ID: 902632753

View in Genome Browser
Species Human (GRCh38)
Location 1:17715395-17715417
Sequence GATAGGCCTGGGCCAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902632753_902632764 24 Left 902632753 1:17715395-17715417 CCAGGATTTGGCCCAGGCCTATC No data
Right 902632764 1:17715442-17715464 CCTCTTTCATCTCACAAATTGGG No data
902632753_902632765 25 Left 902632753 1:17715395-17715417 CCAGGATTTGGCCCAGGCCTATC No data
Right 902632765 1:17715443-17715465 CTCTTTCATCTCACAAATTGGGG No data
902632753_902632762 23 Left 902632753 1:17715395-17715417 CCAGGATTTGGCCCAGGCCTATC No data
Right 902632762 1:17715441-17715463 GCCTCTTTCATCTCACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902632753 Original CRISPR GATAGGCCTGGGCCAAATCC TGG (reversed) Intergenic
No off target data available for this crispr