ID: 902631517

View in Genome Browser
Species Human (GRCh38)
Location 1:17707297-17707319
Sequence GTCCTCACACAGCAAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902631517_902631518 -7 Left 902631517 1:17707297-17707319 CCAACACTTTGCTGTGTGAGGAC No data
Right 902631518 1:17707313-17707335 TGAGGACCTTGTGTGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902631517 Original CRISPR GTCCTCACACAGCAAAGTGT TGG (reversed) Intergenic
No off target data available for this crispr