG + Intronic
1110119604 13:71865776-71865798 GGCCCTCTCCTCTCCCTGCTCGG - Intronic
1110520634 13:76472174-76472196 CACCAACTGCTCTCCAGTCTGGG - Intergenic
1111200686 13:84932248-84932270 CAGCCACTGCACTCCATCCTGGG - Intergenic
1111367495 13:87268741-87268763 CGCCCACTGCACTCCAGGCTGGG - Intergenic
1113069006 13:106400551-106400573 CAGACACTGCTCTGCCTGCAGGG + Intergenic
1113135158 13:107080814-107080836 GACCTACTGCTCTCCCTGCCTGG + Intergenic
1113328349 13:109305373-109305395 CACCTGCTTCTCTCTCTGCTTGG - Intergenic
1113544896 13:111140734-111140756 CTGCCACTGCACTCCCTCCTGGG - Intronic
1113571054 13:111358331-111358353 CACCCGCTGCACACACTGCTGGG - Intergenic
1114234659 14:20813533-20813555 CCCCCACATCTCTTCCTGCTGGG + Intergenic
1115019175 14:28654052-28654074 CAAGCACTGCTCTCAATGCTGGG - Intergenic
1115574069 14:34693946-34693968 CCCCCACTGCACGCCCTGCAAGG + Intergenic
1116946013 14:50835874-50835896 CCACCACTGCTCTCCCGCCTGGG - Intergenic
1117992038 14:61443229-61443251 CACCTACTGCTCTCACTGCAGGG + Exonic
1117994577 14:61466793-61466815 CTCCCGCTCCTCTGCCTGCTGGG + Intronic
1118331393 14:64818492-64818514 CACTCCCTGCTCTCCCTTCTGGG + Intronic
1118361931 14:65064129-65064151 TCCACACTGCTCTCCCTTCTTGG + Intronic
1119135448 14:72214216-72214238 CACCCACTGCTCTCCAGCCTGGG - Intronic
1119514024 14:75233896-75233918 TACCCACTTGTCTCCCTTCTTGG - Intergenic
1119878438 14:78080155-78080177 CACCCACTGCACTCCAGCCTGGG - Intergenic
1120662017 14:87261299-87261321 CACCCACTGCACTCCAGCCTGGG + Intergenic
1120919438 14:89741465-89741487 GCACCACTGCACTCCCTGCTGGG + Intergenic
1121027223 14:90625453-90625475 GAGCCACTGCTCTCCTGGCTGGG + Intronic
1121880560 14:97496894-97496916 GACCCACTTCTCACCCTGCAGGG - Intergenic
1122083610 14:99284380-99284402 CCACCTCTGCTCGCCCTGCTGGG + Intergenic
1122384307 14:101333584-101333606 CACCCGGTGATCACCCTGCTAGG - Intergenic
1122416790 14:101553747-101553769 CATTCACTGCACTCCCTGCAAGG - Intergenic
1122553965 14:102566633-102566655 CACCCACTGCACTCCAGCCTGGG - Intergenic
1122578327 14:102755684-102755706 CACCCAGGGCCCTCCATGCTCGG - Intergenic
1124252131 15:28113777-28113799 CTCCCTCTGTTCTCCCAGCTGGG - Intronic
1124693606 15:31845653-31845675 CTCCCACTGCTCTTCATACTAGG + Intronic
1124720096 15:32104293-32104315 CACTGGCTGCTCTCCCTGCCAGG + Intronic
1125491041 15:40148638-40148660 CACACACTGCTCTCCAAGGTGGG + Intergenic
1125586980 15:40827848-40827870 AGCTCACTGCTCTGCCTGCTGGG - Intronic
1127165004 15:56235518-56235540 AACCAAGTGCTCTCCATGCTTGG + Intronic
1127581278 15:60341190-60341212 TAGCCACTGCACTCCCTCCTGGG + Intergenic
1128681618 15:69656529-69656551 CACACACTGCTCTCCAGCCTGGG + Intergenic
1129342660 15:74896348-74896370 GCCCCACTGCCATCCCTGCTGGG + Intronic
1129651902 15:77496993-77497015 CGCCCTCTGCTGTCCCGGCTAGG + Intergenic
1129706572 15:77797961-77797983 CACCCACTTCTCTGCCTCCTTGG - Intronic
1130682647 15:86010140-86010162 CCCCCACTGCACACCCTGCAAGG - Intergenic
1130838197 15:87672482-87672504 CATCCTCTGCTCCCCCTGCTGGG - Intergenic
1131030768 15:89184522-89184544 CACTCACTGCTCTCCTCCCTTGG - Intronic
1131110077 15:89759423-89759445 CAGCCCCTGCTCACCCTGTTAGG - Intergenic
1132457304 16:31231-31253 CAGCCCCTCCCCTCCCTGCTGGG - Intergenic
1132662346 16:1067164-1067186 GCCCCACTGCACTCCCTCCTGGG - Intergenic
1132858003 16:2056016-2056038 CAGCCACTGCTCTCGGTGCTGGG - Intronic
1132995197 16:2819119-2819141 CACCCAGTTCTCTCCCTTCCAGG + Intronic
1133112155 16:3554454-3554476 GGTCCACTGCTCTCCCTGCATGG - Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133137990 16:3725531-3725553 CTGCCACTGCTCGGCCTGCTGGG - Exonic
1133207241 16:4240995-4241017 CACTGCCTGCTCTCCCTGCAGGG + Intronic
1133221487 16:4320886-4320908 CACCTAGTGGTCACCCTGCTTGG + Intronic
1133971941 16:10574500-10574522 CACCCACTGCTCCTCCAGCAGGG + Intronic
1133977272 16:10608139-10608161 CACCCACTGCACTCCAGTCTGGG + Intergenic
1134131164 16:11651149-11651171 CACCCCATGCTCACCCTCCTGGG - Intergenic
1134358490 16:13506998-13507020 GTACCACTGCACTCCCTGCTGGG + Intergenic
1134537938 16:15041516-15041538 CACACACTGCTGTCACTGCTTGG - Intronic
1134687840 16:16171070-16171092 CACCTGCTGCTCTCTCTGCCTGG + Intronic
1135100490 16:19600970-19600992 CACCCACTGCCCTCCAGCCTGGG - Intronic
1135147599 16:19976315-19976337 CACCCACTGCACTCCAGCCTGGG - Intergenic
1135260382 16:20975415-20975437 CTCCCACCTCTCTCCTTGCTAGG - Exonic
1135497868 16:22968406-22968428 TACCCTCTGCTGTCTCTGCTGGG + Intergenic
1135689597 16:24525676-24525698 CACCCACTGCACTCCAGTCTGGG - Intergenic
1136003294 16:27312485-27312507 CACCCACTGCACTCCAGCCTAGG + Intergenic
1136014492 16:27386766-27386788 CACCAGCTGCTCTACCTTCTCGG + Intergenic
1136572856 16:31107165-31107187 CCGCCACTGCTCTCCATCCTGGG - Intronic
1136608847 16:31354267-31354289 CACCCACTGCACTCCAGCCTGGG + Intergenic
1136989306 16:35142398-35142420 CCCCCACTCCTCTACCAGCTAGG - Intergenic
1138112855 16:54338401-54338423 CACCCACTGCACTCCAGCCTGGG - Intergenic
1138480430 16:57299266-57299288 CACCCACTGCACCCCCACCTCGG + Intergenic
1139976467 16:70815362-70815384 CACCCACTGCACTCCAGCCTGGG + Intronic
1140503180 16:75452490-75452512 CTCCCACTGCACTCCATCCTGGG - Intronic
1143056101 17:4162904-4162926 AACCCAGTGCTCTCCCTGGCTGG + Intronic
1143614105 17:8039455-8039477 CCCCCAGTGCTGCCCCTGCTGGG + Exonic
1143965100 17:10751419-10751441 CACCCACTGCTCTCTCTCCCTGG + Intergenic
1144643655 17:16953809-16953831 CACCCACTGCACTCCAGCCTGGG - Intronic
1144856056 17:18268509-18268531 CACCCACTCCCCTCCCCGCGAGG + Intergenic
1145278650 17:21453075-21453097 CCCCCAGTCCTCTCCCCGCTCGG - Intergenic
1145399203 17:22517410-22517432 CCCCCAGTCCTCTCCCTGCTGGG + Intergenic
1146208688 17:30925226-30925248 CACTCACTGCACTCCAGGCTGGG - Intronic
1146537794 17:33668164-33668186 CTCCCATTGCTCCCCCTGCCTGG + Intronic
1146622319 17:34408617-34408639 CACCTGCTGTTCTCTCTGCTTGG - Intergenic
1147234677 17:39048585-39048607 GACCCATTGCTCTCCAGGCTGGG + Intergenic
1147447992 17:40486670-40486692 GACCCCCTGCTTTCTCTGCTGGG + Intronic
1147833492 17:43313925-43313947 CACCCACTGCACTCCAGCCTGGG - Intergenic
1148525701 17:48331064-48331086 CACCCACTGCTCTTTGTTCTAGG - Intronic
1148833700 17:50453831-50453853 CACCCACTGCACTCCAGCCTGGG - Intronic
1149201872 17:54196133-54196155 CACTCTCTCCTCACCCTGCTTGG + Intergenic
1149723156 17:58865656-58865678 CAGCCACTGCTCTCCAGACTGGG + Intronic
1149993222 17:61394167-61394189 CACCCACCACTTTCCCTGCCTGG - Intergenic
1150039174 17:61840312-61840334 CGCCCACTGCACTCCATCCTGGG + Intronic
1150176766 17:63065931-63065953 CACCCACTGCACTCCAGTCTGGG - Intronic
1150285848 17:63953637-63953659 CACCCACTGCACTCCAGCCTGGG + Intronic
1150983430 17:70169269-70169291 CACCTGCTGCTGTCCCAGCTGGG + Intronic
1151641692 17:75400037-75400059 CACCCACTGCACTCCAGACTGGG - Intronic
1151681787 17:75626281-75626303 CTCCCACTGCACGCCATGCTGGG - Intergenic
1152439173 17:80295017-80295039 CACCAGCTGCTCTACCTGCTGGG + Intronic
1152570136 17:81118055-81118077 CACCCTCTGCCCTGCCTGCCTGG - Exonic
1152628986 17:81401317-81401339 CACCCGCTTCCCTCCCTGCCTGG + Intronic
1153187370 18:2500401-2500423 CACCCCGTCCTCTCCCTGCTGGG - Intergenic
1153233904 18:2967478-2967500 CACCCCCTGCCCTCCCTGACCGG - Intronic
1153500483 18:5744290-5744312 CACATACTGCTCTTCCTGCCTGG + Intergenic
1154028755 18:10731393-10731415 CACCCACCACTCACCCTCCTTGG + Exonic
1154166812 18:12021559-12021581 CAGCCACTGCACTCCAGGCTGGG - Intronic
1156304357 18:35862853-35862875 CATCCACTGTTCCCCCTACTTGG - Intergenic
1156515610 18:37677237-37677259 TGCTCACTGCTCTCCCTGCCAGG + Intergenic
1157220612 18:45826262-45826284 CACCCACTGGGATTCCTGCTGGG - Intronic
1157619335 18:49007066-49007088 CACCCACTCCTCTCTCAGCCTGG + Intergenic
1157932806 18:51841866-51841888 CACCCACTGCACTCCAGTCTGGG - Intergenic
1159194637 18:65096794-65096816 GACCCACTGCTCTCCAGCCTGGG + Intergenic
1159603521 18:70451631-70451653 CCTCCTCTGCCCTCCCTGCTAGG + Intergenic
1161018859 19:1998459-1998481 CAGCCACCGCTTTCCCAGCTGGG - Intronic
1161433753 19:4249658-4249680 CACACACTGCTGCCCCTGCTTGG + Intronic
1161485571 19:4533907-4533929 GCCCCACTCCTCTCCTTGCTGGG - Intronic
1161758184 19:6150054-6150076 CACCCACTGCACTCCAGCCTGGG + Intronic
1161912674 19:7206207-7206229 CACCCACTGCACTCCAGCCTGGG - Intronic
1162036937 19:7945616-7945638 CACCCACTGCACTCCACCCTGGG + Intergenic
1162653905 19:12114231-12114253 CACACACTGCTCTCCCTGTGTGG - Intronic
1162805735 19:13137168-13137190 CACCCCAGGCCCTCCCTGCTGGG - Intronic
1162840450 19:13352650-13352672 CTGCCACTGTTCTCCATGCTGGG + Intronic
1163438900 19:17311670-17311692 CACCTGCTGCTCTTTCTGCTCGG + Intronic
1163443926 19:17335516-17335538 CACCCACTGCACTGCATCCTGGG + Intronic
1163511335 19:17736989-17737011 CACCCACTGCACTCCAGCCTGGG - Intergenic
1163657438 19:18555386-18555408 CACCCACTGCACTCCAGCCTGGG - Intergenic
1164107507 19:22121826-22121848 CACCCACTGCACTCCAGCCTGGG - Intergenic
1165081146 19:33307012-33307034 CAACCACTGCTCTCCAGCCTGGG - Intergenic
1165394344 19:35556188-35556210 CACCTGCTGTTCTCCCTGCCAGG - Intronic
1165462295 19:35951199-35951221 TACCCAATGCTCTCTCTCCTGGG - Intergenic
1165821273 19:38677782-38677804 CACCCACTGCACTCCAGCCTGGG - Intronic
1165856731 19:38883455-38883477 CACCCACTGAACTCCCCGCGTGG + Intronic
1165893406 19:39127861-39127883 CACACACTGCTCCTCCTGCCTGG - Intronic
1165910549 19:39223738-39223760 CACCCACTGCACTCCAGCCTGGG + Intergenic
1165964042 19:39559616-39559638 CACCCCCTGCTCACACTGCTGGG + Intergenic
1166283555 19:41810333-41810355 CTCCCACAGCTCTGCCTTCTCGG + Exonic
1166514501 19:43436248-43436270 CTGCCACTGCTCTCCCGCCTGGG + Intergenic
1166688031 19:44807826-44807848 CGCCCACTGCATTCCCGGCTGGG + Intergenic
1166699389 19:44873588-44873610 ACCCCACTGCTCTCCATCCTGGG + Intronic
1167108696 19:47446469-47446491 CACCCACTGCACTCCAGCCTGGG - Intronic
1167825797 19:51971851-51971873 CACCCAATTCTGTCCCTGTTTGG - Intronic
1168236193 19:55064654-55064676 CGCCCACTGCTCTCCAGCCTGGG - Intronic
1168461650 19:56564657-56564679 CTGCCACTGCACTCCCTCCTGGG - Intergenic
925405836 2:3605194-3605216 CACACTCTGCTGTCCCTTCTTGG - Intronic
926134361 2:10326171-10326193 CACCCACCCCTCTTCCTTCTGGG - Intronic
926664783 2:15509329-15509351 CACCAACTGTTCTCCTTACTAGG + Intronic
927109536 2:19854502-19854524 CACTTACTGCTCCCGCTGCTTGG - Intergenic
927408674 2:22800626-22800648 CTCCCACTGCTGTCTGTGCTGGG - Intergenic
927480947 2:23453519-23453541 CCCCCACTGCACTCCCAGCAAGG - Intronic
927877163 2:26665547-26665569 CCCCCACCTCTCTCCCTGATGGG + Intergenic
928203544 2:29267519-29267541 CAGCCAGTGCCCTCCCTGCTGGG - Intronic
928539131 2:32267828-32267850 CAGCCACTGCTCTCCAGCCTGGG - Intergenic
928904656 2:36356335-36356357 CACCTCCTGGTCTCGCTGCTGGG + Exonic
929707334 2:44227558-44227580 CACCCACTGCACTCCAGCCTAGG - Intronic
930130752 2:47847659-47847681 CACCCACTGCACTCCAGCCTGGG + Intronic
931331016 2:61283549-61283571 CACCCACTGCTTTCCTTTTTTGG - Intronic
931443515 2:62307807-62307829 CGCCCACAGGTCTCCTTGCTAGG - Intergenic
932071572 2:68626031-68626053 CACCTGCTGCTTCCCCTGCTTGG - Intronic
932104210 2:68928044-68928066 CAACCACTGCTCTATCTTCTTGG - Intergenic
932258766 2:70309419-70309441 CACCCACTGCACTCCAGCCTGGG - Intergenic
932424480 2:71620431-71620453 CACCCTCTGCTCTTCCTCCAGGG - Intronic
932427083 2:71644936-71644958 CCCCCACTGCACACCCTGCAAGG - Intronic
932610249 2:73193660-73193682 CACCCACTGCACTCCAGCCTGGG + Intergenic
933279464 2:80317067-80317089 CACCTTCTGTTCTCTCTGCTTGG - Intronic
933730625 2:85453532-85453554 CAGACACTGTTCTACCTGCTAGG - Intergenic
934145369 2:89088442-89088464 CACCCACTGCACTCCTGCCTGGG - Intergenic
934223887 2:90112109-90112131 CACCCACTGCACTCCTGCCTGGG + Intergenic
934526032 2:95052293-95052315 TCTCCACTGCTCTTCCTGCTGGG + Intronic
935187602 2:100748138-100748160 CACCCTCTCCTCCCCCTGCCTGG - Intergenic
935671215 2:105558754-105558776 CACCCACTGCACTCCAGCCTGGG - Intergenic
935685826 2:105681734-105681756 CACCCACTGCACTCCACCCTGGG + Intergenic
936051095 2:109224131-109224153 CTCCCACTTCTGCCCCTGCTTGG + Intronic
936660303 2:114535964-114535986 CACATGCTGCTCTCTCTGCTTGG + Intronic
937454608 2:122030593-122030615 CTCCCACTGCCCTCCCTGGAGGG + Intergenic
937556587 2:123165541-123165563 CACCCACTGCACTCCAGCCTGGG - Intergenic
938573361 2:132582678-132582700 GTCACAGTGCTCTCCCTGCTGGG - Intronic
938973696 2:136455967-136455989 CACCCTCCTCTCTTCCTGCTGGG + Intergenic
941233553 2:162941236-162941258 CACCCACTGCACTCCAGCCTGGG + Intergenic
941374204 2:164707183-164707205 CACCCACTGCACTCCAACCTAGG - Intronic
943864336 2:192909449-192909471 CAGCCACTGCACTCCCACCTGGG - Intergenic
944289934 2:197993700-197993722 CCCCCAGTTTTCTCCCTGCTGGG - Intronic
944863733 2:203840364-203840386 CACACACTGATTTCTCTGCTTGG - Intergenic
945144951 2:206728378-206728400 CACCTGCTGCTACCCCTGCTTGG + Intergenic
945262572 2:207858518-207858540 CACTCACTGCACTCCAGGCTGGG - Intronic
945686151 2:212972719-212972741 CACTCCCTTCTCTGCCTGCTTGG + Intergenic
946267475 2:218559265-218559287 TACCCACTGCACTCCCGCCTGGG + Intronic
947929332 2:233950608-233950630 CACCTGCTGACCTCCCTGCTGGG + Intronic
948029093 2:234801638-234801660 CATCCTCTGAGCTCCCTGCTGGG + Intergenic
948156633 2:235788573-235788595 CTCCCACTCCTCTCCTTGCCCGG - Intronic
948525418 2:238568109-238568131 CACCCATTGCACACCCTGCAAGG + Intergenic
948588219 2:239034532-239034554 CACACACTGCTCACCCTGCCTGG + Intergenic
948814398 2:240502501-240502523 CACACACTGCATACCCTGCTGGG - Intronic
1168790486 20:572766-572788 CACCCACTGCTCCCTCTGCCTGG - Intergenic
1169132324 20:3172768-3172790 CCCCTCCTGCTCTCCCTGCCCGG - Intronic
1169238458 20:3953193-3953215 CACGCACTGCACTCCACGCTGGG - Intronic
1169321334 20:4635470-4635492 CTCCCTCTGCTCCCTCTGCTTGG + Intergenic
1169555133 20:6741358-6741380 CCCCCTCTTCTCTTCCTGCTGGG - Intergenic
1170839800 20:19915337-19915359 CACCCACTGCCATCCCTCCTTGG + Intronic
1171254577 20:23679755-23679777 CACCCTCTCCACTCCATGCTGGG - Intergenic
1171261063 20:23735027-23735049 CACCCTCTCCACTCCATGCTGGG - Intergenic
1171270182 20:23810869-23810891 CACCCTCTCCACTCCATGCTAGG - Intergenic
1172956514 20:38763404-38763426 CCCTCTCTGCTGTCCCTGCTGGG + Intronic
1173486128 20:43442537-43442559 CACCCAGCTTTCTCCCTGCTTGG + Intergenic
1173659040 20:44720275-44720297 CACTCCCTCCTCTCCCTTCTTGG + Intronic
1173900212 20:46582163-46582185 CACCCACTGCACTCCAGCCTGGG - Intronic
1173995680 20:47336923-47336945 CAATCACTGATCTACCTGCTGGG + Intronic
1174177757 20:48655857-48655879 CACCCATTGCCCTCCCTGGCAGG - Intronic
1174235887 20:49091381-49091403 CACCCACTGCACTCCATCCTAGG + Intronic
1174909633 20:54593212-54593234 CACCCACTGCACTCCAGCCTGGG + Intronic
1175310521 20:58008616-58008638 CTCCCACTGCTCTGCCTGGTGGG - Intergenic
1175405305 20:58722249-58722271 CACCCTCTGCCCTCTCAGCTCGG + Intergenic
1175733865 20:61372079-61372101 CACCCAGGTCTCTCCCTCCTGGG + Intronic
1176304973 21:5118555-5118577 CACCTGCTGCTCTCCCTGTGGGG - Intronic
1176416269 21:6476762-6476784 CACCCACTGCACTCCAGCCTGGG + Intergenic
1177764416 21:25440452-25440474 CACTCTATGCTCTCCCTGCTAGG - Intergenic
1178037543 21:28601381-28601403 CACCTACTGATCTCTCTTCTTGG + Intergenic
1178347411 21:31842293-31842315 CACCTTCTGCCCTCTCTGCTGGG + Intergenic
1178366234 21:31991258-31991280 CACCCACTGCACTCCAGCCTGGG - Intronic
1178434032 21:32541508-32541530 CACCCACTGCACTCCAGCCTGGG + Intergenic
1179134798 21:38669978-38670000 CACCAACTGCTCTCCCTTATGGG - Intergenic
1179547369 21:42121889-42121911 CATGCCCTGCCCTCCCTGCTGGG - Intronic
1179580078 21:42338006-42338028 CGCCCTCTGCTATCCATGCTGGG - Intergenic
1179691769 21:43085097-43085119 CACCCACTGCACTCCAGCCTGGG + Intergenic
1179852082 21:44143475-44143497 CACCTGCTGCTCTCCCTGTGGGG + Intronic
1179983906 21:44910745-44910767 CCCCCACTGCTCGCCCTGGTGGG - Exonic
1180568135 22:16692620-16692642 CACTCACTCTTCTCTCTGCTTGG - Intergenic
1180758080 22:18177122-18177144 CTGCCACTGCTCTCCCCACTGGG - Exonic
1180768368 22:18360914-18360936 CTGCCACTGCTCTCCCCACTGGG - Intergenic
1180777941 22:18501477-18501499 CTGCCACTGCTCTCCCCACTGGG + Intergenic
1180800495 22:18629653-18629675 CAGCCTCAGCTCTCCCTGCAAGG - Intergenic
1180810665 22:18758788-18758810 CTGCCACTGCTCTCCCCACTGGG + Intergenic
1180826245 22:18864138-18864160 CTGCCACTGCTCTCCCCACTGGG - Intergenic
1180851730 22:19025210-19025232 CAGCCTCAGCTCTCCCTGCAAGG - Intergenic
1180872254 22:19152924-19152946 CACCCACTGCACTCCAGCCTGGG - Intergenic
1181049231 22:20230905-20230927 CACCCACTGCCCTGCCTGAGCGG + Intergenic
1181196813 22:21193043-21193065 CTGCCACTGCTCTCCCCACTGGG + Intergenic
1181212715 22:21300081-21300103 CTGCCACTGCTCTCCCCACTGGG - Intergenic
1181221224 22:21365609-21365631 CAGCCTCAGCTCTCCCTGCAAGG + Intergenic
1181305162 22:21912268-21912290 CACCAACTGCTCACCCTCTTGGG + Intergenic
1181438923 22:22925653-22925675 CACCTACTGCGCTCGGTGCTGGG - Intergenic
1181815862 22:25436461-25436483 GACCCCCTGCTCTCCCTCCAGGG - Intergenic
1181875455 22:25937120-25937142 CACTCACTGCACTCCCGCCTGGG - Intronic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1182696870 22:32204062-32204084 CACCCAATCCACTCCCTGCCAGG + Intergenic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1183583616 22:38739669-38739691 CACCCACAGCTCTCCTCCCTGGG - Intronic
1183711588 22:39507285-39507307 CACCCACTGCACTCCAGCCTGGG - Intronic
1183786884 22:40034485-40034507 CAGCTTCTGCTCTCCCAGCTAGG + Exonic
1184103864 22:42355984-42356006 AACCCCCTTCTCTCCCTCCTGGG - Intergenic
1184227290 22:43136399-43136421 CACCCACTGCTCTTTCTGTAGGG + Intronic
1184421498 22:44385122-44385144 CCCCCACTGCTGTGCCCGCTGGG - Intergenic
1184454938 22:44604409-44604431 CACCCCCCGGGCTCCCTGCTGGG - Intergenic
1184515995 22:44963152-44963174 GACTCCCTGCTCTCCCTTCTGGG + Intronic
1185371620 22:50463489-50463511 CACCTGCTGCCCTCCCTGCCAGG - Intronic
1203229987 22_KI270731v1_random:101802-101824 CTGCCACTGCTCTCCCCACTGGG - Intergenic
1203276387 22_KI270734v1_random:90044-90066 CTGCCACTGCTCTCCCCACTGGG - Intergenic
949502267 3:4692097-4692119 CACCCACTGCACTCCAGCCTGGG + Intronic
950427658 3:12933128-12933150 CCTCCACTTCTCTCCCTGCGGGG - Intronic
950478561 3:13229713-13229735 CACACACTGTTCCCCCTGCTGGG + Intergenic
951366422 3:21788434-21788456 CACCCACTGCACTCCAGCCTGGG + Intronic
952564158 3:34635055-34635077 CCCCCACTGCACAGCCTGCTAGG - Intergenic
952866189 3:37856666-37856688 CACCCACAGGTCTCTCTCCTGGG - Intergenic
953166277 3:40467857-40467879 CACCCACTGCACTCCAGCCTGGG - Intergenic
953485718 3:43293145-43293167 CAGCCACTGCACTCCATCCTGGG - Intronic
953651981 3:44814349-44814371 CACCCACTGCACTCCAGCCTGGG - Intronic
954236478 3:49260913-49260935 GCTCCACTGCTTTCCCTGCTGGG + Intergenic
954629231 3:52039299-52039321 CTCCCACGCCTCTCCCTGCTAGG + Intergenic
954694258 3:52412157-52412179 CACCCACTGCACTCCAGCCTGGG + Intronic
954931174 3:54283249-54283271 CCACCACTGCTGTCCCTGCCAGG - Intronic
954967521 3:54624578-54624600 CACCCACTGCACTCCAGCCTGGG + Intronic
955112277 3:55960742-55960764 CACCCAATCCACTCTCTGCTGGG + Intronic
955408994 3:58643770-58643792 AACACTCTGCTCTCCCAGCTGGG + Intronic
955520217 3:59768426-59768448 CACATACTGTTCTCCCTGCATGG + Intronic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
956422711 3:69101363-69101385 CCCCCACTGCACTCCTGGCTGGG - Intronic
956928056 3:74010659-74010681 TAACCACTGTTCTCCCTGGTAGG + Intergenic
959187725 3:103068004-103068026 CTGCCACTGCACTCCATGCTGGG + Intergenic
961081957 3:124034388-124034410 CGCCCACCGCCCTCCCAGCTGGG - Intergenic
961317841 3:126052621-126052643 CATCTGCTGCTCTCCCTGCAGGG + Intronic
961325111 3:126105039-126105061 TCCCCAGTGCTCTGCCTGCTGGG - Intronic
961390246 3:126548390-126548412 GACCCACTCTTATCCCTGCTGGG - Intronic
961575766 3:127834962-127834984 CACACCCAGCTCTCCCTCCTGGG - Intergenic
962919219 3:139935758-139935780 CACCCACTGCGCTCCCACCCCGG - Intronic
963100849 3:141602466-141602488 CACCCACTGCTGCTCCTGCTGGG + Intronic
963493028 3:146025076-146025098 CACCCACTGCACTCCAGCCTGGG - Intergenic
963859579 3:150294773-150294795 CACCCACTGCACTCCAGCCTGGG + Intergenic
964328789 3:155577215-155577237 CACCCACTGCACTCCAGCCTGGG + Intronic
964367930 3:155969606-155969628 CTGCCACTGCTCCCTCTGCTTGG + Intergenic
964982779 3:162706723-162706745 CACATACTGTTCTCCATGCTGGG - Intergenic
965905559 3:173701084-173701106 CACCCACTGCACTCCAGCCTGGG + Intronic
966144483 3:176794272-176794294 TTCCCACTGCCCTCCCTACTGGG - Intergenic
966950396 3:184812090-184812112 CTCGCACTGCTCCCCCTCCTGGG - Intergenic
967023778 3:185546121-185546143 CAGCCACTGCACTCCAGGCTGGG + Intronic
967160514 3:186733443-186733465 CACCTACTGTTCTCTCTGCCTGG + Intronic
967893804 3:194381925-194381947 TCCCCACTGCACTGCCTGCTGGG - Intergenic
968041238 3:195591085-195591107 CACTCCTTTCTCTCCCTGCTGGG - Intergenic
968289956 3:197531352-197531374 CACCCACTGCACTCCAGCCTGGG + Intronic
968777436 4:2552052-2552074 CAGCCACTGCACTCCAGGCTGGG - Intronic
968900724 4:3430605-3430627 CTCCCACTGCTCGCCAGGCTGGG - Exonic
968902964 4:3439791-3439813 CACCCCCTGCCCTCCTGGCTGGG - Exonic
969061891 4:4442572-4442594 CACCCACTGCACTCCAGCCTGGG + Intronic
969153298 4:5188483-5188505 CACTCACTGTTCTCTCTGCCTGG + Intronic
969313176 4:6366252-6366274 GACCCATTGCTCAGCCTGCTGGG - Intronic
969853766 4:9982910-9982932 CACCCATTGCACTCCCGTCTGGG - Intronic
970321699 4:14881247-14881269 CTCCCACTGCTTTCTGTGCTTGG - Intergenic
971012181 4:22450303-22450325 CATCCACTGCTCTCCAGCCTGGG - Intronic
971559345 4:28055849-28055871 CACCCACTGCACTCCAGCCTGGG + Intergenic
972318347 4:37948583-37948605 CACCCACTGCACTCCAGCCTGGG + Intronic
973880901 4:55270126-55270148 CAGCCACTGCTCGACCCGCTTGG + Intergenic
973910249 4:55572801-55572823 CACCCACTGCACTCCGGCCTGGG - Intronic
974653494 4:64786417-64786439 TATCCACTGCTCTCACAGCTGGG + Intergenic
975031921 4:69631639-69631661 TACACACTCCTCTCCTTGCTTGG - Intronic
975596788 4:76054788-76054810 CATCCACTGCACTCCAGGCTAGG + Intronic
975600998 4:76099258-76099280 CACCCACTGCACTCCAGCCTGGG + Intronic
976243262 4:82981982-82982004 CACCCACTGCACTCCAGACTGGG + Intronic
976247336 4:83016985-83017007 GAGCCACTGCACTCCCAGCTTGG - Intergenic
976354278 4:84097980-84098002 CAACATCTGCTCTCCCTTCTGGG + Intergenic
977037445 4:91973044-91973066 CACCCACTGCACTCCAGCCTGGG + Intergenic
977502549 4:97859505-97859527 GCCCCACTGCACTCCCTGCCTGG - Intronic
977834271 4:101630771-101630793 CACCCACTGCACTCCAGCCTGGG - Intronic
980248180 4:130275253-130275275 TACCAACTTCTCTCCCTCCTTGG + Intergenic
982384280 4:154782524-154782546 CTGCCACTGCTCTCCCGCCTGGG - Intronic
983062269 4:163173517-163173539 CCCCAACTGTTCTCCCTCCTTGG - Intergenic
983539115 4:168889615-168889637 CATCCACTACTCTCCCTGAGAGG + Intronic
984160738 4:176249512-176249534 GACTCTCTGCTCTCCCTGATTGG + Intronic
984171700 4:176367953-176367975 CACCCATTTGGCTCCCTGCTAGG - Intergenic
985138538 4:186813888-186813910 CACCCACTGCACTCCAGCCTGGG + Intergenic
985698846 5:1358568-1358590 CACCCACTGAACTGCCTGCTCGG + Intergenic
986558976 5:9041629-9041651 CACCCTCACCTCTCCCTGCATGG - Exonic
987342406 5:16950510-16950532 CACCCACTGCACTCCAGCCTGGG + Intergenic
987579790 5:19775088-19775110 CATTCACTGCTGCCCCTGCTGGG - Intronic
988671014 5:33381852-33381874 CACCCACTGCACTCCACCCTGGG - Intergenic
991722634 5:69508075-69508097 CACCCACTGCACTCCAGCCTGGG - Intronic
992205832 5:74429650-74429672 CACCCACTGTTTTCTCTGCCTGG + Intergenic
992918800 5:81489984-81490006 CAGCCACTGCACTCCAGGCTGGG + Intronic
993340221 5:86716352-86716374 CAGGCACTGTGCTCCCTGCTGGG + Intergenic
993466785 5:88257225-88257247 CACTCACTGCTCTCCAGCCTGGG + Intronic
996807103 5:127468275-127468297 AATCCACTGCTCCCTCTGCTTGG + Intergenic
997472741 5:134125692-134125714 CTCCCAGTGCTCCCCCTCCTTGG - Intronic
997605269 5:135170716-135170738 CACCCACTTGTCACCCTGCCAGG - Intronic
997673665 5:135696554-135696576 CTCCCTGTGCTCTCTCTGCTGGG + Intergenic
998272881 5:140723506-140723528 CCCCCACTGCACTCCCGCCTGGG - Intergenic
999137512 5:149332351-149332373 CACCCACTGCACTCCACCCTGGG + Intronic
999141909 5:149367928-149367950 TACCCACTGAACTCCCTACTGGG - Intronic
999243964 5:150143645-150143667 CACCCACATCTCAGCCTGCTTGG - Intronic
999454765 5:151706016-151706038 CACCCACTGCACTCCAGCCTGGG + Intergenic
999635149 5:153614024-153614046 CACCTGCTTCTCTCGCTGCTCGG + Intronic
999667768 5:153931818-153931840 CACATACTGTTCTCCCTTCTTGG + Intergenic
999771738 5:154781024-154781046 CACCCACTGCACTCCAGCCTAGG + Intronic
999787601 5:154906036-154906058 CACCCACTGCACTCCAGCCTGGG - Intronic
1000812105 5:165875783-165875805 CAATCACTTCTCTCCTTGCTTGG + Intergenic
1001274340 5:170339379-170339401 CACACTCTGCTCCCCTTGCTGGG + Intergenic
1001307401 5:170585519-170585541 CACCCACTAGTCTCCCAGCATGG + Intronic
1002319066 5:178364383-178364405 CACCCTCAGCTCACCCTCCTGGG - Intronic
1002375458 5:178785677-178785699 CACCCACTGCACTCCAGCCTGGG + Intergenic
1002594923 5:180315859-180315881 CCCCCACACCTCCCCCTGCTGGG + Intronic
1003195658 6:3911967-3911989 CGCACACTCCTCTCCCTGCTAGG + Intergenic
1005297618 6:24442162-24442184 CACCCACTGCACTCCAGCCTGGG - Intronic
1005343895 6:24870546-24870568 CACCCACTGCACTCCAGCCTGGG - Intronic
1005958036 6:30678246-30678268 CACCCACTGCACTCCAGCCTGGG - Intronic
1006820727 6:36892372-36892394 CAGCAACTGCACTCCCGGCTGGG - Intronic
1006986176 6:38177138-38177160 TAATCCCTGCTCTCCCTGCTCGG + Intronic
1007150123 6:39682050-39682072 CAGGCACTGGTCTCACTGCTAGG + Intronic
1008345653 6:50423286-50423308 CACCCACTGCACTCCAGCCTGGG + Intergenic
1009702805 6:67204366-67204388 CAGCCACTGCACTCCCGCCTGGG + Intergenic
1010162024 6:72867889-72867911 CAGCCACTGCACTCCAGGCTGGG + Intronic
1011184512 6:84659334-84659356 CACCTCCTCCTCTCCATGCTTGG - Intergenic
1011819183 6:91230409-91230431 CTCTCACTTCTCTACCTGCTTGG + Intergenic
1013015640 6:106158583-106158605 CAACCAGTGCTCCTCCTGCTAGG + Intergenic
1013141151 6:107336210-107336232 GAGCCACTGCACTCCCAGCTTGG + Intronic
1013272848 6:108559559-108559581 CTCCCGCTGCTGTCCCCGCTGGG - Intergenic
1014113456 6:117646316-117646338 CGGCCAGAGCTCTCCCTGCTGGG - Intergenic
1014294640 6:119603646-119603668 CACCCACTCCTCTTCCTCCTGGG - Intergenic
1015150282 6:130029860-130029882 CACCCACTGCACTCCAGCCTGGG - Intronic
1015921283 6:138268950-138268972 GACCAAGTGTTCTCCCTGCTAGG - Intronic
1015950790 6:138550523-138550545 CAACCACTTCTCTCCCTTGTAGG + Intronic
1016130464 6:140461976-140461998 CACCCACTGCACTCCAGCCTAGG + Intergenic
1016165302 6:140935105-140935127 CACCCACTGCACTCCAGCCTGGG - Intergenic
1017294284 6:152776147-152776169 CTCCCACTGCACCCCCTGATAGG - Intergenic
1018153914 6:160967318-160967340 CAGCCACTGCTCCCACTGCTGGG - Intergenic
1019484557 7:1283523-1283545 CCCCCTCCACTCTCCCTGCTGGG - Intergenic
1019978197 7:4601309-4601331 CACCCACTGCACTCCAGCCTGGG + Intergenic
1020026041 7:4900796-4900818 CACACCTTGCTCTTCCTGCTAGG + Intergenic
1020140525 7:5609078-5609100 CACCCACTGCACTCCAGCCTGGG + Intergenic
1020248388 7:6448251-6448273 CACCCACTGCACTCCAGCCTGGG - Intronic
1022896257 7:34752780-34752802 CACACACTGCTCTCTCTACCTGG + Intronic
1023068999 7:36409710-36409732 CACTCACTGCACTCCATCCTGGG - Intronic
1023130885 7:37001960-37001982 CACCAACTTATCTCCCAGCTTGG - Intronic
1023179361 7:37466013-37466035 CACCCACTGCACTCCAGCCTGGG + Intergenic
1023874940 7:44281843-44281865 TGCCCACTGCTCTCCCGGCCAGG + Intronic
1025227429 7:57177646-57177668 CACCCTGTGGTCTTCCTGCTAGG - Intergenic
1025716419 7:63961492-63961514 CCCCCACTGCACTCCAGGCTGGG + Intergenic
1025730446 7:64102652-64102674 CACCCTGTGGTCTTCCTGCTAGG + Intronic
1027206453 7:76103727-76103749 CACCCACTGCACTCCAGCCTGGG + Intergenic
1027252578 7:76408475-76408497 CACCCACTTCTCAGGCTGCTGGG + Intronic
1029093432 7:98066676-98066698 CACCCACTGCACTCCAGCCTAGG - Intergenic
1029432238 7:100539025-100539047 CACGCACGGTTCTCGCTGCTGGG + Intergenic
1030838833 7:114322062-114322084 CACCCACTGCACTCCAGCCTGGG - Intronic
1032313248 7:130808658-130808680 CACCCACTGCACTCCAGCCTGGG - Intergenic
1032419166 7:131764241-131764263 CACCCACTGTGCTCCCTGGCTGG - Intergenic
1032489111 7:132310732-132310754 CAACATCTGCTCTCCCTACTGGG + Intronic
1032575644 7:133050971-133050993 GAACCACTGCTCTCCAGGCTGGG + Intronic
1033060059 7:138097530-138097552 TACACCCTGCTCCCCCTGCTGGG - Intronic
1033124715 7:138697567-138697589 CACCCACTGCACTCCAGCCTGGG + Intronic
1033554141 7:142473790-142473812 CAGCCACTCCTCTGTCTGCTGGG - Intergenic
1034761323 7:153674616-153674638 CACCCACAGCTGTGCCTCCTTGG + Intergenic
1034889505 7:154827617-154827639 CACCCCCTCCTCACTCTGCTTGG - Intronic
1034889523 7:154827681-154827703 CACCCCCTCCTCACTCTGCTTGG - Intronic
1035788628 8:2283386-2283408 CACCCCCTGCTCCCACTGTTTGG - Intergenic
1035804177 8:2438319-2438341 CACCCCCTGCTCCCACTGTTTGG + Intergenic
1035946760 8:3971948-3971970 CACCCACTGCACTCCAGCCTGGG - Intronic
1036205084 8:6799674-6799696 CACCCACTGCACTCCAGCCTGGG - Intergenic
1036649001 8:10630172-10630194 CCTCCACTGCACTCCCAGCTGGG - Intronic
1036702389 8:11021566-11021588 CAGCCACTGCTCTCTGAGCTGGG - Intronic
1036964175 8:13277268-13277290 CCCCCACTGCTCTCCAGCCTGGG + Intronic
1037068610 8:14615396-14615418 AGCTCACTGCTCTCACTGCTGGG + Intronic
1037633633 8:20680233-20680255 AACCCACTGCACTCCATCCTGGG + Intergenic
1037862879 8:22418573-22418595 CACACACTGCACTCCAGGCTAGG - Intronic
1037899420 8:22678740-22678762 GAACCACTGCCCTACCTGCTGGG - Intergenic
1038041565 8:23727849-23727871 CATTCACTGCTCTCCCAGCCTGG + Intergenic
1038255335 8:25946038-25946060 CAGCCACTTCTCTCACTGCCTGG + Intronic
1039197273 8:35046895-35046917 CACCTACTGCTCTCCAGCCTGGG - Intergenic
1039746411 8:40431813-40431835 CACCCACTGCACTCCAGCCTGGG + Intergenic
1039910766 8:41825168-41825190 CAGCCACTGCTCGCCCGACTAGG + Intronic
1040310698 8:46235343-46235365 CACCCAGAGCTGTCCCTGGTGGG + Intergenic
1041177218 8:55209179-55209201 AACACACTGCTCTCCCTCTTTGG - Intronic
1041714111 8:60918159-60918181 CACACACTGCTGTCACTGATTGG - Intergenic
1042269091 8:66937676-66937698 CACCCACTGCACTCCAGCCTGGG + Intergenic
1042582173 8:70292030-70292052 CACCCACTGCACTCCAGCCTGGG + Intronic
1042925781 8:73967175-73967197 CAGGCACTGCTCTACATGCTTGG + Intronic
1043384734 8:79737273-79737295 CCTCCACTTCCCTCCCTGCTGGG - Intergenic
1043418196 8:80073058-80073080 CACCCACTGCACTCCAGCCTGGG + Intronic
1043447523 8:80333592-80333614 CACCCACTGCACTCCAGCCTGGG - Intergenic
1044621888 8:94198723-94198745 CCCCTGCTGCTCTCCCTGCCTGG + Intronic
1045934456 8:107662824-107662846 CACCCACTGCACTCCAGCCTGGG + Intergenic
1047019672 8:120761499-120761521 CACCCATTATTCTCCCTTCTGGG - Intronic
1047747468 8:127855564-127855586 CACCCACTTGTCTCCCTTCCCGG - Intergenic
1048601722 8:135925461-135925483 AACCCTCTGCTCTTGCTGCTTGG - Intergenic
1049111870 8:140651332-140651354 CACCCACTGCACTCCAGCCTGGG - Intergenic
1049426410 8:142539856-142539878 CACTCACTTCTGCCCCTGCTGGG - Intronic
1049567709 8:143350051-143350073 CACCCTCTTCTCTCCCCACTGGG + Intronic
1049792430 8:144478182-144478204 CCGCCACTGCTCTCCCTGGCCGG - Intronic
1050435029 9:5599979-5600001 CCCCCAGTGCCTTCCCTGCTGGG - Intergenic
1050998366 9:12248042-12248064 CACCCACTGCACTCCAGCCTGGG + Intergenic
1051576451 9:18621716-18621738 CAAGCACTGTTCTCACTGCTTGG + Intronic
1053128596 9:35602470-35602492 AACCCACTGCACTCCATCCTGGG + Intergenic
1054673424 9:67829474-67829496 CACCCACTGCACTCCAGCCTGGG - Intergenic
1055912529 9:81368649-81368671 CAGCCACTGCTCTCCAGCCTGGG + Intergenic
1056546904 9:87620793-87620815 CATCTATGGCTCTCCCTGCTTGG + Intronic
1056786244 9:89594503-89594525 GACCTACTGCTCTCCCTGATGGG - Intergenic
1056963863 9:91149882-91149904 CACCCACTGCACTCCAAGCCTGG - Intergenic
1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG + Intronic
1057399796 9:94712987-94713009 TTTCCACTGCTCTCCCTGCTTGG + Intergenic
1057500408 9:95593324-95593346 CAGCCACTGCTCTTCCTGCTGGG - Intergenic
1059501505 9:114757785-114757807 AACCCACTGCCCTCCCAGATAGG - Intergenic
1060141269 9:121212440-121212462 CACCCTCTTCTCTCCCTGCCAGG + Intronic
1060343052 9:122793494-122793516 CACCCACTGCACTCCAGCCTGGG + Intergenic
1060565137 9:124584136-124584158 CACCCACTGCACTCCAGCCTGGG - Intronic
1060772488 9:126342648-126342670 CTCCCACCTCTCTCCCTGTTAGG - Intronic
1061070181 9:128305077-128305099 CAGCCACTGCTCTGGGTGCTGGG - Intergenic
1061107700 9:128544526-128544548 CTCCCAGTGCTCTCCTTTCTTGG - Intergenic
1061425038 9:130493480-130493502 CAACCTCTACTCTCCGTGCTTGG + Intronic
1061551212 9:131335784-131335806 CACCCACTGCACTCCAGCCTGGG - Intergenic
1061688452 9:132304060-132304082 CAGCCACTGCACTCCAGGCTGGG + Intronic
1061843581 9:133374976-133374998 CACACAAGGCTCTCCCTGCGGGG + Intronic
1061990487 9:134156105-134156127 AACACACTCCCCTCCCTGCTGGG - Intronic
1062057416 9:134475695-134475717 CTCCCACTGGCCTCTCTGCTTGG + Intergenic
1062076268 9:134591635-134591657 TACCCAATGCACTCCCTCCTGGG + Intergenic
1062434841 9:136542335-136542357 CCGCCACTGCGCTCCCGGCTCGG - Intronic
1062547919 9:137071991-137072013 GAGCCACTGCTCTCCATCCTGGG + Intergenic
1062664308 9:137659592-137659614 CACCCACTGCACTCCAGCCTGGG - Intronic
1062736842 9:138142103-138142125 CAGCCCCTCCCCTCCCTGCTGGG + Intergenic
1185765012 X:2718252-2718274 CACCAAATGCTCTCTCTCCTAGG - Intronic
1187159813 X:16753912-16753934 AACACCCTTCTCTCCCTGCTTGG + Intronic
1187478775 X:19635767-19635789 CACCCCCTCCTGTCCCTGCATGG + Intronic
1187877661 X:23817362-23817384 CTCCCGCTGCCCTGCCTGCTAGG + Intergenic
1190555815 X:51634432-51634454 CACCCACTGCACTCCAACCTGGG - Intergenic
1192234657 X:69288031-69288053 CACCCACTGCACTCCCGTCTGGG + Intergenic
1192594432 X:72391688-72391710 CACACACTGTTCCCTCTGCTTGG + Intronic
1193834213 X:86322455-86322477 CACCGACGGTTCTCCCTCCTTGG + Intronic
1194514190 X:94829552-94829574 CACCCACTGCACTCCAGTCTGGG - Intergenic
1194535620 X:95103199-95103221 CCCCCATTGCTCACCCTGCAAGG - Intergenic
1197173098 X:123456188-123456210 CACACACTGTTCTCAGTGCTGGG + Intronic
1197777243 X:130126446-130126468 CACCCACTGCACTCCAGCCTGGG + Intergenic
1200399054 X:156008154-156008176 CAGCCCCTCCCCTCCCTGCTGGG + Intronic
1201732534 Y:17220257-17220279 CACCCACTGCACTCCAGCCTGGG - Intergenic