ID: 902640616

View in Genome Browser
Species Human (GRCh38)
Location 1:17764063-17764085
Sequence CAGGGCTCGGGAAACCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902640608_902640616 26 Left 902640608 1:17764014-17764036 CCCAGACAAGAATAGCAAAGGTT 0: 1
1: 0
2: 1
3: 21
4: 204
Right 902640616 1:17764063-17764085 CAGGGCTCGGGAAACCCCGGTGG 0: 1
1: 1
2: 1
3: 4
4: 131
902640609_902640616 25 Left 902640609 1:17764015-17764037 CCAGACAAGAATAGCAAAGGTTG 0: 1
1: 0
2: 0
3: 11
4: 97
Right 902640616 1:17764063-17764085 CAGGGCTCGGGAAACCCCGGTGG 0: 1
1: 1
2: 1
3: 4
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902640616 Original CRISPR CAGGGCTCGGGAAACCCCGG TGG Intronic
900332740 1:2144350-2144372 CAGGGCTGGGGAGGCCCGGGGGG + Intronic
901099301 1:6707014-6707036 GAAGGGTCGGGATACCCCGGGGG + Intergenic
902640616 1:17764063-17764085 CAGGGCTCGGGAAACCCCGGTGG + Intronic
903779249 1:25810943-25810965 CAGAGCTAGGTAACCCCCGGGGG - Intronic
904619103 1:31764636-31764658 CAGGGCCCGGGACACCCTGGCGG - Intronic
914995808 1:152542549-152542571 CAGGGCTCTGAAAACCACAGAGG - Intronic
924362278 1:243254746-243254768 AGGGGCTCGGGAAAGCCGGGGGG + Intronic
1063111060 10:3037781-3037803 CATGGCTAGGGAAACACAGGAGG + Intergenic
1065957429 10:30705830-30705852 CAAGTCTCAGGAAACCCAGGAGG - Intergenic
1069703251 10:70441333-70441355 CTGGGCTCGGGACGCCCGGGCGG + Intronic
1069755802 10:70773981-70774003 CAGGGCTGGGGACACCCCAAGGG - Intronic
1076505587 10:130970836-130970858 CAGGGGTCGGGGAGCCCTGGGGG + Intergenic
1078617028 11:12876022-12876044 CAGGTCTCCGGACACCCCAGTGG + Intronic
1081662523 11:44896728-44896750 CAGGGCTGGGGAACCCACAGTGG - Intronic
1084475465 11:69386269-69386291 CTGGGGTCGGCAAACCCGGGGGG - Intergenic
1085028981 11:73258316-73258338 CAGGGCTCTGCATACCCAGGAGG + Intergenic
1085303799 11:75473856-75473878 GAGGCCTGGGGAAACCCTGGGGG - Intronic
1085348853 11:75785409-75785431 CAGGCCTCGGGAAGCACCTGGGG - Intronic
1090354953 11:126134085-126134107 CAGTGCTAGGGAGACCCAGGGGG + Intergenic
1092659465 12:10722939-10722961 CACGTCGCAGGAAACCCCGGTGG - Exonic
1102759704 12:115374754-115374776 CAGGTCTTGGGAAACCCCTTAGG - Intergenic
1103874412 12:124116194-124116216 CAAGGCTGGGGAAGCCACGGAGG - Intronic
1104775640 12:131388642-131388664 CAGGGCTGAGCAAACCCCGTGGG + Intergenic
1106458689 13:29949289-29949311 CAGGACTCTGGAGACCCCGTAGG + Intergenic
1114485063 14:23057359-23057381 CAGGGGTCGGGAATCCGCGGAGG - Intronic
1121637215 14:95461936-95461958 GAGGGCTGGGGACACCCAGGAGG + Intronic
1122178689 14:99939155-99939177 CAGGGCGCTGGAAACACCAGGGG - Intronic
1122231207 14:100306999-100307021 CAGGAGTCCGGAAGCCCCGGAGG - Intergenic
1123506114 15:20942177-20942199 CATGGCCCCGGGAACCCCGGCGG - Intergenic
1128026171 15:64438798-64438820 CAGGGCACAGGAAACCACAGTGG + Intronic
1129690411 15:77710119-77710141 CAGGCCTCTGGAACCCCAGGGGG + Intronic
1130702015 15:86193619-86193641 CAGGGCTCTGGAAAGCCTTGAGG + Intronic
1202971698 15_KI270727v1_random:243018-243040 CATGGCCCCGGGAACCCCGGCGG - Intergenic
1132675932 16:1121261-1121283 TGGGGCCCGGGAACCCCCGGAGG - Intergenic
1133170264 16:3978586-3978608 CCGGGCTGGGGAGTCCCCGGTGG - Intronic
1135822120 16:25693270-25693292 GAGGGCTCTGCAAACCCTGGCGG + Intronic
1138657829 16:58501022-58501044 CAGGGCTAGGGGACCCCAGGTGG + Intronic
1141522912 16:84593357-84593379 CAGGGCACAGGAGACCCCGAGGG + Intronic
1141726233 16:85790709-85790731 CAGGGATAGGGACACCCGGGGGG - Intronic
1142299321 16:89247435-89247457 CAGCGCTGGGGAAACCGCGCCGG + Intergenic
1142382262 16:89739605-89739627 CAGTGCTGGGGACACCCCTGGGG + Intronic
1144501074 17:15786883-15786905 CTGGGCTGGGGACACCCCCGCGG + Intergenic
1145746752 17:27325572-27325594 CTGGGCTTGGGAAAGCCTGGAGG - Intergenic
1145925774 17:28645382-28645404 CGGGGCTCGGGGACCCGCGGGGG + Intronic
1146224092 17:31050864-31050886 CAGGGCTCAGGTGACCCCAGGGG + Intergenic
1148820383 17:50356462-50356484 AAGGGCTCTGGAAGCCCCAGAGG - Intronic
1151784728 17:76269967-76269989 CAGGCCTCATGAAACCCCGTTGG + Intronic
1152739464 17:82012640-82012662 CAGGGCTCAGGGAGCCCCAGAGG + Intronic
1162029061 19:7909632-7909654 CCTAGCTCGGGAAACCCAGGAGG + Intronic
1162721712 19:12666715-12666737 CAGGGCCGGGGAACCCCAGGAGG - Exonic
1163012145 19:14433193-14433215 CCGGGCTCGGGAGACCGAGGGGG + Intronic
1165075197 19:33276458-33276480 CAGGGCTTGAGACACCCCAGTGG - Intergenic
1165331923 19:35144853-35144875 CAGGTCTCGGGAAACCCCGGGGG + Intronic
1166507632 19:43381142-43381164 CAGAGCTGGGGAAACCCCCAGGG - Intergenic
1166695596 19:44849635-44849657 CAGGGCACTGGAGACCCAGGAGG + Intronic
1167748913 19:51368342-51368364 CAGGGCTCGGGACACACAGCTGG - Intronic
1167763243 19:51462388-51462410 CAGGGCTTGTGGAACCCCGAGGG + Intergenic
1168078411 19:53992649-53992671 CAGGGCTGGGGAAGCCTCTGGGG - Exonic
927552261 2:24010486-24010508 CAGAGCTCGGGGACCCCGGGAGG - Intronic
929393237 2:41495285-41495307 CAGGGCTCGGGGAACCAAGGAGG + Intergenic
929818971 2:45258363-45258385 CAGGGCCCGGGCAACCACTGGGG - Intergenic
934750277 2:96789428-96789450 GAGGCCTCCAGAAACCCCGGAGG - Intronic
936938404 2:117859455-117859477 CAGGGCAAGGGCAACGCCGGCGG - Intergenic
937333672 2:121047471-121047493 CAGGGACCGGGAAACCCCCTGGG + Intergenic
944215938 2:197255699-197255721 CCTGGCTGGGGAAACCCAGGGGG - Intronic
948230349 2:236344763-236344785 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230357 2:236344802-236344824 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230371 2:236344880-236344902 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230385 2:236344958-236344980 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230393 2:236344997-236345019 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230401 2:236345036-236345058 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230409 2:236345075-236345097 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230417 2:236345114-236345136 CAGGGCTCTGCACACCCCAGAGG - Intronic
948230425 2:236345153-236345175 CAGGGCTCTGCACACCCCAGAGG - Intronic
948525919 2:238570751-238570773 CAGGGCTCTGGGAACCGCTGTGG - Intergenic
1172197291 20:33100587-33100609 CAGGGCTGGGTAAACCCAAGGGG + Intronic
1173826654 20:46051954-46051976 CAGTGCTTGGGAAACCCCTCAGG - Intronic
1175773861 20:61641062-61641084 CAGGGCTGGGGAAAACATGGAGG - Intronic
1178425599 21:32476749-32476771 CAGGCCTCGGGCAGCCCTGGGGG - Intronic
954639444 3:52089282-52089304 CAGGGCTGGGGAATCACCAGGGG + Intronic
954862199 3:53700537-53700559 CATGTGTCAGGAAACCCCGGAGG + Intronic
957337128 3:78845706-78845728 CATGTCTGGGGAACCCCCGGAGG + Intronic
961647343 3:128399758-128399780 CAGGGCTGGGGAGAGCCAGGTGG - Intronic
962330350 3:134472651-134472673 CAGGACTCTGGCAAGCCCGGGGG + Intergenic
965320507 3:167247617-167247639 TACAGCTCTGGAAACCCCGGTGG - Intronic
967092036 3:186143058-186143080 CAGGGGTCAGGAAACCCTGCAGG - Intronic
967431558 3:189391726-189391748 CAGGGCCCAGGAAACCAGGGAGG - Intergenic
969718245 4:8878778-8878800 CAGGGCTAGGGCAGCCACGGTGG + Intergenic
972725535 4:41743920-41743942 CTGGGCTCTGGAAATCCAGGTGG - Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
983489143 4:168368170-168368192 CAGAGGTCTGGAAACCCAGGAGG + Intronic
986077574 5:4354047-4354069 CAGGGCAAGGGAAACCGAGGTGG - Intergenic
988443595 5:31259807-31259829 CAGGTCTAGGAAAACCCCAGTGG + Intronic
1002776852 6:335774-335796 CAGGGCTTGAGAACCCCAGGAGG + Intronic
1003253637 6:4455545-4455567 CTGTGCTTGGGAAACCCTGGAGG - Intergenic
1004314511 6:14574128-14574150 CAGGGCTCAGCACACCCCTGGGG - Intergenic
1005882062 6:30069472-30069494 GAGGACTGGGGAAACCCAGGAGG - Exonic
1006797915 6:36742835-36742857 CAGGTCGGGGGAAACCCAGGAGG - Intronic
1015502890 6:133952280-133952302 CAGGGGCCGGGGGACCCCGGGGG - Intronic
1017970885 6:159311808-159311830 CAGAGCTTGAGAAACCCTGGTGG + Intergenic
1019513716 7:1430518-1430540 CAGGGCAGGGGCAGCCCCGGGGG + Intronic
1019957019 7:4423742-4423764 TAGGGCTCGATAAACCCCGTCGG + Intergenic
1021686120 7:23188064-23188086 GTGGGCTTGGGAAAGCCCGGTGG - Intronic
1022818616 7:33937200-33937222 TGGGGCTCGGGAAACCTCTGTGG + Intronic
1023871901 7:44267893-44267915 CAGGGCTCGGCATTCCCCGAGGG - Intronic
1024894874 7:54246216-54246238 CAGGGGTGGGGAGACCCCTGGGG - Intergenic
1024976369 7:55117521-55117543 CAGAGCTGGGGCAACCCTGGAGG + Intronic
1026089297 7:67286404-67286426 CAGGGCTTGGGTTTCCCCGGAGG + Intergenic
1026665391 7:72336591-72336613 CAGGGCCCGCGACAGCCCGGGGG + Intronic
1026724986 7:72864096-72864118 CAGGGCTTGGGTTTCCCCGGAGG - Intergenic
1027118884 7:75501722-75501744 CAGGGCTTGGGTTTCCCCGGAGG + Intergenic
1029397733 7:100319775-100319797 CAGGGCTTGGGTTTCCCCGGAGG + Exonic
1035045839 7:155964752-155964774 CAGGGCTGGGGAAACCCTGGGGG + Exonic
1035678399 8:1470835-1470857 GAGGGGTCGGGAAAGCCTGGAGG - Intergenic
1035678448 8:1470968-1470990 GAGGGGTCGGGAAAGCCTGGAGG - Intergenic
1035678469 8:1471025-1471047 GAGGGGTCGGGAAAGCCTGGAGG - Intergenic
1035678504 8:1471120-1471142 GAGGGGTCGGGAAAGCCTGGAGG - Intergenic
1035678525 8:1471177-1471199 GAGGGGTCGGGAAAGCCTGGAGG - Intergenic
1035678553 8:1471253-1471275 GAGGGGTCGGGAAAGCCTGGAGG - Intergenic
1037724731 8:21473770-21473792 CAGGGCTCGAGAAACCTTTGAGG - Intergenic
1038455788 8:27671181-27671203 GAGGGCCCTGGAGACCCCGGGGG - Exonic
1042306915 8:67342931-67342953 CTGGGCTCGGGAAACGCGGCAGG - Intronic
1045035091 8:98170383-98170405 CTCGGCTCAGGAAACCCAGGGGG + Intergenic
1048466096 8:134665813-134665835 CAGGGCTCTGGAGACCCCAGTGG - Intronic
1049311492 8:141936080-141936102 CAGGGCACAGGAGACCCAGGAGG - Intergenic
1050628927 9:7538335-7538357 CAGAGCTGGGAAAACCCAGGTGG - Intergenic
1055288592 9:74757663-74757685 CAGCACTCGGGAAACCGAGGCGG + Intronic
1059579748 9:115531649-115531671 CAGGTCTGGGGAAACCATGGAGG - Intergenic
1061177832 9:129008249-129008271 CAGGGCTCTGGCAGCCCCTGGGG - Exonic
1061531722 9:131219276-131219298 CAGAGCTCGGGAAACGCAGCTGG - Intronic
1061673405 9:132202033-132202055 CAGGGCTAGGGACAGCTCGGTGG - Intronic
1185454736 X:303206-303228 CAGGGCTCGGGCAGGCCCCGCGG + Exonic
1185736600 X:2500772-2500794 CAGGGCTCCGGGGACCCGGGTGG - Intronic
1189746448 X:44173382-44173404 CAGGGCTCTGTAAAGCCCTGTGG + Intronic
1190559226 X:51670997-51671019 CAGGGCTCTGGACACCTGGGAGG - Intergenic
1190565065 X:51722324-51722346 CAGGGCTCTGGACACCTGGGAGG + Intergenic
1190569592 X:51768161-51768183 CAGGGCTCTGGACACCTGGGAGG - Intergenic
1201984981 Y:19956547-19956569 AAGGGCTCTGGAATCCCAGGAGG + Intergenic