ID: 902626620

View in Genome Browser
Species Human (GRCh38)
Location 1:17680243-17680265
Sequence CTGAGGAAACAGCAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902626620_902626631 22 Left 902626620 1:17680243-17680265 CCAGCATCCTGCTGTTTCCTCAG 0: 1
1: 0
2: 2
3: 38
4: 394
Right 902626631 1:17680288-17680310 CCTGTGCCCAGCGAGCCTTCCGG 0: 1
1: 0
2: 1
3: 17
4: 183
902626620_902626634 30 Left 902626620 1:17680243-17680265 CCAGCATCCTGCTGTTTCCTCAG 0: 1
1: 0
2: 2
3: 38
4: 394
Right 902626634 1:17680296-17680318 CAGCGAGCCTTCCGGCCCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902626620 Original CRISPR CTGAGGAAACAGCAGGATGC TGG (reversed) Intronic
900998199 1:6134153-6134175 CTGAAGAAACTGCGGGATGAGGG - Exonic
902436211 1:16399466-16399488 CTGTGGGCAGAGCAGGATGCAGG + Exonic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902990356 1:20183430-20183452 CTTTGGAAACTGCTGGATGCAGG + Intergenic
903372923 1:22848441-22848463 CTGAGCTACCAGGAGGATGCTGG + Intronic
903553159 1:24172862-24172884 GTGAGGACACAGCAAGATGACGG - Intronic
904680226 1:32223893-32223915 CTTGGGAAACAGCAGGGAGCTGG - Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905280819 1:36847969-36847991 CCTAGGAACCAGCAGGATACTGG + Intronic
906033532 1:42737544-42737566 GTCAGGATCCAGCAGGATGCAGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
906811802 1:48834591-48834613 CTGAGGACACAGCAAGAAGGAGG + Intronic
907044993 1:51295114-51295136 CTCAGGGAACAGCTGGATGTGGG + Intronic
907190263 1:52642183-52642205 CTTAAGAAACAGCAGTATGGGGG + Intronic
907634165 1:56116832-56116854 GTGAAGAAACAGCAGGAAGGGGG + Intergenic
907935571 1:59039107-59039129 CTGAGGCAGCACCAGGAGGCAGG - Intergenic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908619967 1:65967374-65967396 GTCAGGAAACAGCAAGTTGCTGG + Intronic
910631786 1:89363021-89363043 CAGAGGACATAGCAGCATGCTGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911628817 1:100158968-100158990 CTTAGGAAACAACAGGTTGAAGG - Intronic
912396452 1:109348349-109348371 GTGAGTAAACAGCAGCATCCTGG + Intronic
912451617 1:109770812-109770834 CTGAGGAAAGAGCAGCCTCCGGG + Intronic
913452608 1:119002161-119002183 CTCAGGAAACACCCGGATGTGGG + Intergenic
913591623 1:120334191-120334213 CTAAGCAAACAGAAGCATGCAGG + Intergenic
913702801 1:121389653-121389675 TTGAGGAAAGAGCAGCATGTGGG + Exonic
914043364 1:144070157-144070179 TTGAGGAAAGAGCAGCATGTGGG + Intergenic
914134722 1:144890338-144890360 TTGAGGAAAGAGCAGCATGTGGG - Exonic
914447618 1:147763251-147763273 ATGAGGATACAGCAGGAAGGAGG + Intronic
914787056 1:150843294-150843316 CTGAGGAAATAGCAAGGTGTTGG + Intronic
914898585 1:151698455-151698477 GTGAAGAAACAGCAGTATGCTGG - Exonic
915274177 1:154776653-154776675 GTGAGGAAACAGCAGGGTTGGGG - Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916100335 1:161388807-161388829 GTGAGGAAACTGCAGGAGGCTGG - Intergenic
916109105 1:161449616-161449638 CGGAGGAAAGGACAGGATGCTGG - Intergenic
916112278 1:161464407-161464429 CGGAGGAAAGGACAGGATGCTGG - Intergenic
916727542 1:167536120-167536142 GTGAGGAAACAGCAAGAAGGCGG + Intronic
917141157 1:171837569-171837591 GTGAGGACACAGCAGGAAGGTGG - Intergenic
917717091 1:177749254-177749276 CTGAAAAAACATTAGGATGCTGG + Intergenic
918584489 1:186170157-186170179 GTCAGGAAACAACAAGATGCTGG + Intronic
919046350 1:192457519-192457541 CTGAGGACACAGCAAGAAGGTGG - Intergenic
919304457 1:195812802-195812824 CTGTGGAAACAGCAATATTCTGG - Intergenic
920490233 1:206408394-206408416 TTGAGGAAAGAGCAGCATGTGGG + Intronic
921051211 1:211513074-211513096 CTGAGGAAAGAGGAGGCTGTTGG + Intergenic
922567433 1:226610140-226610162 CTGAGGAAATGGCAGGAGGCAGG - Intergenic
922928460 1:229370610-229370632 CTGAGGTAACAGCAGAGTGCAGG - Intergenic
922997094 1:229972926-229972948 CTGAGGACACAGTAGGTTGCAGG - Intergenic
923627219 1:235623771-235623793 CTGGGGAGACAGCATGATGAGGG - Intronic
924955842 1:248925841-248925863 CAAAGGAAAGAGCAGGATCCTGG - Intergenic
1063421276 10:5914534-5914556 CTGAGCAAACATCACAATGCTGG - Intronic
1064277742 10:13922070-13922092 CTGAGGACACAGCAAGAAGGTGG + Intronic
1065208328 10:23378350-23378372 ATGAGGAAACTGAAGCATGCAGG + Intergenic
1066662454 10:37749706-37749728 CTGAGAACACAGCATGCTGCTGG - Intergenic
1067004064 10:42644645-42644667 CTGAGGTACCAGCATGATCCTGG - Intergenic
1067687531 10:48476152-48476174 CTGAGGAGACAGCAGCGAGCTGG - Intronic
1067764109 10:49072333-49072355 CTCAGGAACCAGCTGGTTGCTGG + Intronic
1067894847 10:50167783-50167805 CTCAGCACACAGCAGCATGCTGG - Intergenic
1068984646 10:63095911-63095933 CTGAGGAAACAGCATTTGGCCGG + Intergenic
1069958750 10:72067540-72067562 CTGAGGACACAGGTGTATGCTGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1071416073 10:85442632-85442654 ATTAGGAAACAGCAGGTAGCCGG - Intergenic
1072444370 10:95485557-95485579 ATAAGGAGACAGCAGGATGAGGG + Intronic
1072547091 10:96448162-96448184 CAGCGGAACGAGCAGGATGCAGG - Intronic
1072669510 10:97419097-97419119 TTGAGGAAGCCGCAGGCTGCCGG + Intronic
1072826247 10:98609781-98609803 CATAGGAAACAGCAGGAGCCTGG - Intronic
1073233289 10:101991204-101991226 CTGAGGAAAATGCAGAATTCTGG + Intronic
1075129444 10:119725911-119725933 CGGAGGAAAGGGCAGGAAGCGGG + Intergenic
1075503473 10:123000169-123000191 ATCAAGAAACAGAAGGATGCCGG + Intronic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1077501916 11:2913154-2913176 CTGAGGGAGCAGCAGGATATGGG + Intronic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1079029738 11:16977584-16977606 CTGTGTAAACAGCATGGTGCTGG - Intronic
1079164331 11:18024830-18024852 CTGGGGAAACAGCAAGAAGCTGG - Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1081194106 11:40140243-40140265 ATGAGGAGGCAGCAGGAGGCAGG - Intronic
1082874781 11:57977336-57977358 GTGAGGACACAGCAAGAAGCTGG + Intergenic
1083475452 11:62912410-62912432 CTGGGGCAAAAGCAGGAAGCAGG + Intronic
1084346090 11:68549923-68549945 CTGTGGAGACAGCAGGAGTCTGG + Intronic
1084800630 11:71541397-71541419 CTGAGAAAAATGCAAGATGCAGG + Intronic
1085024880 11:73230569-73230591 CTGAGGAAACAGAAGCAGTCTGG + Intronic
1085028005 11:73249845-73249867 CTGAGGAACAAGAAGAATGCTGG + Intergenic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085217740 11:74847491-74847513 CAGAGGAAACAGCATGAAACAGG - Intronic
1085931232 11:81086082-81086104 CTGAGGAAGCACCTGGATGGCGG - Intergenic
1088190646 11:107224566-107224588 CTGAGGAAAAAGAATGTTGCTGG + Intergenic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089642509 11:119857058-119857080 GTGAGGACACTGCAGGCTGCAGG + Intergenic
1090157449 11:124455930-124455952 GTGAGAAAACGGCAGAATGCAGG - Intergenic
1090769799 11:129909767-129909789 CTGTGGAAACAGTAGCAGGCTGG - Intronic
1091037295 11:132245542-132245564 CTGAGGAGAGAGCACGATGGAGG + Intronic
1093680268 12:21994172-21994194 GTGAGGATACAGCAGAATGGTGG + Intergenic
1096269353 12:50152028-50152050 CTGAGGAAACACCATGTTTCAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096718685 12:53505781-53505803 CTGAGGACACGGCAGCAGGCAGG - Exonic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098501800 12:71201616-71201638 CTGATGAAACAGGAGCATACAGG - Intronic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099265724 12:80445005-80445027 CTGAAGAAACAGCAGAATGCAGG - Intronic
1099710247 12:86214595-86214617 GTGAGGACACAGCAAGAGGCTGG - Intronic
1100326395 12:93543692-93543714 CTGAGGAAGCATCTGAATGCAGG - Intergenic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103352239 12:120292245-120292267 GTGCGGAAACAGCAGGGTGGGGG + Intergenic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1103940734 12:124499974-124499996 CCGAGGAAACAGCTCGCTGCAGG + Intronic
1103954953 12:124570919-124570941 CTGAGGATACAGCAGTGAGCTGG - Intergenic
1104224195 12:126815119-126815141 CTGAGAAAGCTGCAGGCTGCAGG - Intergenic
1104285926 12:127424657-127424679 GTGAGGACACAGCAAGATGGCGG + Intergenic
1104892624 12:132147804-132147826 GGGAGGCAACAGCATGATGCTGG - Intronic
1104980381 12:132570823-132570845 CTCAGGACCCAGCAGGCTGCGGG - Intronic
1106172048 13:27296695-27296717 CTCAGGGAGCAGGAGGATGCAGG - Intergenic
1107018586 13:35729126-35729148 CTGTGGAATCAGAAAGATGCAGG + Intergenic
1107477693 13:40755499-40755521 CTGGGGAAACAGCCTGATGGAGG + Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107977386 13:45703420-45703442 CTAAGGAAACAGCTGATTGCAGG - Intronic
1108209529 13:48124353-48124375 CAGAGGAAACAGCTGCCTGCAGG - Intergenic
1109599820 13:64610584-64610606 CTAAGGCAACAACATGATGCTGG + Intergenic
1110819313 13:79896269-79896291 CTGAGGCTGCAGCATGATGCTGG + Intergenic
1111898371 13:94169856-94169878 CTGAGAAAATAGGAAGATGCTGG - Intronic
1112146331 13:96704611-96704633 CTGAGGAAGAAGCCAGATGCAGG + Intronic
1112471462 13:99693510-99693532 CTGAGGAAATCCCAGGATGCTGG - Intronic
1113662323 13:112116234-112116256 CTGAAAAAAAAGCATGATGCTGG + Intergenic
1113988686 13:114340973-114340995 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1114356680 14:21917273-21917295 CTCAGAAAACATCAGGCTGCAGG - Intergenic
1114387098 14:22266869-22266891 CCTAGAAAAGAGCAGGATGCTGG - Intergenic
1114544266 14:23487007-23487029 CTGAGCAAACAGCATGCTGTGGG + Intronic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1114885564 14:26845402-26845424 CTGAGGGAACATAAGGATTCTGG + Intergenic
1115343022 14:32312175-32312197 CTGAGGGAAGAGGAAGATGCAGG + Intergenic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1118021503 14:61720551-61720573 GTGAGGAAACTTCTGGATGCTGG + Exonic
1118443619 14:65833057-65833079 CTAAGGAAGCTGCAGGAAGCTGG + Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1123002141 14:105301289-105301311 GTGAGGACTCAGCCGGATGCGGG + Exonic
1123216172 14:106811055-106811077 CTGAAGAAAGAGCAGGACCCAGG + Intergenic
1123628779 15:22246321-22246343 CTCAGAAAACAGGAGGATGTGGG + Intergenic
1123998358 15:25734218-25734240 CTGTGGATCCAGCAGGCTGCAGG + Intronic
1124154085 15:27209871-27209893 GTGAGGACACAGCAGGAAGGTGG - Intronic
1124461911 15:29899911-29899933 CTGAGGATACAGCAGTGAGCAGG + Intronic
1124664314 15:31579172-31579194 CTGAGGAAAAAACATGAGGCAGG + Intronic
1124986463 15:34621007-34621029 TCCAGGAAACAGCTGGATGCTGG - Intergenic
1125504549 15:40259339-40259361 CTGAGGACACAGCCTGATGCTGG + Intronic
1125968822 15:43895438-43895460 CTGAGGTATCTGCAGGATGCAGG - Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1127955466 15:63849078-63849100 CTCTGGAAACACCAGGCTGCTGG + Intergenic
1128095220 15:64949135-64949157 CTGTGGAAACAGACAGATGCTGG - Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128698985 15:69790154-69790176 CTGAGGGAAAAGGAGGATGTGGG - Intergenic
1128836703 15:70814669-70814691 TGCAGGAAGCAGCAGGATGCTGG + Intergenic
1131059016 15:89393011-89393033 CTGAGGAGGTTGCAGGATGCGGG + Intergenic
1132698997 16:1214279-1214301 CTGAGGAAAGGAGAGGATGCAGG - Intronic
1132706423 16:1245452-1245474 CGGAGGAGACAGGAGGATCCGGG - Intergenic
1133451619 16:5908904-5908926 GTGAGGACACAGCAAGAAGCTGG + Intergenic
1135168615 16:20163647-20163669 CTGAGGGACCAGCAGGATCCTGG + Intergenic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1136609447 16:31357230-31357252 CTGGGGACACAGCGGGCTGCTGG - Intronic
1138681452 16:58686240-58686262 GTGAGGACACAGCAGGAAGATGG - Intergenic
1139913303 16:70412064-70412086 CTGAAGAAAGAGCAGGTTGTTGG - Intronic
1139959337 16:70708789-70708811 GTGAGGAGACAGCTGGGTGCGGG + Intronic
1140735832 16:77896943-77896965 CTTTGGAAACAGCAGAATCCTGG - Intronic
1140840814 16:78837352-78837374 CAGAGGAAAAAGCAAGTTGCTGG - Intronic
1142953077 17:3500136-3500158 GTGAGGAAGCTGCAGGAAGCTGG + Exonic
1143096643 17:4481800-4481822 CTCAGGAATCTGCAGGACGCAGG - Intronic
1143139570 17:4733721-4733743 CTGCGGGTACAGGAGGATGCAGG + Exonic
1143210658 17:5184917-5184939 GGGAGGAAAGAGCAGTATGCTGG - Intronic
1143812811 17:9486234-9486256 TTGAGGAAACAGCAGATTCCAGG + Intronic
1144442698 17:15298088-15298110 CAGAAGAAACAGCTGAATGCAGG - Intergenic
1144759095 17:17697223-17697245 CTGAAGAGACAAGAGGATGCAGG + Intronic
1145266248 17:21380873-21380895 CTGAGGACACACCAGGAAACAGG - Intronic
1147545734 17:41400072-41400094 CTGAGGAAATAGCTGCTTGCTGG - Intergenic
1147557120 17:41486572-41486594 CTGAGGAAACAAAATCATGCAGG + Intronic
1149132659 17:53323941-53323963 CTGAGGAGACAACAGGAAGAAGG + Intergenic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1149696860 17:58622929-58622951 CTTAGCAAACTGCTGGATGCAGG - Exonic
1150435010 17:65146983-65147005 CTGAGGAGGCAACAGGCTGCAGG - Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1151993170 17:77591659-77591681 CTGGGGACACTGCAGGCTGCTGG + Intergenic
1152250198 17:79208499-79208521 CTGGGGAAACAGCCAGAAGCTGG - Intronic
1152888379 17:82865850-82865872 CTGAGGAAAAAGCAGCCTCCAGG - Intronic
1155036444 18:22028842-22028864 CTGAGAAAACTCCAGGATGCCGG + Intergenic
1156519031 18:37705968-37705990 GTGAGACACCAGCAGGATGCTGG + Intergenic
1156723689 18:40101778-40101800 GTGAGGACACAGCATGATGCTGG - Intergenic
1157106315 18:44777635-44777657 CTGAGGACACAGGAGGTTCCTGG + Intronic
1158489309 18:57895437-57895459 CTGAGCAAACAGGAAGACGCTGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1159583734 18:70262942-70262964 CTCAGGAAACAGGAAGATGTGGG + Intergenic
1159668018 18:71187834-71187856 CTTAGGAAAGAACTGGATGCTGG - Intergenic
1160676267 19:392975-392997 CTGAGAAATCAACAGGATGGGGG - Intergenic
1160705569 19:528624-528646 GTCAGGTAACAGCATGATGCAGG + Intergenic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1163534482 19:17869308-17869330 CTGGGGACACAGCATGATCCAGG - Intergenic
1165095219 19:33406532-33406554 CGGAGGAAACAGCAAGGTGGTGG + Intronic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1166736400 19:45087848-45087870 CTGTGGCTGCAGCAGGATGCTGG + Intronic
1166875181 19:45892595-45892617 CTGAGGAAGGAGCAGGGTGGGGG - Intronic
1167593895 19:50417698-50417720 CTGAGCAAACAGCCCGCTGCGGG + Intronic
1167705121 19:51077543-51077565 CGGAGTAAAGATCAGGATGCTGG + Intronic
924959103 2:17867-17889 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
925821353 2:7802630-7802652 CTGAGGATACAGCAGTAAACAGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
929665719 2:43832213-43832235 TTAAGGACACAGCAGGATACAGG + Intronic
931291640 2:60879515-60879537 CTGGGGGAACAGCAGGCAGCAGG - Intergenic
931701443 2:64912527-64912549 TTCAGGATACAGCAGGATGGAGG + Intergenic
932453486 2:71831203-71831225 GTGAGGAAACAGCAGATTTCAGG + Intergenic
933660557 2:84924255-84924277 TTGAGGAAACTGCAGGCTTCTGG + Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934945852 2:98540962-98540984 CTTTGAAAACAGCAGGATTCTGG - Intronic
935211987 2:100946220-100946242 CTGAGGAAAATGCAGCATGGAGG + Intronic
935865825 2:107386679-107386701 CTGAAGGAACAGCTGGATGCTGG - Intergenic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
937771878 2:125728982-125729004 CTGACCAAACAGCAGGATGTGGG + Intergenic
939070465 2:137534447-137534469 CTGAGGAGACAGCAAAATACAGG + Intronic
939675981 2:145072320-145072342 ATGAGGAAACTGCTGGAGGCTGG - Intergenic
939937978 2:148315180-148315202 CTAATGTAGCAGCAGGATGCAGG - Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942958239 2:181799206-181799228 CTCAGGAAACAACAAGATCCTGG - Intergenic
944904579 2:204250015-204250037 CTTAGGAACCACCAGGAGGCTGG - Intergenic
945184218 2:207123319-207123341 TTGATGAAAAATCAGGATGCTGG + Intronic
945333368 2:208563846-208563868 CTCAGGAAACAGTAAGATGTAGG - Intronic
945411010 2:209506972-209506994 CGGAGGAAAAAACAGGAAGCAGG - Intronic
945781448 2:214178453-214178475 CTGAGGAAACATCTGGATGTGGG + Intronic
945837882 2:214853944-214853966 GTGAGGACACAGCAGGAAGATGG + Intergenic
947328292 2:229001490-229001512 CTCAGGAAACACCAGGATTCTGG + Intronic
948408325 2:237739743-237739765 CTGAGTGACAAGCAGGATGCAGG - Intronic
1168872917 20:1146326-1146348 CTGAGGAAACAGTAGGTTAGAGG + Intronic
1170046195 20:12087973-12087995 CTAAGGAAGCAGAAGAATGCTGG - Intergenic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1170882900 20:20313214-20313236 GTGAGGACACAGCAGGAAGGTGG + Intronic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1175116407 20:56685741-56685763 CTGAGGAGCAAGCAGGAGGCTGG - Intergenic
1176885240 21:14247679-14247701 CTGTAGAGAAAGCAGGATGCTGG + Intergenic
1177488789 21:21794193-21794215 CTGAGGAACCAAGAGAATGCCGG - Intergenic
1177520918 21:22224338-22224360 CTGAGGAAACAACAGAAGGCAGG + Intergenic
1177757376 21:25363283-25363305 TTGAGGAAACTGCAGGAAGGGGG + Intergenic
1179080961 21:38170333-38170355 CTGAGACAACAGGTGGATGCTGG + Intronic
1179677815 21:42996333-42996355 AAGAGGAAACATCAGGGTGCAGG + Intronic
1179896054 21:44364361-44364383 CTGGGGCAAGAGCAGGAGGCTGG + Intronic
1180788443 22:18559800-18559822 GTGAGGAAAAAGCAGGAATCTGG + Intergenic
1181233294 22:21435518-21435540 GTGAGGAAAAAGCAGGAATCTGG - Intronic
1181245356 22:21499325-21499347 GTGAGGAAAAAGCAGGAATCTGG + Intergenic
1181515786 22:23411473-23411495 CTGAGGGAACAGCTGGTTGGTGG - Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182234730 22:28866358-28866380 CTGAGGGAATAGCAGGATGAGGG + Intergenic
1182785700 22:32905882-32905904 CTGAGGAAACCTCAGCTTGCAGG + Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184101939 22:42345302-42345324 CTCAGGAAGCAGCAGCATGCAGG - Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184982974 22:48107265-48107287 CTGAGGCAAAAGCCAGATGCAGG - Intergenic
950109216 3:10407789-10407811 CTGAGCAAACCTCAGGAAGCAGG - Intronic
950279943 3:11698201-11698223 ATGAAGAAACAGCTGGAGGCTGG + Intronic
950885579 3:16359563-16359585 GTGAGGACACAGCAGGAAGGTGG + Intronic
951061695 3:18215846-18215868 GTGAGGAAACAGCAAGAAGGTGG + Intronic
952787969 3:37175491-37175513 GTGAGTAACCAGCAGCATGCAGG - Intronic
954099213 3:48356453-48356475 CAGAGGAAACTGCAAGAGGCTGG + Intergenic
955628426 3:60946115-60946137 GTGAGGATACAGGAGGATGACGG + Intronic
955644726 3:61124928-61124950 CTGATGAAACATCAGCATGGAGG - Intronic
955789331 3:62572244-62572266 ATGAGGAAACAGAAGGACCCAGG - Intronic
958945808 3:100360639-100360661 CTTAGACAACAGCATGATGCAGG - Intergenic
960684805 3:120285438-120285460 CTGAGGAGACGGCCGGAGGCGGG - Intergenic
960948243 3:122981599-122981621 CCGAGGACAAAGCAGCATGCTGG + Intronic
961349750 3:126292265-126292287 CTGAGGAATTAGCAGGCTCCAGG + Intergenic
961742371 3:129040774-129040796 CTGGGGAAACTGCAGGAGTCAGG + Intergenic
961839626 3:129697927-129697949 CTCAGGAGACAGGAAGATGCAGG - Intronic
962930403 3:140030604-140030626 CTGAGGAAACAGCACCAGGGTGG + Intronic
963069553 3:141291797-141291819 GTGAGGAGACAGCAGCAAGCAGG + Intronic
964379532 3:156084011-156084033 TGAAGGAAATAGCAGGATGCTGG - Intronic
965529606 3:169757899-169757921 CAGAGGACACGGCAGGGTGCGGG + Intergenic
965531483 3:169774335-169774357 CTGAACAAACAGCGGGAAGCAGG + Exonic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
965768186 3:172153525-172153547 CTGAGGAAGGAGCAGGCTGGGGG + Intronic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966643357 3:182215328-182215350 GTGAGGATACAGCAGGAAGATGG - Intergenic
966773395 3:183523475-183523497 GTGAGGAAAAAGGGGGATGCTGG - Intronic
967015466 3:185477875-185477897 GTGAGGAAACAGCAAGAAGGTGG - Intronic
967375513 3:188796310-188796332 CTGAGGGAGAAGCATGATGCAGG + Intronic
967467230 3:189821972-189821994 CTAAGGAAACAGGAGGGTGTAGG + Intronic
968374587 4:28315-28337 CACAGGAAAGAGCAGGATCCTGG + Intergenic
968588527 4:1446172-1446194 CTGAGGGACCAGCAGGGTGGAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969147947 4:5140649-5140671 CTGCTGAAACAGCAGGTTCCTGG - Intronic
969604759 4:8196855-8196877 CTGAGAGGACAGCAGGCTGCAGG + Intronic
970075727 4:12217318-12217340 GTGAGGACACAGCAAGAAGCTGG - Intergenic
970499347 4:16661469-16661491 ATGAGGAAACTGCAGCATGGTGG - Intronic
971107177 4:23539407-23539429 ATGAGGAAAAAGCAGTTTGCAGG - Intergenic
971424757 4:26504723-26504745 ATGAGGACACAGCAAGATGGCGG + Intergenic
972345425 4:38188725-38188747 CTGAGCAAGGATCAGGATGCAGG - Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
975464294 4:74692027-74692049 CTGAGGAACCAGAAGTCTGCAGG - Intergenic
976970468 4:91096155-91096177 CTGAGAAAGCAGCAATATGCTGG - Intronic
977775982 4:100919808-100919830 CTTTGGTATCAGCAGGATGCTGG - Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979920574 4:126490921-126490943 CGGACCAATCAGCAGGATGCGGG + Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
981303966 4:143225999-143226021 CTTACGAAAAAGCAGGACGCAGG - Intergenic
982243815 4:153328649-153328671 CTGGGGAAACAGCAGGATCCAGG + Exonic
982813373 4:159854857-159854879 GTGAGGAGAGTGCAGGATGCTGG + Intergenic
984155872 4:176195579-176195601 CTGCGGCAACAGCAGAAGGCGGG + Exonic
984540307 4:181030135-181030157 ATGAGGAAAAAGGAAGATGCTGG - Intergenic
985468496 5:20869-20891 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
985505654 5:278820-278842 CTGGGGACACAGGAGGGTGCTGG + Intronic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
986857832 5:11891633-11891655 GTGAGGAAAGAGCAGGAAGGCGG + Intronic
987123819 5:14792599-14792621 CTGAGGAGGCAGCTGGGTGCTGG + Intronic
987590057 5:19912886-19912908 CTGAGGAAGCAGCAGGGTCTGGG + Intronic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
990351857 5:54925960-54925982 ATGAGAATACAGCAGGAAGCTGG - Intergenic
990417241 5:55598097-55598119 GTGAGCAGACAGCAGGATCCAGG - Intergenic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
993040057 5:82804267-82804289 CTGAGGAGACAGGAGGCTTCTGG - Intergenic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
995111069 5:108429004-108429026 CTGTGGAAAAAGCAGTTTGCTGG + Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995706008 5:114990052-114990074 CTGACCAATCAGCAGGATGTGGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996650314 5:125867928-125867950 CAGAAGAGACAGCAGGAAGCTGG + Intergenic
996760518 5:126982218-126982240 CTGAGGATGCAACAGGAAGCAGG - Intronic
996912750 5:128674166-128674188 ATAAAGAAACAGCAGGAGGCGGG - Intronic
998546956 5:143037325-143037347 GTCAGGAAACAGCAGGTAGCAGG - Intronic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1000760383 5:165216249-165216271 CTGAGGAAACAGAGTGAAGCAGG + Intergenic
1003260637 6:4512429-4512451 CTGAGGAGACTGCAGGAGCCAGG + Intergenic
1003311191 6:4971215-4971237 GTGAGGACACAGCAGGAAGGTGG - Intergenic
1003635970 6:7831884-7831906 CTCAGGAAAGAGCACGAAGCAGG + Intronic
1003816327 6:9845159-9845181 ATGCGGAAGCAGCAGGTTGCAGG - Intronic
1004288929 6:14348971-14348993 GTGAGGACACAGCAGGAAGGCGG - Intergenic
1004455292 6:15786154-15786176 CTGAGAAAGGAACAGGATGCAGG - Intergenic
1004923496 6:20398489-20398511 CTGAGGAACCAGCCAGATGCTGG + Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005349016 6:24916131-24916153 CTGAGGAAAAAGGTGGAAGCAGG - Intronic
1006014566 6:31069733-31069755 CTGAGGATACAGCAGTGAGCTGG + Intergenic
1006304661 6:33211802-33211824 CGGAGGCAACAGCAGGAAGCAGG + Exonic
1008671137 6:53770076-53770098 TTGAGGGAAGAGCAAGATGCTGG - Intergenic
1009288336 6:61851583-61851605 CTAAGGACACAGCAGGAAGATGG + Intronic
1009323345 6:62318304-62318326 GTGAGGACACAGCAGGAAGATGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010349438 6:74854793-74854815 CTGAGGGATCTGAAGGATGCAGG + Intergenic
1011071245 6:83386839-83386861 GTGAGGAAATAACAGGAAGCTGG + Intronic
1011859601 6:91738253-91738275 GTGAGGACACAGCAGAATGTGGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1014668448 6:124270072-124270094 CAGAGGAGACACCAGCATGCAGG + Intronic
1016254643 6:142089117-142089139 CTGTGGGAAAAGCAGGTTGCAGG - Intergenic
1016353174 6:143189981-143190003 GTGAGGACACAGCAAGAAGCTGG - Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017709143 6:157150580-157150602 CTCAGGCAGCGGCAGGATGCAGG + Intronic
1019756948 7:2777622-2777644 GTGAGGAAGCAGCAGGAAGGTGG + Intronic
1019840522 7:3438111-3438133 CTGGGGCAAAGGCAGGATGCAGG - Intronic
1020215417 7:6186505-6186527 TTGAGGAAAGAGAAAGATGCTGG + Intronic
1020417252 7:7960394-7960416 CTGAGGAGACACCTGTATGCAGG + Intronic
1021121988 7:16806353-16806375 ATGAGCAAGCACCAGGATGCAGG - Intronic
1021536007 7:21705434-21705456 CAGAGCAAACAGCTGGTTGCTGG - Intronic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024870085 7:53955058-53955080 CGGACCAATCAGCAGGATGCGGG - Intergenic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1026116793 7:67502599-67502621 ATGAGGACACAGCAGGAAGGTGG - Intergenic
1026548081 7:71341931-71341953 CTGTGGATGCAGGAGGATGCAGG + Intronic
1026883697 7:73923446-73923468 GTGAGGACACAGCAAGATGGCGG - Intergenic
1027177293 7:75912748-75912770 CTAAGGAAACATCAGGAAACAGG - Intronic
1028578987 7:92385219-92385241 GTCAGGAAACAACAGGTTGCTGG + Intronic
1029361074 7:100089032-100089054 CGGAGGAAGCAGCGGGATGGAGG + Exonic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1032762453 7:134956506-134956528 ATGAGGACACAGCAGGAAGGTGG + Intronic
1033501043 7:141950062-141950084 CTGAGGAGAAAGCAGGAGGTGGG - Intronic
1033535426 7:142307928-142307950 ATGAGGAAACAGGAGGCTGCTGG - Intergenic
1033578999 7:142714512-142714534 CTGAGGTTACTGCAGGAAGCAGG + Intergenic
1034590250 7:152132312-152132334 CTGAGGACACAGGAGCAAGCAGG + Intergenic
1034928483 7:155141859-155141881 CTGAGGAAATAGCAAGCTTCTGG - Intergenic
1034958645 7:155350763-155350785 CCGAGGAGACCGCAGGAAGCCGG - Intergenic
1035371683 7:158383263-158383285 CAGAGGCAAAAGCAGCATGCAGG + Intronic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1037844552 8:22271610-22271632 GTGAGGACACAGCAAGATGGCGG - Intergenic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041718988 8:60959454-60959476 CTGATGGAGCTGCAGGATGCTGG - Intergenic
1041719821 8:60965616-60965638 ATGATGAAACAGGAGGATGCAGG + Intergenic
1041970953 8:63742172-63742194 CTGAGGACACAGCACGAAGGTGG + Intergenic
1043395595 8:79832675-79832697 CTGAGGAAAGAGCTGGATTTAGG - Intergenic
1045017392 8:98011097-98011119 ATGAGGACACAGCTGGGTGCTGG - Intronic
1045490203 8:102662460-102662482 CTGAGGAAGAAGCAGGCTGAAGG + Intergenic
1045596301 8:103660084-103660106 CTGAGGACACGGCAGCAGGCAGG - Intronic
1045646942 8:104308454-104308476 GTGAGGACACAGCAGGAAGGCGG + Intergenic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1046796960 8:118383990-118384012 CTGAAGAAAAAGCAGAATGAAGG + Intronic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047904040 8:129453793-129453815 CTGAGGATAGGGCAGGATGCTGG - Intergenic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1048654192 8:136517232-136517254 CTGAGGAAACAGCATGAGTCTGG - Intergenic
1048846285 8:138606288-138606310 CTGAGGACACAGGAGGTGGCAGG + Intronic
1048870201 8:138790937-138790959 CTGAGGACCCAGCATGGTGCTGG - Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049284903 8:141769336-141769358 CTGAGGGAACAGCAGAAACCAGG - Intergenic
1049560189 8:143306476-143306498 CTCAGGACACAGCAGGGTGGGGG - Intronic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1051680051 9:19597939-19597961 CTATGTAAACAGCAGGAGGCAGG + Intronic
1051740627 9:20248487-20248509 GTGAGGACACAGCAGGAAGATGG - Intergenic
1051764993 9:20513738-20513760 CTGAGGAACCGGGAGGAGGCAGG + Intronic
1055928099 9:81531467-81531489 GGGAGGAAACAGGAGGAAGCTGG + Intergenic
1055955034 9:81765500-81765522 ATGAGGTGGCAGCAGGATGCTGG - Intergenic
1056906142 9:90649547-90649569 ATGAGGACACAGCAGGAAGGTGG + Intergenic
1057060451 9:91999342-91999364 CTGAGAAATCAGGAGGCTGCTGG - Intergenic
1057412028 9:94825288-94825310 CAGGCAAAACAGCAGGATGCGGG - Intronic
1057706325 9:97397671-97397693 CTGAGGACACAACAAGAAGCTGG - Intergenic
1058892316 9:109371481-109371503 TTGAGGACACAGCAGGAAGATGG + Intergenic
1059470382 9:114500759-114500781 ATGAGGAAACAATAGGATTCTGG - Intronic
1060378613 9:123142585-123142607 AAGAGGAAACATCAGGATGAAGG - Intronic
1061677606 9:132227319-132227341 CTTAGCATTCAGCAGGATGCAGG - Intronic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1203574632 Un_KI270744v1:165835-165857 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1187041916 X:15605452-15605474 GTGCTGAAACAGCAGGATGGAGG + Intergenic
1187459440 X:19473144-19473166 CTGAGGAGACAGCAGGAATCCGG + Intronic
1188049953 X:25472838-25472860 CTGGGGATACAGGAGGCTGCTGG - Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1192319802 X:70081285-70081307 CTAAGGCAACAGGAGGATGGGGG + Intergenic
1194740031 X:97561634-97561656 CTAAAGATACAGCAGGGTGCTGG - Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196193682 X:112818936-112818958 CTTAGGAAGGAGCAGGATGAGGG - Intronic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1200833972 Y:7714625-7714647 ATGAGGAAACAGCAGGAATGTGG + Intergenic
1200911737 Y:8537190-8537212 CTGAGGGAAGAGCAGCATACTGG + Intergenic