ID: 902640078

View in Genome Browser
Species Human (GRCh38)
Location 1:17761490-17761512
Sequence CATAGCTTCGACTTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902640075_902640078 0 Left 902640075 1:17761467-17761489 CCCAGGTAATCTTGCTGGGTCTT 0: 1
1: 0
2: 0
3: 26
4: 378
Right 902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 78
902640076_902640078 -1 Left 902640076 1:17761468-17761490 CCAGGTAATCTTGCTGGGTCTTC 0: 1
1: 0
2: 2
3: 9
4: 120
Right 902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 78
902640074_902640078 3 Left 902640074 1:17761464-17761486 CCGCCCAGGTAATCTTGCTGGGT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902640078 Original CRISPR CATAGCTTCGACTTTAAAGT GGG Intronic
902640078 1:17761490-17761512 CATAGCTTCGACTTTAAAGTGGG + Intronic
909261651 1:73497169-73497191 CATAGTTTCTTCTTTAAAGTGGG - Intergenic
912604211 1:110971859-110971881 CATAACTCCCACTTAAAAGTGGG - Intergenic
917493668 1:175520568-175520590 GATAGCTCCAACATTAAAGTTGG - Intronic
920894673 1:210034694-210034716 CCTAGCTTCCACTTAAAAGTGGG + Intronic
924950240 1:248875374-248875396 CATATCTGTGACTTTCAAGTTGG - Intergenic
1069313854 10:67073224-67073246 AATAGCTTTGATTTTCAAGTAGG - Intronic
1074879506 10:117643905-117643927 CATATCTTCATATTTAAAGTGGG + Intergenic
1085811462 11:79686235-79686257 TAAAGCATAGACTTTAAAGTTGG + Intergenic
1086458017 11:86978382-86978404 CACCCCTTCAACTTTAAAGTGGG - Intergenic
1086855181 11:91857744-91857766 CTTAGCTCAGACTTTAGAGTTGG + Intergenic
1090230133 11:125096490-125096512 CATTTTTTCTACTTTAAAGTGGG + Intergenic
1090866411 11:130704699-130704721 CTTAGCTTTGTCTTTAAAGCAGG + Intronic
1095255695 12:40033116-40033138 CATTGCTTTGTCTATAAAGTGGG - Intronic
1096321611 12:50619064-50619086 CATAGCTGTGACTTTAAAGCAGG + Intronic
1100927283 12:99563332-99563354 TCTAGCTTTGATTTTAAAGTGGG + Intronic
1101306926 12:103537617-103537639 CATAGCTTTGACTTCCAAGATGG - Intergenic
1102615856 12:114153531-114153553 CTTATCTGTGACTTTAAAGTGGG - Intergenic
1103705938 12:122872434-122872456 CCTAGCTTTTACTTTAGAGTTGG - Intronic
1106290636 13:28357999-28358021 GATATCTTCAACTTTCAAGTTGG - Intronic
1109491529 13:63107060-63107082 CATAACTTAGACTTCTAAGTAGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113506024 13:110816525-110816547 TATAGCTTTGCCTTTAAAGAAGG - Intergenic
1114208656 14:20597489-20597511 CATTGCTTCCACTCTAAAATGGG + Intronic
1117429172 14:55635380-55635402 CATAGCTTGGATTTTTCAGTAGG + Intronic
1118099549 14:62581192-62581214 CAGAGATCCAACTTTAAAGTGGG - Intergenic
1125258495 15:37794885-37794907 CATTGCTTCTATTTTAAAGTGGG - Intergenic
1128102585 15:65015401-65015423 AATTTCTTCAACTTTAAAGTGGG + Intronic
1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG + Intronic
1131960954 15:97789578-97789600 CACAGCTTCACCTTTAAAGGAGG + Intergenic
1135295910 16:21278858-21278880 CAAACCTTCGCCTTTAAAGGGGG + Exonic
1140757445 16:78080678-78080700 CTTAGCCTCAACTGTAAAGTAGG + Intergenic
1141773201 16:86103898-86103920 AATAACTTGGACTTCAAAGTTGG - Intergenic
1149586903 17:57795716-57795738 AATTGCTTTAACTTTAAAGTAGG - Intergenic
1153041917 18:820658-820680 CATTGCTTCTATTTTAAACTTGG - Intergenic
928382862 2:30835438-30835460 AATAGCTTAATCTTTAAAGTAGG + Intergenic
931536707 2:63285527-63285549 CCTATCTTTGTCTTTAAAGTGGG - Intronic
935405276 2:102702804-102702826 TATAGCTTAGACTTTAAAAATGG + Intronic
942632370 2:177964606-177964628 TTTAGCTTCTACTTAAAAGTGGG + Intronic
942695006 2:178632181-178632203 CATAGCTTCTACTCTAATTTGGG + Exonic
944795022 2:203175270-203175292 CATACCTTCCACTCTGAAGTTGG - Exonic
1169168832 20:3447541-3447563 CAGAGCTTCAACTTTGAAGGAGG + Intergenic
1172382662 20:34509215-34509237 CCTAGCTTCGACTGTCAAGGTGG + Exonic
1178675164 21:34625153-34625175 CATATCTTGCACTTTAAACTAGG - Intergenic
949845802 3:8369476-8369498 CAATGCTTCAACTGTAAAGTTGG + Intergenic
949963137 3:9331332-9331354 CATCTCTTCATCTTTAAAGTAGG - Intronic
953831352 3:46300223-46300245 CAAAGCTCAGACTTTAAAGTAGG - Intergenic
957542087 3:81585188-81585210 CATAGCTGTGACATTAAACTTGG - Intronic
959224724 3:103564809-103564831 TTTAGCTTAGACTTTAAAGATGG - Intergenic
962427097 3:135280543-135280565 CATAGCTTCCACTTTTTGGTAGG + Intergenic
968717617 4:2173073-2173095 CATTGCTTAGGCTTTGAAGTGGG + Intronic
980569454 4:134595023-134595045 CAAAGCTTCATTTTTAAAGTTGG + Intergenic
981498833 4:145424189-145424211 CATAGCTTTCTATTTAAAGTGGG + Intergenic
982761479 4:159289548-159289570 AATATCTTCTACTTTAAACTAGG + Intronic
983384697 4:167045275-167045297 CGTAGCTTTAAATTTAAAGTCGG + Intronic
986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG + Intergenic
987855015 5:23410405-23410427 GATAGCTTTGACTTAAAAGAAGG + Intergenic
992209178 5:74460858-74460880 CCAAGCTTAGACTTTAATGTGGG + Intergenic
994437105 5:99750402-99750424 CATAGTTTCCAATTTAAAGGTGG - Intergenic
998784219 5:145691245-145691267 CATAGTTTCCACTTTCTAGTTGG - Intronic
1001699507 5:173696659-173696681 CATAGTTTAGCATTTAAAGTTGG + Intergenic
1004590807 6:17050003-17050025 CATAGCTGTCACTTTAAATTTGG - Intergenic
1008257580 6:49322980-49323002 CAGACCTTCCACTTCAAAGTGGG + Intergenic
1009342109 6:62568961-62568983 CATAGTTTCTACTTCACAGTAGG - Intergenic
1015450175 6:133358206-133358228 CAGAGCTTTGTCTTTAAGGTAGG + Intronic
1015912657 6:138184099-138184121 CATAGCTTCTATTTAAAATTTGG + Intronic
1020371060 7:7432455-7432477 CAAAGGTAAGACTTTAAAGTAGG - Exonic
1025003310 7:55336384-55336406 CTTAGCTTCCACTTGGAAGTGGG + Intergenic
1028107500 7:86897462-86897484 CAGAGCTTCGGCATTATAGTTGG - Intronic
1031923933 7:127620539-127620561 AATCACTTTGACTTTAAAGTGGG - Intergenic
1036205534 8:6803061-6803083 GGTAGCTTTGACTTTAGAGTAGG + Intergenic
1037210430 8:16379442-16379464 CTTAGCTTCATCTTTAAAATGGG + Intronic
1041203382 8:55473161-55473183 TATAGCTTCAGCTTTAAAGCTGG + Intronic
1043637486 8:82404628-82404650 CACAGCTTAGAGTTGAAAGTAGG + Intergenic
1054872037 9:70056320-70056342 TAAAGCTTATACTTTAAAGTTGG - Intronic
1054948213 9:70819720-70819742 CATAGATTTCACTTTCAAGTAGG + Intronic
1055760203 9:79598904-79598926 CAGAGCTTCTAGTTTAGAGTAGG + Intronic
1060864757 9:126986922-126986944 CATAGCTTTTACCTTACAGTGGG + Intronic
1190727506 X:53199235-53199257 CATAGATTTGAATCTAAAGTAGG - Intronic
1192491624 X:71580358-71580380 CAAAGTTTCGGCTTTAAGGTGGG + Exonic
1193536836 X:82727319-82727341 CATTGCATCGATTTTAAATTGGG + Intergenic
1193968988 X:88027005-88027027 CATTGCGTTGACTATAAAGTAGG - Intergenic
1195130551 X:101846712-101846734 CACAGCTTGGGCTTTGAAGTGGG + Intronic
1196598912 X:117578479-117578501 CTTAGCTTCTACTTATAAGTGGG + Intergenic
1197395859 X:125926243-125926265 CAAAGCTTCTTCTTTCAAGTTGG + Intergenic
1198364732 X:135929145-135929167 AAGAGCTTCTGCTTTAAAGTAGG - Intergenic