ID: 902628723

View in Genome Browser
Species Human (GRCh38)
Location 1:17692121-17692143
Sequence GTGAAGGCTCAGAACTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902628723_902628728 0 Left 902628723 1:17692121-17692143 CCATCATAGTTCTGAGCCTTCAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 902628728 1:17692144-17692166 TTTTGGAATGGATTTAGGTGTGG 0: 1
1: 0
2: 1
3: 19
4: 457
902628723_902628727 -5 Left 902628723 1:17692121-17692143 CCATCATAGTTCTGAGCCTTCAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 902628727 1:17692139-17692161 TTCACTTTTGGAATGGATTTAGG 0: 1
1: 0
2: 5
3: 27
4: 319
902628723_902628730 30 Left 902628723 1:17692121-17692143 CCATCATAGTTCTGAGCCTTCAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 902628730 1:17692174-17692196 TCCCAGCTCCACAGACACCCAGG 0: 1
1: 0
2: 5
3: 41
4: 397
902628723_902628729 1 Left 902628723 1:17692121-17692143 CCATCATAGTTCTGAGCCTTCAC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 902628729 1:17692145-17692167 TTTGGAATGGATTTAGGTGTGGG 0: 1
1: 0
2: 2
3: 21
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902628723 Original CRISPR GTGAAGGCTCAGAACTATGA TGG (reversed) Intronic
901988989 1:13097305-13097327 GCAGAGGCTCAGAACTTTGAAGG + Intergenic
901992824 1:13129462-13129484 GCAGAGGCTCAGAACTTTGAAGG - Intergenic
902628723 1:17692121-17692143 GTGAAGGCTCAGAACTATGATGG - Intronic
905561430 1:38930229-38930251 GAGAAGGCTGAGTATTATGATGG - Intronic
908112533 1:60911538-60911560 GTGAGAGCTCAGAAGTTTGAAGG + Intronic
909247213 1:73301352-73301374 GTGATGACTCAGAGATATGATGG + Intergenic
909277766 1:73709800-73709822 ATGAAAGGACAGAACTATGAAGG + Intergenic
910528274 1:88206071-88206093 GTGATTGCACAAAACTATGATGG - Intergenic
913265485 1:117039092-117039114 GTTAAGTGTCAGATCTATGAAGG + Intergenic
915058976 1:153163958-153163980 GTGAGGACTGAGAAATATGAGGG - Intergenic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
917766728 1:178228122-178228144 GTGAAGACTCAGATCTGTCACGG - Intronic
921300350 1:213745802-213745824 GGGAAGGCTCAGTGCTTTGAAGG + Intergenic
922570230 1:226630276-226630298 GTGAAGGCACAAAAATCTGAAGG + Intergenic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
1063174293 10:3537896-3537918 GTGAAGGATGGGAACTGTGATGG - Intergenic
1065408014 10:25390090-25390112 GGGAAGCCTCATAAATATGATGG - Intronic
1067470782 10:46536271-46536293 GTGAAGATTGAGAACTGTGATGG - Intergenic
1068134178 10:52935359-52935381 CTGAAGGCTCAGGACAATGAAGG + Intergenic
1068354671 10:55896448-55896470 GGGAGGGCTCAGAATCATGATGG + Intergenic
1070522699 10:77268291-77268313 GTGTAGGCACAGAACTATGGAGG - Intronic
1072193189 10:93092840-93092862 GAGATGGCCCAGAACTGTGAAGG - Intergenic
1079245989 11:18752695-18752717 GTGGAGGCCCAGAAGTACGAGGG + Intronic
1079925469 11:26487345-26487367 GGGAGGCCTCAGAACTATGGTGG - Intronic
1081909358 11:46690740-46690762 GTGAAGGGTCAGGACAGTGATGG - Intronic
1084971659 11:72775428-72775450 GTGCAGGCTCAGAACTCAGGGGG - Intronic
1086391382 11:86367914-86367936 TTGAATGCTTAGAACTAGGATGG + Intergenic
1088250991 11:107860740-107860762 GTGAAAGTTCAGAGGTATGAGGG - Intronic
1094094640 12:26689616-26689638 CTGAAGGCTCTGAAATCTGATGG + Intronic
1096694997 12:53343235-53343257 GCAAAGGCTCAGAGGTATGAGGG + Intronic
1101866586 12:108524873-108524895 GTGAAGGCACAGAAACACGAGGG - Intronic
1103014371 12:117482354-117482376 GTCAACCCACAGAACTATGAGGG + Intronic
1104323899 12:127777672-127777694 GAGAAGTCTCAGAACAATGGAGG - Intergenic
1106933256 13:34690091-34690113 ATGAAGGCTCTTAAATATGAAGG - Intergenic
1110113940 13:71787496-71787518 GCGAAGGCTCATAACTTTAATGG - Intronic
1110408241 13:75174695-75174717 GTGAGTGCTCAGGACTATGACGG - Intergenic
1113522452 13:110950483-110950505 GTGGAGGCTCAGGACTGTGTGGG + Intergenic
1113701451 13:112391925-112391947 ATGCAGGCTCAGAACAATGCGGG - Intronic
1114400839 14:22408973-22408995 GAGCTGGCTCAGACCTATGAAGG - Intergenic
1115717760 14:36124549-36124571 GAGAAGATTCAGAACTCTGAGGG - Intergenic
1116767962 14:49095199-49095221 GGGAAGGCTCAGAAATACGCAGG - Intergenic
1117571600 14:57054476-57054498 GCGAAGGCACAGAAGTATGATGG + Intergenic
1117657540 14:57972024-57972046 ATGAAGGATCAGTTCTATGAAGG + Intronic
1117665121 14:58048524-58048546 GTGAACGCTCAGCAATTTGAAGG - Intronic
1127180391 15:56409880-56409902 GTAAAGGGACAGAACAATGAGGG - Intronic
1130702932 15:86204028-86204050 GTGAAGGATGAGACTTATGATGG + Intronic
1132554329 16:565992-566014 GTGAAGGCTGATACCTATCACGG - Intergenic
1138695188 16:58806547-58806569 GTGAAGACTCACAATTATGGTGG + Intergenic
1138775576 16:59719435-59719457 GCCAAGGCTCAGAACTTTGGGGG - Intronic
1140132200 16:72173121-72173143 ATGAAGCCTCAGAGATATGAAGG - Intronic
1140462636 16:75152914-75152936 GCAAAGGCAGAGAACTATGAAGG - Exonic
1140487962 16:75309158-75309180 GGGAGGGCTCAGAACCCTGAGGG - Intronic
1141553542 16:84821898-84821920 GTTGAGGCTCAGAATTATTAAGG + Intronic
1141914221 16:87083183-87083205 GCCAAGCCACAGAACTATGATGG - Intergenic
1145740581 17:27270781-27270803 GGGAGGGCTCAGAATTATGGTGG - Intergenic
1149983301 17:61328842-61328864 GTGAAGGCACAGAAAGACGATGG - Intronic
1152719207 17:81914671-81914693 GTGGTGTCTCAGAACTGTGACGG - Exonic
1153068916 18:1082126-1082148 GCCAAGGCACAGAACTGTGATGG + Intergenic
1153492919 18:5668163-5668185 GTGAAGGCTCGGAAATCCGAAGG - Intergenic
1157101490 18:44733983-44734005 GTGAAGGCCCTGAATTGTGATGG - Intronic
1158029232 18:52942549-52942571 GGGAAGGCTCAGAATCATGGTGG + Intronic
1159749581 18:72283627-72283649 GTGAAGCCTCATAACCATGGTGG + Intergenic
1166168672 19:41010798-41010820 GTGAAGACTCAGAAGAGTGAGGG - Intronic
925629107 2:5870600-5870622 GTGAAGGGTCAGAGCTATCCTGG - Intergenic
926351307 2:11997417-11997439 GGGAAGCCTCAGAATCATGATGG - Intergenic
927321953 2:21757427-21757449 GTGAATTCTCAAAACTATTATGG - Intergenic
928841356 2:35609282-35609304 GTGAAGTCTCAGAACTATTTTGG + Intergenic
931964796 2:67521512-67521534 GAGAAGGCTCTGAGCTGTGAAGG + Intergenic
932741692 2:74295703-74295725 TTGAAGGTTCAGAACCATGGAGG - Intronic
933767102 2:85717420-85717442 AGGAGGGCTCAGAACCATGAGGG - Intergenic
937580106 2:123474844-123474866 GTCAAGTCTCAGAGCAATGAGGG + Intergenic
939079342 2:137640312-137640334 GGGAGGCCTCAGAACCATGATGG - Intronic
939555610 2:143669481-143669503 GTTATGGCTCAGACCTTTGAAGG + Intronic
941464668 2:165812030-165812052 GTGAAAGCTCAGGATTATGAAGG + Intergenic
941758990 2:169220002-169220024 ATGAAGGCACAGAAGTATGGCGG - Intronic
942114657 2:172716252-172716274 GTGTAGGTTGAGAAATATGAAGG - Intergenic
947312623 2:228820939-228820961 GGGAAGGCTCATAACCATGGTGG + Intergenic
1172078715 20:32320581-32320603 GTCAAGGCTGTGAGCTATGATGG - Intronic
1172571704 20:35975720-35975742 GTGAAGGCAGAGAAATATGGGGG - Intronic
1173134292 20:40425692-40425714 ATGAAGGCTCAGAAATGTTAAGG - Intergenic
1174684710 20:52442817-52442839 GTGAGGGCTTAGAATTCTGAAGG + Intergenic
1175801096 20:61801384-61801406 ATGACGTCTCAGAACTCTGAGGG - Intronic
1176144335 20:63558949-63558971 GGGAAGTCTCAGAACCAGGAAGG - Intronic
1181474602 22:23160595-23160617 GCAAAGGCTCAGAAGTTTGAGGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
949203278 3:1406778-1406800 CTGAAGGCTAAGAACCAGGAGGG + Intergenic
949367540 3:3299405-3299427 GTAAACACTCAGAAATATGATGG - Intergenic
949862537 3:8519326-8519348 GGGCAGGCTCAGAAGTATGCAGG + Intronic
953109509 3:39919966-39919988 GTGAAGGCACAAAAAGATGAAGG - Intronic
953256072 3:41291695-41291717 GTTAAGTCTCAAAAATATGAAGG + Intronic
960723638 3:120648902-120648924 GAGAAGACTCAGAACCCTGAAGG + Intronic
964886349 3:161487998-161488020 TTGAAGGCTCAGAACATTGTGGG + Intergenic
969608037 4:8212005-8212027 GCCAAGGCTCAGAACCACGATGG + Intronic
975494668 4:75024600-75024622 GTGAAGGCTCAGATCCTTGTGGG - Intronic
976054206 4:81044243-81044265 GTGAAAGCTCAGAGTTATGGAGG - Intronic
977142049 4:93386101-93386123 GTGAGCGCTCAAAACTATTAAGG + Intronic
978857631 4:113411422-113411444 GAGCAGGCTCAGAAACATGAAGG - Intergenic
982175188 4:152699723-152699745 GTGAAGGCTCAAAGCTGTGCAGG + Intronic
983083539 4:163415684-163415706 GGGAAGTCTCAGAACCATGGTGG - Intergenic
985223054 4:187728292-187728314 GTGAAGGCAAAAATCTATGAAGG - Intergenic
986725494 5:10593622-10593644 GTGAAGACTCAGAGCTCTGGAGG - Intronic
987449943 5:18070732-18070754 ATCAAGGCCCAGAACTATCAAGG + Intergenic
990217318 5:53548873-53548895 TTAAAGGCTCACAACTCTGAGGG - Intergenic
993003878 5:82410566-82410588 GTGAAGACACAGAACGAAGATGG + Intergenic
998430807 5:142068281-142068303 GTGACTGTTCTGAACTATGACGG - Intergenic
999649580 5:153752166-153752188 GGGGTGGCTCAGAACTATGCTGG + Intronic
1001080334 5:168663005-168663027 GAGAAGGCTCAAAATTATAAGGG + Intronic
1002829256 6:804439-804461 ATGAAGGCTAAGAATCATGATGG - Intergenic
1003292114 6:4788645-4788667 GTGAGGGCTCAGGAATATGGTGG - Intronic
1006581367 6:35079516-35079538 GTGAAGGCTCTGGGTTATGACGG + Exonic
1008723644 6:54390085-54390107 GTTAATGCTCAGTAATATGAAGG - Exonic
1008838065 6:55862168-55862190 GTGAACGCTAACAACTATGATGG + Intronic
1010449448 6:75986482-75986504 CTGAAGGCTCAGATCTAGAAGGG + Intronic
1011249225 6:85353426-85353448 GAAAAGGCTCAGAATTATAAAGG + Intergenic
1016133780 6:140512065-140512087 CTGCAGGCTGAGAAATATGAGGG - Intergenic
1021792140 7:24216546-24216568 ATGAACGCTCAGAATTCTGATGG + Intergenic
1023288351 7:38643000-38643022 CTGAAGGCTCAGAACTTTCAGGG + Intergenic
1024492523 7:50001856-50001878 GTGAGCCCTCAGAACTGTGAGGG + Intronic
1026490444 7:70858428-70858450 TTGATGGCTCGGAACTATGGTGG + Intergenic
1028959424 7:96732387-96732409 GTGAAGGCTTAGAATCAGGATGG - Intergenic
1030327152 7:108232397-108232419 GGGAAAGCTGAGACCTATGAAGG - Exonic
1030349139 7:108463827-108463849 TTGAAGGCTCAGGACTAAGTCGG + Intergenic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1036478147 8:9112920-9112942 GTGAAGGCTGAGAAAGGTGAGGG - Intronic
1037027323 8:14055213-14055235 GAGAAGCCTCATAACTATGGTGG - Intergenic
1038029711 8:23627171-23627193 TTGAAAGATCAGAACAATGACGG - Intergenic
1041620279 8:59959655-59959677 ATCAAGGCTCAGAACAAAGATGG - Intergenic
1041952244 8:63516700-63516722 GTGTAGCCACAGAACTCTGATGG + Intergenic
1042504166 8:69541865-69541887 GTTTAAGCTCAGAACTGTGAAGG + Intronic
1044150668 8:88771972-88771994 GTGAAGGGTGAGGACTATTATGG + Intergenic
1045378613 8:101600592-101600614 GTGACGGCACAGGACTAGGATGG + Intronic
1046494960 8:115001181-115001203 GTGAAGGCCCAGAATTATTACGG + Intergenic
1051522458 9:18004450-18004472 GTGAAGGCACAGAATGATGTGGG + Intergenic
1052169295 9:25374274-25374296 GGGAAGCCTCACAATTATGATGG + Intergenic
1053054652 9:34987512-34987534 GTGTAGGCTCGGACCTTTGAGGG - Intergenic
1055821949 9:80276569-80276591 GTGAAGGAACTGAACTATGGAGG + Intergenic
1057058561 9:91982958-91982980 TTGAAAGCTCAGAAGTGTGATGG + Intergenic
1061691161 9:132332466-132332488 GTAAAGTCTGAGAAGTATGAGGG - Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1191638298 X:63401861-63401883 GTTAATGCTCAAAACAATGAAGG - Intergenic
1192803569 X:74491046-74491068 GAGAAGACTCAGGACCATGAAGG - Intronic
1197431735 X:126375845-126375867 GAGAAGCCTCAGAATCATGAAGG + Intergenic
1199134383 X:144233565-144233587 TTGAGGGCTCAGAAAGATGAGGG + Intergenic