ID: 902630715

View in Genome Browser
Species Human (GRCh38)
Location 1:17702817-17702839
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902630715_902630722 -2 Left 902630715 1:17702817-17702839 CCCACCCTGGGGGGCATGTCGGG No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630715_902630721 -3 Left 902630715 1:17702817-17702839 CCCACCCTGGGGGGCATGTCGGG No data
Right 902630721 1:17702837-17702859 GGGGATCAGACCCCTGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902630715 Original CRISPR CCCGACATGCCCCCCAGGGT GGG (reversed) Intergenic
No off target data available for this crispr