ID: 902642384

View in Genome Browser
Species Human (GRCh38)
Location 1:17775165-17775187
Sequence AGGCTGAGGCCAGATGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 1, 2: 6, 3: 74, 4: 470}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902642378_902642384 4 Left 902642378 1:17775138-17775160 CCTGATGCTCTCTAAATACAGGT 0: 1
1: 0
2: 1
3: 12
4: 123
Right 902642384 1:17775165-17775187 AGGCTGAGGCCAGATGGTGCAGG 0: 1
1: 1
2: 6
3: 74
4: 470
902642376_902642384 27 Left 902642376 1:17775115-17775137 CCTTACATCAGAGCAAAATTTAG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 902642384 1:17775165-17775187 AGGCTGAGGCCAGATGGTGCAGG 0: 1
1: 1
2: 6
3: 74
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902642384 Original CRISPR AGGCTGAGGCCAGATGGTGC AGG Intronic
900322763 1:2093301-2093323 AGGCTGGGGCCAGGGGGTGAGGG - Intronic
901081782 1:6587819-6587841 AGGCTGGGGGCAGATGTTTCAGG + Intronic
901220157 1:7579124-7579146 TGGCTGAGGCCACATGGAGAGGG + Intronic
901704793 1:11065176-11065198 AGGCTGCCGCCTCATGGTGCAGG - Intergenic
901769217 1:11521968-11521990 AGGCTGAGAGCTGGTGGTGCTGG + Intronic
901778450 1:11576637-11576659 AGGCTTGGGCCAGCAGGTGCTGG - Intergenic
902642155 1:17773996-17774018 AGACTGAGGCCAGATGGTGCAGG + Intronic
902642384 1:17775165-17775187 AGGCTGAGGCCAGATGGTGCAGG + Intronic
903199024 1:21717850-21717872 AGGCTGAGCCCAGGAGGTGGAGG + Intronic
903981930 1:27195020-27195042 AGGCTGTGGTCAGATGGGGCAGG - Intergenic
904584409 1:31571981-31572003 AGGCTGGGGCCGGATCATGCAGG - Intergenic
904673131 1:32180586-32180608 AGGCCGAGGCCAGGTTGTCCGGG + Intronic
904913348 1:33951745-33951767 TGGCTGAGTCCAGATTGTGTAGG - Intronic
904987158 1:34561375-34561397 TGGCTGAGGCCAGAAGGGGTGGG - Intergenic
905326230 1:37153850-37153872 TGGCCTAGGCCTGATGGTGCAGG - Intergenic
905430985 1:37923384-37923406 AGGCTGAGGTCAGGCAGTGCAGG + Intronic
905935127 1:41817387-41817409 AGGATGGGGCCGGATGGGGCAGG + Intronic
906034277 1:42740909-42740931 AGGCTGATGCCAGAAGGTTGGGG - Intergenic
906270313 1:44472656-44472678 AGGCTGAGGCCAGATCCTGAAGG - Intronic
906519462 1:46458644-46458666 AAACTGAGGCCAGATTGTGTAGG - Intergenic
906831030 1:49032186-49032208 AGGCAGAGACCAGATGATCCAGG + Intronic
907186585 1:52614284-52614306 AGGCAGATGCCAGATCATGCAGG + Intergenic
907314483 1:53559694-53559716 GGGCTGAGGCCAGGGGGTGCAGG - Intronic
907488682 1:54794992-54795014 AGGCTGGGGCCAGGTGGGGCGGG - Intronic
907578137 1:55547122-55547144 AGGTTAACGCCAGATGGTGAAGG + Intergenic
908191531 1:61708482-61708504 AGGCTGAGGCCAGAGGAGCCCGG - Intronic
910117889 1:83752473-83752495 GGGCTGAGGCCAGCTGGGGTTGG - Intergenic
910791392 1:91054751-91054773 AGGCAGCAGCCAGATGGTGCAGG + Intergenic
911942896 1:104069802-104069824 AGGATGGGGACAAATGGTGCAGG + Intergenic
912493183 1:110073676-110073698 AGGCTGAGGCCAGAGTGGCCTGG + Intronic
912521275 1:110246548-110246570 AGGCTGGGACCAGACGGTGAAGG - Intronic
912726871 1:112066516-112066538 AGGCTGAGTCCAGAAGCAGCCGG - Intergenic
913172289 1:116243772-116243794 AGGCTGAGGCCAGGCTGAGCAGG + Intergenic
913247337 1:116881652-116881674 GGGCTGAGTCCAGATGGAGTTGG - Intergenic
914242066 1:145858927-145858949 GGGCTGAGTCCAGATGGGGATGG + Intronic
914763026 1:150614440-150614462 AGCCTGAGTCCAGAAGGTGAAGG - Intronic
915277820 1:154801698-154801720 AGGAAGAGGCAAGATGGTGGAGG + Intronic
915571693 1:156748437-156748459 AGGGTGGGGCCAAATAGTGCTGG + Intronic
915903355 1:159861847-159861869 AGGATGAGGCCTGAGGGTGGTGG - Intronic
916357125 1:163924230-163924252 AGGGAGAGACCAGATGGAGCAGG + Intergenic
916578665 1:166088904-166088926 AGTCAGAGGCCAGAGGATGCAGG - Intronic
916926946 1:169531704-169531726 AGGTTGGGGCCAGATGGTAAAGG + Intronic
917294517 1:173504942-173504964 AGGCTGCAGCCACATGGTGCTGG - Intronic
917669307 1:177257294-177257316 AGGAGGCGGCCAGCTGGTGCAGG - Exonic
917910474 1:179639491-179639513 AGGCTGAGGAGAGAGGCTGCTGG + Intronic
918041042 1:180913728-180913750 AGGCTGAAGCCAGAGGAGGCCGG - Intronic
918375684 1:183907050-183907072 AGGCTTGGGCGAGGTGGTGCTGG - Exonic
919336497 1:196243495-196243517 TGGCAGTGGCCACATGGTGCAGG + Intronic
919767608 1:201137248-201137270 AGGCTGAGGCTGGAAGGGGCAGG - Intronic
919914322 1:202130401-202130423 AGGCTGAGGCCAAGGGGTGTGGG - Exonic
920057485 1:203203025-203203047 AGGCTGAGGCCAAACGGTCCAGG - Intergenic
921253700 1:213320771-213320793 AGGCTGAGGTCAGATGGGGTTGG - Intergenic
921255221 1:213332742-213332764 AGGCCGACCTCAGATGGTGCTGG + Intergenic
921757236 1:218872890-218872912 AGGCTGGGGCCAGAGTGTGCAGG + Intergenic
922388790 1:225116207-225116229 AGGCAGAGGACAGAGGGTGAAGG + Intronic
922720272 1:227896713-227896735 AGGGTGAGGGCAGATGGGCCAGG + Intergenic
922883122 1:228997690-228997712 AGGCAGGGGCCAGATGGTACAGG - Intergenic
923728532 1:236528633-236528655 AGGCTGAGCCCAGGAGGTGGAGG - Intronic
923772104 1:236946574-236946596 TGGATGAGGGCAGATGGGGCAGG + Intergenic
924468586 1:244319720-244319742 AGGATGAGGCACGATGGTGGTGG + Intergenic
924563651 1:245177996-245178018 AGAATGAGGCCAGGTTGTGCAGG + Intronic
924567414 1:245210254-245210276 AGGCTGAGGCCAGAGGCTGCGGG - Intronic
924654181 1:245958330-245958352 ATGCAGAGGCCAGATTGTGAAGG - Intronic
1062868159 10:875372-875394 AGGCTGGGGCCAGATTATGGGGG - Intronic
1063213000 10:3898451-3898473 AGGGTGGGGACAGATTGTGCAGG - Intergenic
1063382112 10:5591983-5592005 AGGCTGGAGCCACTTGGTGCAGG + Intergenic
1065130127 10:22612343-22612365 AGGCCCAGGCCAGATGGGGGAGG + Intronic
1066590258 10:36986933-36986955 AGGCTGGGGCCAGATTGTGAAGG - Intergenic
1066722583 10:38355417-38355439 AATCTGAGACCAGTTGGTGCTGG - Intergenic
1067191283 10:44070324-44070346 AGATTCAGGCCAGATGGTGGGGG - Intergenic
1067267132 10:44756070-44756092 GGGCTGTGGACAGGTGGTGCAGG + Intergenic
1067523528 10:47025471-47025493 AGACTGAAGCCAGATGGGGTGGG + Intergenic
1067724922 10:48762725-48762747 AGGCAGAGGCCAGATGGAGAGGG - Intronic
1067869119 10:49941448-49941470 AGACTGAGACCAGAAGGTTCGGG + Intronic
1067995643 10:51270061-51270083 AGGCTGAGGCCAGATTATCAAGG + Intronic
1069292007 10:66791265-66791287 AGGCAGAGGCCAGATCATACAGG - Intronic
1069771459 10:70903209-70903231 AGGCAGAGGCAAGATTGGGCGGG + Intergenic
1069908534 10:71746398-71746420 GGGCTGAGGCCGGATGGGGGTGG - Intronic
1070725144 10:78782612-78782634 CGGCTGAGCTCAGCTGGTGCTGG - Intergenic
1070967771 10:80539970-80539992 GGGCTCAGGCCGGGTGGTGCTGG - Intronic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1071528296 10:86371219-86371241 TGGCTGAGGCAAGCTGGTGCTGG - Intergenic
1072721312 10:97782615-97782637 AGGCTGTGGCCGGCTGGGGCAGG - Intergenic
1073051104 10:100667992-100668014 AGACTGAGGCCAGGAGGTGGAGG - Intergenic
1073324927 10:102637139-102637161 ATGCAGAGGCCAGACTGTGCAGG + Intergenic
1073486203 10:103820570-103820592 AGGCTGAGGTCAGAGGGAGGGGG - Intronic
1074188650 10:111117115-111117137 AGGCCGAGGCCAGAACGTTCAGG + Intergenic
1074918557 10:117983191-117983213 GGGCAGAGGCCAGATCATGCAGG - Intergenic
1075261432 10:120966681-120966703 AGGCTGAGGCCAAAGGCTCCAGG + Intergenic
1076160149 10:128237447-128237469 AGCCTGAATCCAGCTGGTGCTGG - Intergenic
1076440224 10:130476443-130476465 AGACTGAGGCCAGACGGCCCAGG - Intergenic
1076498507 10:130915615-130915637 AGGCCAAGCCCAGATGCTGCTGG + Intergenic
1076622993 10:131804731-131804753 AGGCTGCGGCCACATGGCGGAGG - Intergenic
1076802598 10:132838085-132838107 CGGCTGTGGTCAGGTGGTGCAGG + Intronic
1076992526 11:282905-282927 AGCCTGAGGCCTGTGGGTGCTGG + Intronic
1077042740 11:531725-531747 GGCCTGAGGCCAGTCGGTGCTGG + Intergenic
1078266605 11:9759580-9759602 AGGCGGGGGACAGATGCTGCTGG + Intergenic
1079090737 11:17478116-17478138 AGGCAGAGGGCAGATGGGGTTGG + Intergenic
1079125581 11:17716516-17716538 AGGCTGAGGCTAGCTCATGCAGG + Intergenic
1079323876 11:19475136-19475158 AGGCTAAGGACAGATGATTCCGG + Intronic
1079346748 11:19659346-19659368 AAGCTACGGCCAGATGGTGTAGG + Intronic
1079364063 11:19793760-19793782 AGGCAGCGGCCAGATGATACAGG - Intronic
1080519987 11:33060384-33060406 AGGGTGAAGCCAGATGGCCCAGG + Intronic
1080916153 11:36662314-36662336 AGGTTGGGGCCAGATTCTGCAGG + Intergenic
1081632926 11:44701651-44701673 GGGCTGAGGCCAGAGGGTCTGGG + Intergenic
1081962817 11:47150801-47150823 AGGCAGGGGGCAGATGGAGCGGG + Intronic
1083252734 11:61478698-61478720 ACTCTGAAGCCAGATGGTGTGGG - Intronic
1083563306 11:63691987-63692009 AGGTTGAGGCCAGATATTACAGG - Intronic
1083666420 11:64277305-64277327 AGGCTGAGGCCTACAGGTGCCGG - Intronic
1083719619 11:64597942-64597964 AGGGTGCGGCCAGAGGGCGCTGG + Intronic
1083921298 11:65782395-65782417 TGTCTGAGCCCAGAGGGTGCTGG + Intergenic
1083994855 11:66266853-66266875 AGGCTGTGGGCAGAGGGGGCAGG - Exonic
1084715162 11:70869023-70869045 AAAGTGAGGCCAGATGGGGCAGG + Intronic
1085410345 11:76287154-76287176 AGGCCGAGGCAAGAAGGAGCAGG - Intergenic
1085794746 11:79528674-79528696 AGGAAAAGGCCAGATGGTACAGG + Intergenic
1085897828 11:80661134-80661156 AGGCTGGGGCCAGATTGTGAAGG + Intergenic
1087615505 11:100482191-100482213 AGGCATAGGGCAGATGTTGCTGG - Intergenic
1088897621 11:114090287-114090309 TGTCTGAGGCCTGATGGTGTTGG + Intronic
1089775788 11:120834877-120834899 AGGCTGGGGGCAGAGGGTCCGGG - Intronic
1090427570 11:126619359-126619381 AGGCGGAAGCCAGATGGTGTAGG + Intronic
1091985421 12:4907328-4907350 AGGCAGAGCCCAGATCATGCAGG - Intergenic
1093669976 12:21862289-21862311 AGGCTGAGACCAGATAGTTGGGG - Intronic
1094293412 12:28877200-28877222 AGGCAGAAGCCAGATGGTAGTGG - Intergenic
1095417274 12:41990573-41990595 AGGCTGAGGCCAGAGGGTCATGG - Intergenic
1095646748 12:44556937-44556959 AGGTTGGGGCCAGATGGTGAAGG + Intronic
1096486090 12:51982298-51982320 AGGCAGAGGCCAGATTATGAGGG + Intronic
1096876592 12:54634585-54634607 AGGCAGAGGCCAGAGAGTTCTGG + Intronic
1097147232 12:56950228-56950250 AGATTGAGGTCAGATGTTGCAGG - Intergenic
1097731474 12:63133111-63133133 AGAATGAGGCCAGCTGGAGCAGG + Intergenic
1097970724 12:65630184-65630206 AGCGTGGGGCCAGATGCTGCGGG + Intergenic
1098184577 12:67882732-67882754 AGGCTGAGGTCAGATTGTGGAGG + Intergenic
1099413462 12:82359397-82359419 AAGCAGAGGCCAGATGGCACAGG + Intronic
1100739391 12:97574761-97574783 AGTCAGAGGTCAGATGGTGGTGG - Intergenic
1101023576 12:100578233-100578255 TGGCTGAGGAAAGATGGGGCAGG + Intronic
1101334514 12:103784529-103784551 AGGCTGTGGCCACAGGTTGCAGG + Intronic
1101425955 12:104588763-104588785 AGGCGGAGCCCAGAGGCTGCTGG - Intronic
1101598744 12:106190000-106190022 AGGCAGAAGTCAGATTGTGCAGG + Intergenic
1102083554 12:110117465-110117487 AGGCTGAGGCCGGGAGGTACAGG + Intergenic
1103070462 12:117936973-117936995 AGGCTGGGGGCAGATGGAGGAGG - Intronic
1103146489 12:118599545-118599567 AGGCAGAGGCCAGAGTGTGCAGG - Intergenic
1103667704 12:122583207-122583229 AGGCTGAGGCAGGATCGTGGCGG + Intronic
1103882204 12:124174820-124174842 GGGCTGAGCACAGATGGTGCAGG + Intronic
1104891093 12:132140553-132140575 AGGCTGCGGCCAAGTGATGCTGG + Intronic
1104930923 12:132339106-132339128 AGGCTGCGGCGAGGTGGGGCCGG + Intergenic
1104981331 12:132574254-132574276 AGGCTGAGTCCTGGGGGTGCAGG - Intronic
1105073464 12:133252808-133252830 AAGCTGAGGTGAGAAGGTGCAGG - Intergenic
1105366150 13:19766925-19766947 AGGCTGAGGCCAGCTGAGACAGG + Intronic
1105503335 13:20990538-20990560 AGGCTGAGGCCAGAGGATGGAGG - Intronic
1105805996 13:23951847-23951869 AGGCTGAGGCCAGTGGATCCTGG + Intergenic
1106364429 13:29064340-29064362 AGGTTGGGGCCAGATTGTGGGGG + Intronic
1106421514 13:29589657-29589679 TGGCTGAGTCCAGGTGGTGCTGG - Intronic
1106487753 13:30187588-30187610 AGGCTGAAGCAAGATGGGTCTGG - Intergenic
1107966036 13:45598996-45599018 AGGCTTGGGCCAGATGGAGATGG - Intronic
1108590025 13:51905183-51905205 AGGCTGAAGGCAGTTCGTGCAGG + Intergenic
1110253112 13:73402740-73402762 AGGCTGAGGAAAGAGGATGCTGG - Intergenic
1110637968 13:77788113-77788135 AGGCAGAGGCCAGATTGTATGGG - Intergenic
1110737663 13:78956782-78956804 AGGCAGAGACCAAAAGGTGCAGG - Intergenic
1112078428 13:95938285-95938307 AGGCAGAGGCCAGATCATGAAGG + Intronic
1112463913 13:99626340-99626362 AGGTTGAGGCCAGACTGTGAAGG + Intronic
1115017475 14:28634171-28634193 AGGCTGAGGAGGGATGGGGCTGG - Intergenic
1115149738 14:30270705-30270727 AGGCTGAGGGGAGCTGGGGCGGG - Intergenic
1115675978 14:35675088-35675110 AGGCTAAAGGCAGATGGTGTAGG + Intronic
1117753347 14:58946555-58946577 AGGCAGAGGCCCCATGGTGAAGG - Intergenic
1117805702 14:59488617-59488639 AGGTTGAGGCCAGAATGTGAAGG + Intronic
1121705800 14:95992738-95992760 AGGCAGGGGCCAGATTCTGCAGG + Intergenic
1122070509 14:99202769-99202791 AGGCCGAGGCCACCTGGAGCCGG + Intronic
1122287066 14:100658463-100658485 AGGATGTGGCCAGGTGGCGCTGG + Intergenic
1122722482 14:103730123-103730145 AGGCTGAGGCCAGGGGGCGTGGG + Intronic
1122809161 14:104279432-104279454 AGGCTGGGGCCAGATGCCTCGGG + Intergenic
1122861682 14:104585298-104585320 AAACTGAGGCCAGAGGGGGCTGG - Intronic
1122884114 14:104702990-104703012 AGGCAGACGCCAGGGGGTGCCGG - Intronic
1123098204 14:105776359-105776381 AGGCTGAGTGGAGGTGGTGCAGG + Intergenic
1125536788 15:40445510-40445532 GTGCTGAGGCCAGATGTTGCCGG - Intronic
1125766633 15:42140877-42140899 AGGCCGTGGCCAGATGGAGAGGG + Exonic
1125795925 15:42403832-42403854 ATGCAGGGGACAGATGGTGCAGG + Intronic
1125901758 15:43354807-43354829 AGGCTGAGGCAAGAGGATCCTGG + Intergenic
1127264021 15:57346789-57346811 TGGCTGAGGGCGGCTGGTGCTGG + Intergenic
1127599619 15:60522471-60522493 AGGCTGAGGCAGGAAGGTGATGG + Intronic
1129479393 15:75811021-75811043 AGGCAGGGGCCAGATCCTGCAGG - Intergenic
1129678074 15:77643154-77643176 AGGGTGAGGGCAGCTGGGGCTGG + Intronic
1129880728 15:79004523-79004545 AGGATGAGGCCAGAGAGTGTAGG - Intronic
1129975029 15:79814989-79815011 AGGCTGGGAACAGAGGGTGCAGG - Intergenic
1130197752 15:81796665-81796687 AAGATGAGGCTAGATTGTGCTGG - Intergenic
1131468243 15:92672979-92673001 AGGCTGAAGCCAGGGGGTGATGG + Intronic
1132221900 15:100111267-100111289 AGGGTGAGGCCACATGTTTCAGG + Intronic
1132285806 15:100661480-100661502 AGGCTGCAGCCAGCTGGAGCTGG - Intergenic
1132384854 15:101393099-101393121 AGATTGAGGCCAGATTGTTCCGG - Intronic
1132585135 16:702881-702903 TGGCTCAGGCCAGATGGTGGAGG - Intronic
1133324293 16:4934138-4934160 AGAGTCAGGCCAGATGGTGCAGG - Intronic
1134244190 16:12527734-12527756 AGGCTCAGTCCACAGGGTGCAGG - Intronic
1134559122 16:15192602-15192624 AGGCAGGGACCAGATCGTGCAGG - Intergenic
1134633854 16:15777506-15777528 AGGCTGAGGCCAGAAGGACGGGG + Intronic
1134919658 16:18104215-18104237 AGGCAGGGACCAGATCGTGCAGG - Intergenic
1135178279 16:20250978-20251000 TGGCAGAGTCCAGATGATGCGGG + Intergenic
1136508683 16:30722706-30722728 AGGCTGAGGCCAGTAGGGGCAGG - Exonic
1137236242 16:46621016-46621038 GGGCGGAGGCCAGAGAGTGCAGG + Intronic
1137530511 16:49276123-49276145 AGGCTCAGGCCTGACGGTGAGGG + Intergenic
1137671312 16:50281263-50281285 AAACTGAGGCCAGAGTGTGCAGG + Intronic
1137953485 16:52806082-52806104 AGACAAAGGCCAGATGGTGCAGG + Intergenic
1138546341 16:57722067-57722089 GGGCAGTGCCCAGATGGTGCGGG + Intronic
1138701218 16:58865590-58865612 AGGATGAGGGGAGATGGTGAAGG + Intergenic
1139287232 16:65826417-65826439 TGGCTGAGCTCAGATGGAGCTGG + Intergenic
1139527574 16:67526265-67526287 AGGCAGAGGCCAGAGGGTGGAGG + Intronic
1140724262 16:77798029-77798051 AGACTGAGGACAGATGCTGACGG - Intronic
1140755341 16:78061497-78061519 AGGCTGAGACCAGAGCGTGGTGG - Intronic
1140978524 16:80084187-80084209 GGGGTGAGGGCAGATGGTGATGG + Intergenic
1141039886 16:80664153-80664175 AGGATGAGGCCAGACGATGGAGG - Intronic
1141435943 16:83999752-83999774 AGGCTGAGGGGAGGGGGTGCTGG - Intronic
1141469973 16:84231464-84231486 GGGCTGAGGCCACATGGAGAGGG + Intronic
1141521170 16:84580638-84580660 AGGTGGAAGCCAGATGGTGGGGG - Intronic
1142293081 16:89201592-89201614 AGGCGGAGGCCAGCAGGCGCCGG + Exonic
1142394306 16:89822811-89822833 TGCCTGAGTCCAGATGGTGGAGG + Intronic
1142518547 17:489648-489670 ACGACGAGGCCAGATGGGGCCGG + Intergenic
1142620490 17:1162522-1162544 AGGCAGAGGCCATGTGGTGAGGG - Intronic
1143072017 17:4304105-4304127 AGGCTGAGCCCAGGAGGTGGAGG - Intronic
1143474002 17:7192704-7192726 AGAAAGAGGCCAGATGGTGGTGG + Intronic
1143866195 17:9925805-9925827 AGGCTGAGTCCAGATGTCACTGG - Intronic
1143874619 17:9982132-9982154 AGGCTGGGGCCAGAAGGAGATGG + Intronic
1143984007 17:10895493-10895515 AGCCTGAGGCCTGAAGGTGGTGG - Intergenic
1144503559 17:15809777-15809799 AGACTGTGGCCAGATGGAGTAGG + Intergenic
1144573603 17:16415806-16415828 AGGCTGAGGCCAGGGCGTGGCGG - Exonic
1144739820 17:17575600-17575622 AGGCTGGGGCCAGCTGGGGACGG + Intronic
1145166596 17:20617454-20617476 AGACTGTGGCCAGATGGAGTAGG + Intergenic
1146055497 17:29578777-29578799 AGGCTGAGGGCAGAGGGAGATGG + Exonic
1146278358 17:31529635-31529657 AGGCAGTGGCCAGGTGGTGCTGG + Intronic
1146309155 17:31753816-31753838 AGGCTGAGGACAGATGGGGTGGG - Intergenic
1146458071 17:33022517-33022539 AGGCTGAGCCGAGTGGGTGCAGG - Intronic
1146486307 17:33245806-33245828 AGGCAGATGCCAGAGTGTGCAGG + Intronic
1147622967 17:41880291-41880313 AGGCTGAGGCCAGATTGCCTAGG - Intronic
1147935371 17:44007684-44007706 AGGCTCCGGCCAGATGCTGTGGG + Exonic
1148437978 17:47696907-47696929 GGGCAGAGGCCAGATGCTGGGGG - Intronic
1148482533 17:47969612-47969634 AGGCTGAGGCCAGATCCCCCAGG - Intronic
1148698179 17:49573564-49573586 AGGCTGGGACCAGATGATGGAGG - Intergenic
1148700407 17:49583343-49583365 AGGCAGAGGCAAGATGGGGTGGG + Intronic
1148749186 17:49935008-49935030 AGGCTGAGACCAGCTGGCACTGG - Intergenic
1148880635 17:50723736-50723758 ACGCTGAGGCCAGGAGGTGGAGG - Intronic
1148984883 17:51612734-51612756 GGGCTGAGGCCAGACCGTGTTGG + Intergenic
1149577379 17:57723879-57723901 AGGCTGAAGCCTGAGAGTGCAGG + Intergenic
1149623075 17:58060588-58060610 TTGCTGAGGACAGATGGGGCTGG - Intergenic
1150449033 17:65250415-65250437 GGGCTGAGGACAGATGGTGGAGG + Intergenic
1152071064 17:78133791-78133813 AGGCTGAGGCTGGATGGTAGAGG + Intronic
1152127974 17:78458842-78458864 AGGCAGGGGCCAGATGGTGCCGG - Intronic
1152581034 17:81165736-81165758 AGGCGGAGGCCGGTTTGTGCTGG + Intronic
1152812848 17:82390556-82390578 AGGCTCTGGGCAGATGGGGCAGG - Intronic
1152866731 17:82728499-82728521 AGGCGGAGGGCAGAGGTTGCAGG - Intronic
1152892475 17:82890413-82890435 GGGCTGTGGCCAGGTGGTGTGGG + Intronic
1154191255 18:12232405-12232427 AGGGTGAGTCCAGCTGGTGCAGG - Intergenic
1154216764 18:12421172-12421194 AGGCTGGGGGCAGCAGGTGCAGG - Intronic
1154509382 18:15079385-15079407 AGGCTGAGGCCATCTTGTTCTGG + Intergenic
1155098479 18:22584168-22584190 AGGCAGGGGCCTGATGGGGCAGG - Intergenic
1157344760 18:46816559-46816581 AAGCTGAGGCCAGAAGGTAAAGG - Intronic
1157557144 18:48620288-48620310 AGACTGAGGCAGGAGGGTGCAGG - Intronic
1157872266 18:51241428-51241450 AGCCTGGGGCCAGATGCTGGAGG + Intergenic
1159529914 18:69642432-69642454 AGGCTGAGGCCAGAAGTTCAGGG + Intronic
1159890011 18:73944108-73944130 GGACTGAGGCCAGATGGTGCAGG - Intergenic
1160497748 18:79385063-79385085 AGGCTGGGGCCGTCTGGTGCCGG - Intergenic
1160759002 19:773153-773175 AGGCTGAGGCCAGGTGGGTGGGG - Intergenic
1160865399 19:1253861-1253883 AAACTGAGGCCAGAGGGGGCGGG - Intronic
1160968990 19:1759170-1759192 ATGCTGAGGGCAGCTGGTGCAGG + Intronic
1161026727 19:2040395-2040417 AGGCTGAGGCCTGGTGTTACAGG + Intronic
1161154851 19:2727282-2727304 GTGCTGAGGCCAGACGGGGCTGG - Intronic
1161680212 19:5676388-5676410 AGGCGGAGGCCAGCTGGGGCTGG - Intronic
1161785176 19:6320204-6320226 AGACAGAGGCCAGGTGTTGCTGG - Intronic
1162365082 19:10243641-10243663 AAGCTGAGGCCAGATGTTGAGGG + Intergenic
1162417225 19:10545075-10545097 ACGCAGCGGCCAGATGATGCTGG + Exonic
1162585660 19:11556779-11556801 AGGCTGAGGCCAGAGGATTGAGG - Intronic
1163519420 19:17783090-17783112 AAGCTGAGGACAGGTGGTGGTGG - Exonic
1163698377 19:18775224-18775246 AGGCCGAGGGCAGAGGGTGAGGG + Intronic
1165369564 19:35396104-35396126 AGGCCGGGGCCAGATGGCCCAGG - Intergenic
1165796009 19:38519507-38519529 AGGCGGAGATCAGATGGGGCTGG - Intronic
1166505820 19:43370918-43370940 AGGCTGAGTCCAGAAGGTCAAGG - Intergenic
1167279480 19:48558510-48558532 AGGCAGAGATCAGAAGGTGCCGG - Intronic
1168072447 19:53960512-53960534 AGTCTGAGGCCAGCTGATGGGGG + Intergenic
1168107952 19:54175550-54175572 AGAGTGAGGAAAGATGGTGCTGG - Intronic
1168113882 19:54209953-54209975 AGGCTGAGGCCAGAGAGGGCAGG + Intronic
925100154 2:1237504-1237526 ATGCTGAGTGCAGAGGGTGCTGG + Intronic
925477154 2:4230137-4230159 GGGCAGAGGCCACATGGTTCTGG + Intergenic
925943316 2:8839602-8839624 AGGCTGAGGAAAGATGGGGTTGG - Intergenic
926134941 2:10329932-10329954 AGGCCGAGGCCATATCGAGCAGG + Intronic
926320452 2:11745624-11745646 TGCCTGAGGCCAGAAGGTGAAGG + Intronic
928029763 2:27768305-27768327 AGGGTGAGGCCAGATGATAGAGG + Intergenic
929078256 2:38096180-38096202 AGGCTGAGCTCAGAAGGGGCGGG - Intronic
929768170 2:44868193-44868215 ATGGTGGGACCAGATGGTGCTGG + Intergenic
930025839 2:47028646-47028668 GGGATGAGGCCAGATTATGCAGG - Intronic
931204781 2:60136664-60136686 AGGCTGGGGCTTCATGGTGCTGG - Intergenic
931255458 2:60568316-60568338 AGGCTGGCACCAGATGGAGCGGG - Intergenic
931637672 2:64355341-64355363 TGGCTGAGGCCAGAAGGAGTTGG - Intergenic
932403732 2:71500070-71500092 AGTCTGACTCCAGATGGGGCGGG + Intronic
932607065 2:73172470-73172492 AGGCTGAGCTCAGATGGTTGGGG - Intergenic
932835145 2:75029179-75029201 GGGCAGAGGCCAGGTGGTCCTGG + Intergenic
932862828 2:75312228-75312250 TTGCTGAGGCCAGGTGGTGGAGG + Intergenic
933746672 2:85576886-85576908 ATGCTTAGCTCAGATGGTGCTGG - Intronic
933747173 2:85579746-85579768 GGGCTGAGGCCAGCTGTTTCAGG + Intronic
933925365 2:87087941-87087963 AGGCTGAGCTCAGATGGTTGGGG + Intergenic
934947184 2:98550359-98550381 AGGCTGAGCCCCCATGGAGCTGG - Intronic
935147896 2:100408740-100408762 AGACTGTGGCCAGAGGATGCAGG + Intronic
937246687 2:120498567-120498589 AGGGTGAGGACAGAGGGTGGTGG + Intergenic
937280795 2:120716046-120716068 AGGCTGGGGCCTGGTGCTGCTGG - Intergenic
938378322 2:130823026-130823048 GAGCTGAGGCCTGAAGGTGCCGG - Intergenic
938900661 2:135796423-135796445 GGGCTGAGGCCACATGGTGGAGG - Intronic
939327582 2:140713563-140713585 AGGCTGAGGAGAGAGGGTCCAGG + Intronic
941317369 2:164009922-164009944 AGGCTGGCTACAGATGGTGCTGG + Intergenic
941413347 2:165187745-165187767 AGGCAGAGGCCAGATCATGAAGG - Intronic
941797087 2:169611104-169611126 AGGCTGAGGCAGGAAGGTGGAGG + Intronic
942315318 2:174692221-174692243 AGGCAAAGGTCAGATGGGGCTGG + Intergenic
942922965 2:181399269-181399291 AGGCTGAGGCCTGATTAGGCAGG + Intergenic
943472915 2:188317146-188317168 TGGCTGAGGCCAGATTGTGCAGG - Intronic
943702036 2:190997042-190997064 ATGCTGGAGCCTGATGGTGCAGG - Intronic
946836732 2:223780125-223780147 AGGCTGGGGCCAGGGGGTGGTGG - Intronic
947708725 2:232297026-232297048 AGGCAGATGCCAGATGTTACTGG + Intronic
948042222 2:234911641-234911663 ATTCCAAGGCCAGATGGTGCAGG + Intergenic
948341500 2:237256433-237256455 AGGATCAGGCCAGATTGTGAGGG + Intergenic
948371780 2:237494235-237494257 AGGCAGAAGGCAGATGGTGGAGG + Intronic
1169334982 20:4748617-4748639 GGGCTGAGGCCATATGGGCCGGG + Intergenic
1169662769 20:7998580-7998602 AGGCTGAAGCCAGGTCATGCAGG - Intronic
1169941908 20:10946657-10946679 AGACTGAGACAAGATGGGGCAGG - Intergenic
1170562205 20:17568168-17568190 AGGCTGAGGCCAGAGGCAGACGG + Intronic
1170612413 20:17925485-17925507 AGGCTGAGGCTACATGATGGGGG + Intergenic
1171442799 20:25178997-25179019 AGCCTGAGGCAGGAGGGTGCTGG - Intergenic
1172083942 20:32363913-32363935 AGGCAGAGACCAGATTGTGAGGG + Intronic
1172435604 20:34926982-34927004 GGGCTGAGGCCTGGTGGTGGTGG + Intronic
1172773181 20:37393202-37393224 AAACTGAGGCCAGAGGGGGCTGG - Intronic
1172826120 20:37787920-37787942 AGGCAGAGGCCAGATCTTGAGGG - Intronic
1173364649 20:42373945-42373967 GAGCTGAGGCCAGAGGGTGCTGG + Intronic
1174112291 20:48205079-48205101 AGGCTGTGGCCACATGGGGTGGG - Intergenic
1175190073 20:57205785-57205807 ACACTGAGGCCAGATGCTACAGG + Intronic
1175387157 20:58604727-58604749 AGTCTGAGCCCAGATGGCCCTGG + Intergenic
1175961539 20:62639463-62639485 AGGCTGTGGCCATGTGGTGGAGG - Intergenic
1176018509 20:62951084-62951106 AAGCAGAGGCCAGTGGGTGCTGG + Intergenic
1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG + Intronic
1176788697 21:13292441-13292463 AGGCTGAGGCCATCTTGTTCTGG - Intergenic
1177637059 21:23801275-23801297 AGGCTGAGGACCGATGTTGTAGG + Intergenic
1177987858 21:28000587-28000609 AGGCTGAGGCCATCTTGTTCTGG - Intergenic
1178694744 21:34783136-34783158 AGGCTGAGCTCATCTGGTGCAGG + Intergenic
1178699288 21:34819765-34819787 AGGCCGAGGCCAGGAGGGGCGGG - Intronic
1178701902 21:34840959-34840981 AGGCTGAGTCCAGAGGGAGTGGG + Intronic
1179166100 21:38936452-38936474 AGGCTCAGGACACATGGTGTTGG - Intergenic
1180595063 22:16967685-16967707 AGGCAGAGGGCAGATGAGGCAGG - Intronic
1180698608 22:17769816-17769838 AGGCAGATGCCAGCTGGTGCAGG + Intronic
1180705459 22:17807279-17807301 AGCCTGAGCCCAGATGGAGTTGG - Intronic
1181138848 22:20788617-20788639 CTGCTGAGAGCAGATGGTGCAGG + Intronic
1181265166 22:21626818-21626840 AGGCTGAGGCGAGGAGGTGGAGG + Intergenic
1181326425 22:22052199-22052221 AGGCTGAGGCAAGAGAATGCAGG - Intergenic
1182028529 22:27139001-27139023 TGGCTGAGACAAGATGGGGCTGG + Intergenic
1182089634 22:27585218-27585240 AGGCTAAGGCCAGAATGTGAAGG + Intergenic
1182098710 22:27642857-27642879 AGGCAGTGGCGAGATGGAGCAGG + Intergenic
1182461792 22:30488669-30488691 AGGCTGTGGCCAACTGGAGCCGG - Intergenic
1182604188 22:31490205-31490227 AGGCGGTGGCTAGATGGGGCTGG + Intronic
1183082846 22:35467893-35467915 AGGCTGAGGACAGGCTGTGCTGG + Intergenic
1183345336 22:37304317-37304339 AGGGTGGGGCCAGAGGGTCCAGG + Intronic
1183354733 22:37352036-37352058 GGGATGAGGCCAGGTGGTGCTGG - Intergenic
1183502970 22:38192241-38192263 AGGCAGAGGCCAGATCGAGGAGG + Intronic
1184124151 22:42475222-42475244 AGGCTGGGATCAGATAGTGCAGG - Intergenic
1184742540 22:46437425-46437447 AGGCTGAGGTCAGATGCTCGAGG - Intronic
1184754116 22:46506846-46506868 AGGCTGTGTCCTGGTGGTGCGGG - Intronic
1184802444 22:46769824-46769846 AGGCCGAGGCCAGATGCTGTGGG + Intronic
1184853627 22:47134994-47135016 TGGCTGAGGCCTGAGGGAGCGGG - Intronic
1184948161 22:47818805-47818827 AGGCTAAGGGCAGAAAGTGCAGG + Intergenic
1185077166 22:48689728-48689750 GGGCTGGGGCCAGACTGTGCAGG + Intronic
949561342 3:5205574-5205596 ATGCTAAGGCCCAATGGTGCTGG + Intronic
949891327 3:8735688-8735710 AGGTTGGGGCCAGATTGTGTTGG - Intronic
949947732 3:9203568-9203590 AGGGTGTGGGCAGAGGGTGCAGG - Intronic
950563413 3:13749149-13749171 AGGGTCAGGCCAGATGATGTGGG - Intergenic
951880563 3:27477714-27477736 AGGCTGAGGCAGGATGAGGCGGG - Intronic
952700027 3:36317894-36317916 AGGCTGAAGCCAGATCCTACAGG - Intergenic
953660912 3:44890962-44890984 AGGCAGAAGCCAGCTGGGGCAGG - Intronic
953919249 3:46940626-46940648 TGGATGAGGCTAGATGGTCCAGG + Intronic
954419250 3:50409969-50409991 AGACTGAGGCCAGAGGAGGCAGG + Intronic
954715207 3:52523508-52523530 AGGCTGAGGCCTGAGTGGGCCGG - Exonic
956930988 3:74042721-74042743 AGGCAGGGGCCAGATCATGCAGG - Intergenic
957722791 3:84025811-84025833 AGGCAGAGGTCAGATAATGCAGG - Intergenic
958187380 3:90139403-90139425 AGGCTGAGGCCAGAAGTTTAAGG + Intergenic
961333265 3:126155302-126155324 GGGTTCAGCCCAGATGGTGCAGG - Intronic
961491200 3:127257847-127257869 AGGCTGGGGGCTGATGGGGCAGG - Intergenic
961815609 3:129548650-129548672 GGGCTGAGGTCAGATGGCTCTGG - Intronic
962032579 3:131616910-131616932 AGGCTTTGGCCAAATGGTTCAGG + Intronic
963763576 3:149309617-149309639 CGTCTGAGGGCAGATGGAGCAGG + Intergenic
964634338 3:158843724-158843746 ACCCAGAGGGCAGATGGTGCAGG - Intergenic
966937827 3:184725420-184725442 AGCCAAAGGCCAGATGGTGGAGG + Intergenic
967920091 3:194608091-194608113 AAGCTTTGGCCAGATGCTGCAGG + Intronic
968248787 3:197185251-197185273 AGGCTGCATCCAGTTGGTGCTGG - Intronic
968293555 3:197556230-197556252 GGGCTGAGGCCGGAGGGTGAAGG + Intronic
968584828 4:1411445-1411467 AGGCAGAGGCCAGAGAGGGCAGG - Intergenic
968628204 4:1637527-1637549 AGGCTGAGGCGAGGTGGGGCAGG - Intronic
968818235 4:2832665-2832687 TGGCGGAGGCCACATGGGGCAGG + Intronic
970073836 4:12195387-12195409 AGGCTGAAGCCAGAGGGGCCAGG + Intergenic
970760232 4:19476659-19476681 AGGCAGAGGTCAGGTGGTACAGG - Intergenic
972441973 4:39103134-39103156 AGGCAGAGGCTAGATCATGCAGG + Intronic
972622546 4:40762455-40762477 AGGCTGAGACCAGAAGATTCAGG + Intronic
972638805 4:40907756-40907778 AGGCTGAGCCCAAAAGGTGAAGG - Intronic
975851384 4:78576396-78576418 AGGCTGAGGCCATAGGATCCAGG - Intronic
976346088 4:84003245-84003267 AGGTTGAGGCCAGATTGTCAAGG + Intergenic
978339421 4:107706880-107706902 AGGCAGAGCTCAGCTGGTGCTGG + Intronic
978576655 4:110196584-110196606 CCGCTGAGGCCAGGGGGTGCAGG - Intronic
979263205 4:118671751-118671773 AGGGTGAGTCCAGATGGGGCAGG + Intergenic
981914773 4:150021940-150021962 AGGATGGGGCCATATGGTGCAGG - Intergenic
982139235 4:152301870-152301892 AGGCTGTGGCCAGCTGAGGCAGG - Intergenic
982253153 4:153427524-153427546 ATACTGGGGCCAGAAGGTGCAGG - Intergenic
984081384 4:175253334-175253356 AGGCTGAGCCAAGAGGGGGCGGG + Intergenic
984469967 4:180155957-180155979 GAGCTGAAGCCAGATGGTGCTGG + Intergenic
985064501 4:186106843-186106865 AGGCTGAGGCAAGAGGATGATGG + Intronic
985871709 5:2562696-2562718 AGGCTGAGGTGAGGTGTTGCCGG + Intergenic
985958317 5:3281090-3281112 AGGCTGATGGCTGGTGGTGCTGG + Intergenic
986419611 5:7565743-7565765 AGCCTGTGTCCAGATGGTTCTGG + Intronic
989591089 5:43113510-43113532 AGGCTGAGGCAAGGGGGTGGAGG + Intronic
991412093 5:66355767-66355789 AGGCAGAGACCATATGATGCAGG + Intergenic
991460824 5:66856243-66856265 AGGCTGATGTCAAAGGGTGCAGG + Intronic
992103574 5:73431081-73431103 AGGCTGAGGCAGGATGGAGGCGG + Intergenic
993011699 5:82490364-82490386 AGGCTGAGGCCAGATCACTCAGG + Intergenic
994040291 5:95251389-95251411 AGGCAGAGGCCAGATCATGCAGG + Intronic
994610180 5:102026763-102026785 TTGCTGTGGCCAGATGGTGAAGG + Intergenic
994614818 5:102091078-102091100 TGCCTGAGGACAGATGGTCCTGG - Intergenic
995285939 5:110388285-110388307 AGGCACAGACAAGATGGTGCTGG - Intronic
995954785 5:117763834-117763856 TGGCTGAGTCCAGATGGCCCAGG - Intergenic
997096557 5:130919720-130919742 AGGCAGAGGCCAGATAATGTAGG + Intergenic
997650027 5:135510151-135510173 AGGCAGAGGCCAGATCATGTGGG - Intergenic
997996464 5:138590719-138590741 AGGCTGAGGCAGGAGGGTTCCGG - Intergenic
998053210 5:139053578-139053600 AGGCTGGGGCCAGATACTGCAGG - Intronic
999177839 5:149644101-149644123 AGGCTGGGGCCAGATGCTTCGGG + Intergenic
999891956 5:155987608-155987630 AAGCTAAGGCCAGATCGTGAAGG - Intronic
1000990444 5:167906561-167906583 AGGCTGAGGCCAGAGTGGGTAGG - Intronic
1001635513 5:173207408-173207430 AGGCTGAGTCCTGATGGAGGAGG + Intergenic
1001669458 5:173461695-173461717 AGGCCAAGGCAAGAGGGTGCTGG + Intergenic
1001702824 5:173719942-173719964 AGGCTGAGGGGAGCAGGTGCCGG + Intergenic
1001878136 5:175218541-175218563 AAGCTGCAGTCAGATGGTGCTGG + Intergenic
1002091207 5:176807546-176807568 AGGCAGGGGCCAGATTCTGCTGG + Intergenic
1002831108 6:822139-822161 AAGCTGAAGCCAGAGGGTGAGGG - Intergenic
1003604412 6:7545995-7546017 AGGCAGAGGGAAGCTGGTGCAGG + Intronic
1003626513 6:7746240-7746262 AGGCTGACGCCAGATGCTGAGGG + Intronic
1004441866 6:15662330-15662352 AGGCTGTGGCCGGAGGGTGCAGG + Intronic
1006037923 6:31228676-31228698 AAGCAGAAGCCAGGTGGTGCAGG - Intergenic
1006225830 6:32535447-32535469 GGGCTGAGGGCAACTGGTGCTGG + Intergenic
1006273248 6:32980719-32980741 GGGGTCAGGCCAGATGGGGCAGG + Exonic
1006422481 6:33944038-33944060 AGGCTGAGGACAAAGGGTCCTGG - Intergenic
1006423466 6:33949675-33949697 AGGCAAGGGCCAGATGGTGAAGG - Intergenic
1006426535 6:33966806-33966828 AGGTTGAGGCCAGCTGAGGCTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007652137 6:43429531-43429553 AGGCTGAGGTGAGAGGTTGCTGG - Intronic
1010091626 6:71989839-71989861 AGGCTTAGGCCAGGTCATGCAGG - Intronic
1010091698 6:71990561-71990583 AGGCTTAGGCCAGGTCATGCAGG - Intronic
1010091748 6:71990809-71990831 AGGCTTAGGCCAGGTCATGCAGG + Intronic
1010326584 6:74570510-74570532 AGGCAGAGGCCAGATCATGAAGG + Intergenic
1010384511 6:75263745-75263767 AGGCTGATGCCAGATTGTACAGG + Intronic
1011002962 6:82611734-82611756 ACTCTGAGGCCAGATTGTGGAGG - Intergenic
1015434667 6:133172373-133172395 GGGCTGAGGCCACAGGGGGCTGG - Intergenic
1016755161 6:147676926-147676948 AAGCTGGGGCCAGATGGTGAGGG + Intronic
1018607327 6:165611517-165611539 AGGCTGTGCCCAGAAGGGGCGGG + Intronic
1019427344 7:983847-983869 ATGCTGAGGACAGAGGGTACGGG + Intronic
1019557800 7:1641282-1641304 AGTGTGAGGACAGATGGGGCAGG - Intergenic
1019708101 7:2505938-2505960 GGGCTGAGGCCTGATGGTGCAGG - Intergenic
1019713936 7:2529856-2529878 AGGCTGCGGGCAGAGGCTGCTGG + Intergenic
1020268089 7:6574998-6575020 AGGCTGAGGCAGGATGAGGCAGG - Intergenic
1021936463 7:25636802-25636824 AGGCTGAAGCCAGGTGGACCAGG + Intergenic
1022132446 7:27416866-27416888 TGACTGAGGCCAGATGGTGAAGG - Intergenic
1022835950 7:34114887-34114909 TGGCCCAGGCCAGATGTTGCAGG + Intronic
1022859624 7:34354218-34354240 ATGCAGAGGCCAGATGGAGAAGG - Intergenic
1023355478 7:39362971-39362993 AAGCAGAGGCCAGATGACGCTGG + Intronic
1023372106 7:39522025-39522047 AGGCTGAGGCAGGATGAGGCAGG + Intergenic
1023718262 7:43066105-43066127 AGGCTGAGGCCAGAAGGTCAAGG + Intergenic
1024265079 7:47600219-47600241 AGGATGGGGCCAGGTGGTGGTGG - Intergenic
1025602480 7:63013462-63013484 AGGTTGAGCCCAGAAGGTTCAGG - Intergenic
1026141654 7:67712004-67712026 AGGGTGAGGCCAGATGGGGAAGG + Intergenic
1026355359 7:69552640-69552662 AGGAAGAGGCCAGATCCTGCAGG + Intergenic
1027134731 7:75616217-75616239 AGGCTGAGGCCAGGTTTGGCTGG - Intronic
1029930918 7:104370200-104370222 AGGCTGCTGCCAGCTGGTGCTGG + Intronic
1032075088 7:128832305-128832327 AGGCTGAGGGCAGGGGGTGGGGG + Intronic
1032183842 7:129706182-129706204 AGTGTGAGGCCAGATTGTGGTGG + Intronic
1032528572 7:132600607-132600629 AGGCTGAGGCCAGGGGATCCAGG - Intronic
1032865688 7:135921841-135921863 TGACTGAGGCTAGATGGTTCAGG + Intergenic
1034329334 7:150269308-150269330 AGGCTGGGGTCAGATTGTGAAGG - Intronic
1034471796 7:151258682-151258704 AGGATGAGACCAGATCCTGCAGG - Intronic
1034668720 7:152840552-152840574 AGGCTGGGGTCAGATTGTGAAGG + Intronic
1035154045 7:156897925-156897947 AGGATGAGGCCAGTTGGAACGGG - Intergenic
1035494037 7:159306237-159306259 AAGCTGAGGTGAGAAGGTGCAGG - Intergenic
1036784587 8:11677491-11677513 AAGCAGAGGCCAGATGGTCCTGG - Intronic
1037361869 8:18083137-18083159 GGCCTGAGGCTAGATGGTGATGG - Intronic
1038345813 8:26731514-26731536 AGACTGAGGTCAGATTGTGGAGG + Intergenic
1038593286 8:28860837-28860859 TGACTGAGGCCATATGGGGCTGG - Intronic
1040033064 8:42843410-42843432 TGGCTGAGGCCAGGTGTTTCCGG + Intergenic
1040484478 8:47856997-47857019 AGGCTGAGGCCATTTGGTTTAGG + Intronic
1040598708 8:48864022-48864044 AGGCTGTGCCCTGATGGTTCTGG - Intergenic
1040799437 8:51324965-51324987 AGGCTGAGGCAGGAGGTTGCAGG - Intronic
1041233783 8:55778169-55778191 AGGCTGAGTCCAGGAGGTGGAGG + Intronic
1041416322 8:57612866-57612888 AGGCTGAGGCCAGAGAATGGCGG + Intergenic
1044302116 8:90596746-90596768 AGGCTGAGGATGGAAGGTGCAGG + Intergenic
1044523850 8:93229845-93229867 ACACTGGGGCCGGATGGTGCTGG - Intergenic
1044802557 8:95972273-95972295 AGGCTGAAGACAGATGGTGCTGG - Intergenic
1045221306 8:100202922-100202944 AGGCTGAGGCCAGAAGTTCAAGG + Intronic
1045287292 8:100803304-100803326 TGGCTGAGGAGAGATAGTGCTGG - Intergenic
1046026017 8:108724968-108724990 TGGCAGAGGCCAGACTGTGCAGG - Intronic
1047246710 8:123152425-123152447 AGGCAGAGGGCAGAAGGAGCTGG - Intergenic
1047285516 8:123484335-123484357 AAGCCGAGGCCAGATGACGCGGG + Intergenic
1047381911 8:124372212-124372234 CGGCTGAGGCGAGAAGGAGCTGG + Exonic
1047388363 8:124430373-124430395 GGGCAGGGGCCAGATTGTGCTGG + Intergenic
1047718242 8:127615564-127615586 AGGCTGAGGCAAGATGGGAGAGG - Intergenic
1048341900 8:133546675-133546697 AGGCTGAGGCCAGATAGGAAAGG + Intronic
1048641746 8:136370580-136370602 AGGCAGGAGGCAGATGGTGCAGG - Intergenic
1049343665 8:142127221-142127243 AGACTGAGGCCAGCTGGAGGAGG - Intergenic
1051364861 9:16314732-16314754 AGGCTCAGGCCAGATGCTGAAGG - Intergenic
1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG + Intronic
1053425827 9:38009277-38009299 AGGCTGATGCCACATGGAGGTGG + Intronic
1054748586 9:68881162-68881184 AGCATGAGGCCAGCTGGTGAAGG - Intronic
1056965934 9:91162922-91162944 AGGCTGAAGCCACAGGCTGCGGG - Intergenic
1057525919 9:95801067-95801089 AGGATGTGGCCAGAAGGTGGGGG - Intergenic
1057771154 9:97969270-97969292 GGGCAGAGGACAGATGGTGTGGG - Intergenic
1058583134 9:106480414-106480436 AGTCAGGGGCCAGATGGTGAAGG - Intergenic
1059064847 9:111072442-111072464 ACGCTGAGGCCTGCTGGTGGGGG - Intergenic
1059409617 9:114123915-114123937 AGGCTGAGGCCAGCTTGGGGAGG - Intergenic
1059762715 9:117354282-117354304 AGGCAGAGGCCAGATGATGAGGG - Intronic
1060152209 9:121295960-121295982 AGGCTGTGGCCATTTAGTGCAGG - Intronic
1060214873 9:121732701-121732723 AGGCTGGGGCCAGATTGTTGAGG + Intronic
1060429296 9:123535492-123535514 AGGCAGGGGCCAGATTGTGAAGG - Intronic
1060463657 9:123882941-123882963 AGGCAGAGGCCAGATCATGTAGG - Intronic
1060698516 9:125730672-125730694 GGGCAGAGGCCAGATGGTGGAGG + Intergenic
1061017284 9:127989217-127989239 AGGCTGAGGCCTGCTGGAGCTGG - Intergenic
1061264448 9:129497188-129497210 AGGCAGAGCCCAGTTGGAGCTGG + Intergenic
1061859644 9:133461268-133461290 AGGTTGAGGCAGGAGGGTGCTGG + Intronic
1061907295 9:133705229-133705251 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907308 9:133705278-133705300 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907321 9:133705327-133705349 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907334 9:133705380-133705402 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907347 9:133705433-133705455 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907370 9:133705531-133705553 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1062396119 9:136353581-136353603 AGGCTGGGGCCAGCTGTTGAGGG - Intronic
1062406822 9:136400612-136400634 AGACTGAGGCCAGAGGGTGGGGG + Intergenic
1062440213 9:136566367-136566389 AGACTGAGGCAGGATGGGGCGGG + Intergenic
1062697039 9:137880800-137880822 AGGCCGAGGCTGGGTGGTGCAGG + Intronic
1185680513 X:1884997-1885019 AGGATGAGGCCACATGGAGACGG - Intergenic
1186101393 X:6160621-6160643 AGGCTGAGGCAAGATAATCCGGG - Intronic
1187345896 X:18463236-18463258 ACGCAAAGGCCACATGGTGCAGG + Intronic
1187363196 X:18646623-18646645 AAGCGGAGGTCAGATGGTGCAGG - Intronic
1190058448 X:47195696-47195718 AAGCTGGGCCCAGATAGTGCAGG - Intronic
1190157343 X:48004637-48004659 AGGCTGGGGCCAGGTGCTGTAGG + Intronic
1190173113 X:48127522-48127544 AGGCTGGGGCCAGGTGCTGTAGG + Intergenic
1190227934 X:48560316-48560338 ATGCTGAGGCCTGCTGGTGGAGG + Exonic
1191713930 X:64181088-64181110 AGGCAGAGGACACATGGTGTAGG + Intergenic
1192221640 X:69201216-69201238 AGGCTGGGGCCACATTGTGAAGG - Intergenic
1192894981 X:75433088-75433110 AGGCAGAGGCTAGATGATACAGG - Intronic
1193559383 X:82998935-82998957 ATGCTGTGGACAGATGATGCTGG + Intergenic
1194381713 X:93200443-93200465 TGGCTGAGGCCCCATGTTGCAGG + Intergenic
1195126467 X:101813704-101813726 AGGCTGAGGGCAGCTGAGGCTGG + Intergenic
1195179112 X:102339642-102339664 AGGCTGAGGGCAGCTGAGGCTGG - Intergenic
1195392658 X:104379106-104379128 AGGCAGTGGCCAGATTGTGCAGG - Intergenic
1195658145 X:107352865-107352887 AGGCTGAGGCCAGTGTGTGAGGG + Intergenic
1195747262 X:108131303-108131325 ACGCTGTGGACAGATGATGCTGG + Exonic
1195945478 X:110206098-110206120 GGGCTGAGGCCAGGTGGAGCTGG - Intronic
1197784489 X:130186828-130186850 AGTCTGAGGCCAGAGGGGGATGG - Intergenic
1198005643 X:132489882-132489904 AGGCGGAGGCCAGAGAGTCCGGG - Intronic
1198429867 X:136554455-136554477 AGGCAGGGGCCAGGTGGTGCAGG + Intronic
1198675146 X:139123329-139123351 AGGCAGAGGCCAGATCTTGTAGG - Intronic
1199711530 X:150473152-150473174 AGGCTGAGACCAGATGGCGTGGG - Intronic
1199969596 X:152849692-152849714 AGGCTGAGGCAAGAAGGGGTTGG + Intronic