ID: 902630722

View in Genome Browser
Species Human (GRCh38)
Location 1:17702838-17702860
Sequence GGGATCAGACCCCTGCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902630702_902630722 19 Left 902630702 1:17702796-17702818 CCCCTCCTCTGCCCTGCTATCCC No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630705_902630722 14 Left 902630705 1:17702801-17702823 CCTCTGCCCTGCTATCCCCACCC No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630717_902630722 -3 Left 902630717 1:17702818-17702840 CCACCCTGGGGGGCATGTCGGGG No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630704_902630722 17 Left 902630704 1:17702798-17702820 CCTCCTCTGCCCTGCTATCCCCA No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630699_902630722 26 Left 902630699 1:17702789-17702811 CCCCAGACCCCTCCTCTGCCCTG No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630711_902630722 7 Left 902630711 1:17702808-17702830 CCTGCTATCCCCACCCTGGGGGG No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630713_902630722 -1 Left 902630713 1:17702816-17702838 CCCCACCCTGGGGGGCATGTCGG No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630700_902630722 25 Left 902630700 1:17702790-17702812 CCCAGACCCCTCCTCTGCCCTGC No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630719_902630722 -6 Left 902630719 1:17702821-17702843 CCCTGGGGGGCATGTCGGGGATC No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630701_902630722 24 Left 902630701 1:17702791-17702813 CCAGACCCCTCCTCTGCCCTGCT No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630709_902630722 8 Left 902630709 1:17702807-17702829 CCCTGCTATCCCCACCCTGGGGG No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630715_902630722 -2 Left 902630715 1:17702817-17702839 CCCACCCTGGGGGGCATGTCGGG No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630720_902630722 -7 Left 902630720 1:17702822-17702844 CCTGGGGGGCATGTCGGGGATCA No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data
902630703_902630722 18 Left 902630703 1:17702797-17702819 CCCTCCTCTGCCCTGCTATCCCC No data
Right 902630722 1:17702838-17702860 GGGATCAGACCCCTGCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902630722 Original CRISPR GGGATCAGACCCCTGCCCGT GGG Intergenic
No off target data available for this crispr