ID: 902637991

View in Genome Browser
Species Human (GRCh38)
Location 1:17747651-17747673
Sequence TGGGAGTGACCACTAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902637984_902637991 7 Left 902637984 1:17747621-17747643 CCTGCCTGGCTCCTGAGTTTTGC No data
Right 902637991 1:17747651-17747673 TGGGAGTGACCACTAGACCCAGG No data
902637985_902637991 3 Left 902637985 1:17747625-17747647 CCTGGCTCCTGAGTTTTGCCTCT No data
Right 902637991 1:17747651-17747673 TGGGAGTGACCACTAGACCCAGG No data
902637982_902637991 22 Left 902637982 1:17747606-17747628 CCATCATTTATTTTACCTGCCTG No data
Right 902637991 1:17747651-17747673 TGGGAGTGACCACTAGACCCAGG No data
902637987_902637991 -4 Left 902637987 1:17747632-17747654 CCTGAGTTTTGCCTCTGCCTGGG No data
Right 902637991 1:17747651-17747673 TGGGAGTGACCACTAGACCCAGG No data
902637981_902637991 28 Left 902637981 1:17747600-17747622 CCATTTCCATCATTTATTTTACC No data
Right 902637991 1:17747651-17747673 TGGGAGTGACCACTAGACCCAGG No data
902637980_902637991 29 Left 902637980 1:17747599-17747621 CCCATTTCCATCATTTATTTTAC No data
Right 902637991 1:17747651-17747673 TGGGAGTGACCACTAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902637991 Original CRISPR TGGGAGTGACCACTAGACCC AGG Intergenic
No off target data available for this crispr