ID: 902644904

View in Genome Browser
Species Human (GRCh38)
Location 1:17791240-17791262
Sequence GGCTGTACACTCCGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 8, 2: 43, 3: 78, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902644904_902644910 4 Left 902644904 1:17791240-17791262 CCAGCTCCACGGAGTGTACAGCC 0: 1
1: 8
2: 43
3: 78
4: 182
Right 902644910 1:17791267-17791289 CCACGCCTCCCTGCTGCAGCAGG 0: 6
1: 23
2: 37
3: 81
4: 391
902644904_902644913 12 Left 902644904 1:17791240-17791262 CCAGCTCCACGGAGTGTACAGCC 0: 1
1: 8
2: 43
3: 78
4: 182
Right 902644913 1:17791275-17791297 CCCTGCTGCAGCAGGCGTGATGG 0: 1
1: 10
2: 58
3: 122
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902644904 Original CRISPR GGCTGTACACTCCGTGGAGC TGG (reversed) Intronic
902280522 1:15371089-15371111 GGCCGTAAGCTCCGTGGGGCAGG + Intronic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
903082207 1:20819998-20820020 GGCCGTACACTGCATGGAGCCGG + Intronic
903672273 1:25043432-25043454 GGCTGCATTCTCCATGGAGCTGG - Intergenic
903750247 1:25616940-25616962 GGCTGCGCGCTCCGCGGAGCCGG + Intergenic
904390248 1:30180233-30180255 GGATGGACACTCCCAGGAGCTGG - Intergenic
905001147 1:34671165-34671187 GGCTGCACACTCCGTGAGGCAGG + Intergenic
905150443 1:35922847-35922869 ACCTGTCCACTCCTTGGAGCTGG + Exonic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG + Intergenic
907761655 1:57367680-57367702 GGTTCCACACTCCGTGGAGCTGG + Intronic
909054764 1:70807506-70807528 GGCTGCATGCTCCATGGAGCTGG - Intergenic
911534583 1:99085186-99085208 GTCTGTAGGCTCCATGGAGCAGG + Intergenic
912881954 1:113424162-113424184 AGCTGCACACTCCTTGGAGCTGG - Intronic
916509651 1:165460770-165460792 GGCTGTGCACTCCGGAGAGCAGG - Intergenic
916648995 1:166817230-166817252 GGCTGTACACTCCATAGAACTGG - Intergenic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
919302629 1:195790600-195790622 GGCTGTGTGCTCCATGGAGCCGG + Intergenic
919513554 1:198494700-198494722 GGCTGCAGGCTCCATGGAGCCGG - Intergenic
921767051 1:218983994-218984016 GGCTGCATACTCAATGGAGCTGG - Intergenic
923200978 1:231711229-231711251 GGCTGTATACTCCTTGGTGGTGG - Intronic
924672885 1:246147499-246147521 GGCTGCACACTCCATGGAGGCGG + Intronic
1062823652 10:552890-552912 CTCTGTCCACTCCGTGGAGATGG - Intronic
1065830208 10:29608383-29608405 GATTGTGCACTCTGTGGAGCTGG + Intronic
1068300503 10:55132100-55132122 GGCTACACACTCCATGGAGCTGG - Intronic
1068474304 10:57506581-57506603 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1069731905 10:70622555-70622577 GGCTGCACACTCCATAAAGCTGG + Intergenic
1070232589 10:74585565-74585587 TGCTGTACTCTCAGGGGAGCAGG + Intronic
1070959131 10:80486639-80486661 GGCTGTGCCCTCCAGGGAGCTGG - Intronic
1072871459 10:99124866-99124888 GGCTGCACACTCCATGGAGCTGG - Intronic
1073072810 10:100805596-100805618 GCCTGTAGACTCAGGGGAGCAGG + Intronic
1074991660 10:118713412-118713434 GGCTGCATGCTCCATGGAGCCGG - Intronic
1076648794 10:131972824-131972846 GGCTGGACACTCAGCTGAGCGGG - Intronic
1076655352 10:132019937-132019959 GGCTGCACACTCCACAGAGCCGG - Intergenic
1076801937 10:132834989-132835011 GGCAGGACCCTCCGTGGTGCGGG - Intronic
1077476686 11:2793806-2793828 GGCTGTACATTCTAAGGAGCAGG - Intronic
1077894592 11:6444116-6444138 GGCTGTATACTCCAGGGAGCAGG + Intergenic
1077912596 11:6586589-6586611 GGCTGCATGCTCCATGGAGCCGG + Intronic
1078042911 11:7884616-7884638 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1078315327 11:10289410-10289432 GGCTGCACACTCCACGGACCTGG - Intronic
1079111911 11:17609928-17609950 GGCTGGGGACTCCGTGGGGCCGG - Exonic
1079733141 11:23961765-23961787 GGCTGCACACTCCATGGAGCTGG + Intergenic
1082773499 11:57227886-57227908 GGCTTTACTCTACGTGGACCGGG - Intergenic
1085212313 11:74791883-74791905 GGCTGTACGCTCCACGGAGCCGG - Intronic
1087036095 11:93758185-93758207 GGCTACACACTCTATGGAGCGGG + Intronic
1088704413 11:112448406-112448428 GGCTGCACACTCCATGGAGCTGG - Intergenic
1089823011 11:121246054-121246076 GGCTGTACACTCCATAGAGCTGG + Intergenic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1094427145 12:30327802-30327824 GGCTGCACACTCCATGGAGCTGG + Intergenic
1096298107 12:50401116-50401138 GGCCGTACACGCCGCGGAACCGG + Intronic
1097130137 12:56805446-56805468 AGCTGTATACTCCATGCAGCTGG - Intergenic
1098519748 12:71421470-71421492 GGCTGTGCACTCCACAGAGCTGG - Intronic
1099049884 12:77768806-77768828 GGTTGCACACTCCATGGAGCTGG - Intergenic
1099683462 12:85857187-85857209 AGCTGTGCACTCCATGGAGCTGG - Intergenic
1100847730 12:98678360-98678382 GGCTGCATGCTCTGTGGAGCTGG + Intronic
1101208838 12:102515798-102515820 GGCTGTAAACTCCGAGTAGCTGG + Intergenic
1102590079 12:113950333-113950355 GTCTGTACACTCCCTGCAGAGGG - Intronic
1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG + Intergenic
1107300685 13:38962773-38962795 GGCTGTGCCCTACTTGGAGCAGG - Intergenic
1107859354 13:44646259-44646281 GGCTGTAAACCCCCTGGAGAGGG - Intergenic
1108464283 13:50698620-50698642 GGCTGTAAACTCCTTAGGGCGGG + Intronic
1109562883 13:64076002-64076024 GGCTGTGCACTCCACAGAGCTGG - Intergenic
1110730927 13:78877453-78877475 AGCTGTGCATTCTGTGGAGCTGG - Intergenic
1110980230 13:81888998-81889020 GGCTACACACTCCGAAGAGCTGG + Intergenic
1111354569 13:87080715-87080737 AGCTGCACACTCCGCAGAGCAGG - Intergenic
1111704364 13:91730102-91730124 GGTTGTTCACTCCGTGTGGCAGG - Intronic
1111800627 13:92975404-92975426 GGTTGCACACTCCATGGAGCTGG - Intergenic
1112741030 13:102472675-102472697 GGCTGCATGCTCTGTGGAGCTGG - Intergenic
1112870575 13:103965792-103965814 GGCTGTAAAATCCTTGAAGCAGG - Intergenic
1115058991 14:29168276-29168298 GGTTGTCCACTCAGTGGAGCAGG + Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115484839 14:33900856-33900878 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1116130725 14:40854028-40854050 GGCTGCACACTACTTGGAGCTGG + Intergenic
1116257103 14:42570891-42570913 GGCTACACATTCCATGGAGCTGG + Intergenic
1116902125 14:50371654-50371676 GGCTGTGTGCTCCCTGGAGCTGG + Intronic
1117285611 14:54283099-54283121 GGCTGGGCCCTCCATGGAGCTGG - Intergenic
1118200200 14:63664083-63664105 GGCTGTGTATTCCATGGAGCAGG - Intergenic
1119618005 14:76111579-76111601 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1121824768 14:97001081-97001103 GGCTGCACGTTCCATGGAGCAGG - Intergenic
1122078841 14:99253235-99253257 GGCGGTGCACTCTGAGGAGCCGG - Intronic
1124650408 15:31469679-31469701 GGCTGCACACTCCATGGAGCTGG - Intergenic
1125769564 15:42156164-42156186 GGCTGTAGAGTCCACGGAGCTGG - Intronic
1128790797 15:70432114-70432136 GGCTGCACACTCCATGGAGCTGG - Intergenic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1130029183 15:80296245-80296267 GGCTGCACACTCCATGGAGCTGG - Intergenic
1130183011 15:81651101-81651123 GACTACACACTCCGTGGAGCTGG + Intergenic
1130728783 15:86468027-86468049 GACTGTAAACTCCTTGGGGCAGG + Intronic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1135986678 16:27189386-27189408 GGCTGTGCACTCCACGGAGCTGG + Intergenic
1137238422 16:46633976-46633998 GGCTGCACACTCCATGGAGCTGG - Intergenic
1137291691 16:47055819-47055841 GGCTGCACACTCCATGGAGCCGG - Intergenic
1137588496 16:49679262-49679284 GGCTGCGCCCTCCGTGGAGCTGG + Intronic
1139390114 16:66601963-66601985 GGCTGCACACTCCATGGAGCAGG - Intergenic
1141125459 16:81397797-81397819 GGCTGTAGCGTCTGTGGAGCAGG - Intergenic
1143497833 17:7322602-7322624 GGCTGTCCCTTCCCTGGAGCCGG + Intronic
1144714353 17:17423975-17423997 GACTGCACACTCCATGGAGCTGG + Intergenic
1146086789 17:29837827-29837849 GGCTGCGCACTCCATGGAGCTGG + Intronic
1146425154 17:32731662-32731684 GGTTGTGTGCTCCGTGGAGCTGG + Intronic
1146458648 17:33026190-33026212 GGCTGTTCACCTCGTTGAGCAGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148437768 17:47695988-47696010 GGCTCTGCACTCCCTGGGGCCGG - Exonic
1149085299 17:52709658-52709680 GGCTGCACACTACATGGAGCGGG + Intergenic
1149159790 17:53678159-53678181 GGCTGTGCACTCCATAGAGCCGG + Intergenic
1149160588 17:53687540-53687562 GGCTGCACACTCCATGGAGCTGG - Intergenic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG + Intergenic
1153975009 18:10261520-10261542 CACTGTAAACTCTGTGGAGCAGG - Intergenic
1154072343 18:11163950-11163972 GGCTGAGCACTCCTTGGAGGGGG + Intergenic
1155120861 18:22817001-22817023 GGCTGCACACTCCATGGAGCGGG - Intronic
1155830975 18:30514264-30514286 GGCTGCACACTCCATGGAGCAGG - Intergenic
1156298984 18:35818473-35818495 GGCTGCACGCTCCGTGGAGCTGG - Intergenic
1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG + Intergenic
1159186557 18:64983540-64983562 GGCTGCACCCTCCATGAAGCTGG + Intergenic
1159623735 18:70669025-70669047 GGCTGTGTGCTCCATGGAGCAGG + Intergenic
1160474265 18:79168060-79168082 GGCTGCATGCTCCATGGAGCTGG - Intronic
1165027105 19:32969949-32969971 GGCTGCACACTTCATGGAGCCGG - Intronic
1166322083 19:42024785-42024807 GCCTGTCCACTCTGTAGAGCTGG + Intronic
1166897315 19:46032260-46032282 GGCCTTCCACTCCATGGAGCAGG + Intergenic
1167013016 19:46821513-46821535 GGCTACACACTCCATGGAGCCGG + Intergenic
1167234918 19:48308628-48308650 GGCTGCACACTCCATGGAGCCGG + Intronic
1202652953 1_KI270707v1_random:23559-23581 GGCTGTGCACTCCTCGAAGCTGG + Intergenic
925465621 2:4105372-4105394 AGCTGTGCACCCAGTGGAGCTGG + Intergenic
925995369 2:9288452-9288474 GGCTGTGCCCTCCATGGAGTTGG + Intronic
926859428 2:17292417-17292439 GGCTGCACACTCCATGGAGCTGG - Intergenic
928723801 2:34148419-34148441 GGCTATACACTCCACGGAGCAGG - Intergenic
930800429 2:55437980-55438002 GACTGCACATTCCATGGAGCTGG + Intergenic
932113445 2:69022793-69022815 GGCAGCACACACCTTGGAGCTGG + Intronic
932501742 2:72188174-72188196 GGCTGCAGACTCCATGGAGCTGG - Intronic
933420720 2:82042724-82042746 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
938195072 2:129319553-129319575 GTCAGCACACTCCATGGAGCTGG - Intergenic
938722196 2:134076715-134076737 GGCTGCATGCTCCATGGAGCCGG - Intergenic
939059691 2:137405757-137405779 GGCTTCACAGTTCGTGGAGCAGG - Exonic
940422950 2:153499984-153500006 AGCTGTGCACTCCAGGGAGCTGG - Intergenic
940423908 2:153509346-153509368 GTCTGCGCACTCCGTGGAACTGG - Intergenic
942114490 2:172713835-172713857 GGCTGTGCGCTCCATGGAGCCGG - Intergenic
943427132 2:187750574-187750596 GGCTGGATGCTCCATGGAGCCGG - Intergenic
943526158 2:189020385-189020407 GGCTGCACACTCCATGGAGCTGG + Intergenic
943961062 2:194264646-194264668 GGCTACACACTCCATGGAGCAGG + Intergenic
944483693 2:200181957-200181979 GACTGCACGCTCAGTGGAGCTGG + Intergenic
944586456 2:201177983-201178005 GGGTGCACACTCCACGGAGCTGG + Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
945770528 2:214035888-214035910 GGCTGTGCACTCCATGGAGCTGG - Intronic
946049967 2:216854519-216854541 GACTGTAGACTCCTGGGAGCGGG - Intergenic
946495458 2:220191917-220191939 GGCCGTGCACTCCATGGAGCTGG + Intergenic
948316232 2:237030460-237030482 GGCTGACCCCTCAGTGGAGCAGG + Intergenic
1168983537 20:2027435-2027457 GGCTGCACACTCCATGGAGCTGG - Intergenic
1170500888 20:16974629-16974651 GCCTGTACATTCCATGGAGCGGG + Intergenic
1172226253 20:33307012-33307034 GGCTGTGCCCTCCCTGGGGCAGG - Intronic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1172676537 20:36676841-36676863 GGCTGCACACGCCATGGAGCTGG + Intronic
1173524620 20:43722043-43722065 AGCTGCACACTCCATGGATCTGG - Intergenic
1175064292 20:56272311-56272333 TGCTGCACACTCCATGAAGCTGG + Intergenic
1175233699 20:57493457-57493479 TGCTGGTCACTCCGTGGAGGAGG + Intergenic
1176064717 20:63188539-63188561 GGCAGTAGAGTCCGTGGAGTTGG - Intergenic
1176087224 20:63303689-63303711 GGCTGGTCACTCCCTGGCGCGGG + Intronic
1176104459 20:63379389-63379411 GGCTGTGCGCTCTGTGGAGCTGG + Intergenic
1177736101 21:25092477-25092499 GGCTGCACACTCCATGGAGATGG - Intergenic
1178270194 21:31182469-31182491 GGCCGTCCACTCGGTGGGGCGGG + Exonic
1181088482 22:20456277-20456299 GGCTGTAAACACCATGGAGTGGG + Intronic
1182549575 22:31093576-31093598 AGCTGTAGCCACCGTGGAGCCGG + Intronic
1183684954 22:39356477-39356499 GGCTGGGGACTCCCTGGAGCAGG - Intronic
1184504818 22:44894342-44894364 GCCTGTAAACTTCGTGGAGTTGG - Intronic
1184509997 22:44927807-44927829 GGCTGTAAACTACCTGGTGCTGG - Intronic
1184665594 22:45987315-45987337 GGCCGCATACTCCATGGAGCAGG + Intergenic
949870384 3:8583062-8583084 GGATGTAAACTCCGTGGAGCAGG + Intergenic
950968855 3:17166597-17166619 GGCTGTGCACTCTGTGCTGCAGG - Intronic
951509029 3:23480514-23480536 GGCTGCACCCTCCATGGAACCGG - Intronic
952016030 3:28958777-28958799 GGCTGAAGACTCCACGGAGCAGG + Intergenic
952269552 3:31817783-31817805 GGCTGCACACTCCATGGAGCTGG - Intronic
953163661 3:40445169-40445191 GGTTGTACACTCCATGGAACAGG + Intergenic
955241625 3:57183117-57183139 TGCTGCACACTCCATGGAGCCGG - Intergenic
955402649 3:58604166-58604188 GATTGTACTCTCGGTGGAGCTGG + Intronic
956427472 3:69151645-69151667 AGCTGTAAACTCCGAGGAGATGG + Intergenic
957586933 3:82144875-82144897 GTGTGTACACTCAGTGGAGGAGG - Intergenic
958019782 3:87981064-87981086 GGCTGTGCACTTCAGGGAGCTGG - Intergenic
960634413 3:119768818-119768840 GGCTGCACCCTCCATGGAGCTGG - Intergenic
960690441 3:120341714-120341736 GGCTGCACATTCCATGGAGCTGG + Intronic
961493460 3:127273919-127273941 GGATGCACACTCCATGGAGCCGG + Intergenic
962105419 3:132383727-132383749 GGCTGCATGCTCCATGGAGCCGG - Intergenic
962786093 3:138769138-138769160 GGCTGCATGCTCTGTGGAGCTGG - Intronic
962824689 3:139089260-139089282 GGCTGCACACTCCATGGAGCTGG - Intronic
964075337 3:152685187-152685209 GGCTGTGCTCTCTATGGAGCTGG - Intergenic
965118748 3:164522693-164522715 GGCAGCACACTCCTTGAAGCCGG - Intergenic
965205314 3:165713729-165713751 GGTTGCACACTCCATGGAGCCGG - Intergenic
965229361 3:166029948-166029970 GCCTGTGTACTCCATGGAGCTGG - Intergenic
965541941 3:169879828-169879850 GACTGCACAATCCATGGAGCTGG + Intergenic
965813538 3:172614873-172614895 GGCTGCACACTCCATGGAGCTGG - Intergenic
966254051 3:177898351-177898373 GGCTGTGCACTCCGCAGAGCTGG + Intergenic
966491314 3:180531447-180531469 GGCTGCCCACTCCATGGAGCTGG + Intergenic
967480405 3:189966243-189966265 GGCTGCCCACTCCCTGGTGCTGG + Intronic
967650013 3:191974081-191974103 AGCTGCACACTCCATGAAGCTGG - Intergenic
968980914 4:3848910-3848932 GGCTGCAGGCTGCGTGGAGCTGG - Intergenic
969323171 4:6425245-6425267 GGCTGTGCACGCCCAGGAGCAGG + Intronic
969728656 4:8940381-8940403 GGCCGTGCACACCGTGAAGCTGG + Intergenic
969972304 4:11060464-11060486 GGCTGTACACTCAGTGCAGTAGG - Intergenic
972203734 4:36747331-36747353 GGCCACACACTCCATGGAGCCGG + Intergenic
972931194 4:44072742-44072764 GGCTACACATTCTGTGGAGCTGG - Intergenic
974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG + Intergenic
976129546 4:81870424-81870446 GGCCGTTCACTCCATGGAGCTGG + Intronic
976922765 4:90458239-90458261 GGCGGTGCACTCCATGGAGCAGG - Intronic
978248696 4:106604852-106604874 GGCTGTACTTCCCATGGAGCCGG - Intergenic
978498325 4:109383991-109384013 GGCTGTGCACTTCATGCAGCCGG + Intergenic
978663546 4:111155145-111155167 GGCTGCGCACTCCATGGAGCTGG - Intergenic
978964697 4:114726073-114726095 GGCTGCACACTCCATGGAGCTGG - Intergenic
980582538 4:134773328-134773350 TGCTGTGCACTCCATGGAGTTGG + Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
981723163 4:147821607-147821629 GGCTGTGCACGTGGTGGAGCAGG + Intronic
982158173 4:152541028-152541050 GCCTGCACACTCCATGCAGCAGG - Intergenic
984375215 4:178921746-178921768 GGCTGCATGCTCCGTGGAGTTGG + Intergenic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
988073857 5:26326567-26326589 GGCTGCATGCTCCATGGAGCGGG - Intergenic
991359458 5:65803841-65803863 GGCTGTGCGCTCCATGGAGCTGG - Intronic
992029794 5:72709515-72709537 GGCTGTACACTCCATGGAGCTGG - Intergenic
994107870 5:95966438-95966460 GGCTGTGCACTTCCTGGGGCTGG + Intergenic
994245532 5:97471703-97471725 GGCTGCATGCTCCATGGAGCTGG - Intergenic
995859905 5:116629990-116630012 GGCTGTACATTCCCTGGGGAGGG - Intergenic
998792168 5:145777617-145777639 GGCTGCACACTCCATGAAGCTGG + Intronic
1003192481 6:3886806-3886828 GGCCGAACACTCAGTGGTGCTGG - Intergenic
1004520667 6:16358613-16358635 TGCTGCATACTCCATGGAGCTGG + Intronic
1004696891 6:18042557-18042579 GGCAGCACACTCCATGGAGCTGG + Intergenic
1005021622 6:21423887-21423909 GGCTGCACACTCCATGGAGCCGG - Intergenic
1006500747 6:34457572-34457594 GGCTGCACACTCCATGGAGCTGG + Intergenic
1006766431 6:36510534-36510556 GGCTGTGTGCTCCATGGAGCTGG - Intronic
1006867794 6:37222833-37222855 GGTTACACACTCCATGGAGCCGG - Intronic
1009582887 6:65558547-65558569 GGATGTGCAATCTGTGGAGCTGG - Intronic
1012052423 6:94361911-94361933 TGCTGCACACTCCACGGAGCAGG - Intergenic
1012749634 6:103140827-103140849 GGCTGCACACTCCACAGAGCTGG - Intergenic
1013474980 6:110498830-110498852 GGCTGAGGGCTCCGTGGAGCAGG - Intergenic
1014227280 6:118862308-118862330 GGCTGTACGCTCCATGGAGCTGG - Intronic
1014384592 6:120785606-120785628 GGTTGTGCCCTCTGTGGAGCAGG + Intergenic
1015434616 6:133172115-133172137 GGCTGAGCACTACATGGAGCTGG + Intergenic
1015455806 6:133424870-133424892 GGCTGCACACTCCATGGAGCGGG - Intronic
1016648174 6:146434307-146434329 TGCTGACCACTCCCTGGAGCTGG - Exonic
1016957774 6:149643081-149643103 GGCAGCTCACTCTGTGGAGCTGG - Intronic
1017993830 6:159513619-159513641 GGCTGCACGCTCCATGGGGCTGG + Intergenic
1018491127 6:164294565-164294587 GGCTGTTCACACAGTGGAGAGGG + Intergenic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1020959577 7:14786496-14786518 GGCTGTGTATTCCCTGGAGCCGG + Intronic
1021561568 7:21972718-21972740 GGCTGCATACTCCATGGAGCCGG - Intergenic
1023618960 7:42050023-42050045 CGCTGTGCACTTAGTGGAGCTGG - Intronic
1023773651 7:43583193-43583215 GCCTGTTCACTCCGAGCAGCCGG - Exonic
1023790629 7:43750343-43750365 GGCTGCACACTCCATAGAGCTGG - Intergenic
1024024419 7:45399188-45399210 GGCTGTGTGCTCCATGGAGCCGG + Intergenic
1024254642 7:47531739-47531761 GGCTGCACTCTCCATGGAGCCGG + Intronic
1024786354 7:52911681-52911703 GGCTGTGCACTCCAGGGAGCTGG - Intergenic
1025098574 7:56116469-56116491 GGCGGTACAGTGCCTGGAGCAGG + Intergenic
1025834411 7:65081382-65081404 GGCTGTACAGTGCCTGGAGCTGG + Intergenic
1025904177 7:65770901-65770923 GGCTGTACAGTTCCTGGAGCTGG + Intergenic
1026392158 7:69912421-69912443 GGCTGTATGCTCTGAGGAGCCGG - Intronic
1027128239 7:75572622-75572644 GGCTGCACACTCCATGGAACAGG + Intronic
1030387540 7:108883450-108883472 GGCTATATACTCCCTGCAGCAGG - Intergenic
1035434698 7:158850467-158850489 GGCTGCACACTGCGTGGAGCTGG - Intergenic
1039210264 8:35205080-35205102 GGCTGAACACTCCCAGGAGCTGG - Intergenic
1039921213 8:41895913-41895935 GGCTGCAGGCTCCGGGGAGCGGG - Intronic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1042395919 8:68292362-68292384 GGCTGGACACTCCATGGAGCCGG + Intergenic
1043087294 8:75850056-75850078 GGCTGCACACTCTGTGGCACAGG - Intergenic
1044259349 8:90098837-90098859 GGCTGCACGCACCATGGAGCCGG - Intergenic
1044525114 8:93242321-93242343 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1044962200 8:97542478-97542500 GGCTGCACACTCCATGGAGCCGG + Intergenic
1045586156 8:103539602-103539624 GCCTGTATGCTCTGTGGAGCAGG - Intronic
1048548079 8:135405301-135405323 GGCTGCACACTCCATGGAGCTGG - Intergenic
1049823849 8:144654605-144654627 GGCTGCACACTCCATGGAGCTGG + Intergenic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050947846 9:11549291-11549313 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1051355045 9:16233620-16233642 GGCAGTGCACCCCATGGAGCTGG + Intronic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1052707376 9:32010340-32010362 GGCTGCACACTCCACAGAGCTGG + Intergenic
1053077909 9:35150730-35150752 GGCTACACACTCCATGGAGCCGG + Intergenic
1057468378 9:95337029-95337051 GGCTGCATGCTCCGTGGAGCTGG + Intergenic
1057548356 9:96034652-96034674 GGCTGCACACTCCATGAAGCTGG + Intergenic
1057709730 9:97428540-97428562 ATCTGTACTCTCCTTGGAGCCGG - Exonic
1059104657 9:111501241-111501263 GGCTGCATCCTCTGTGGAGCTGG + Intergenic
1059401094 9:114071068-114071090 GGCTGCACACCCCATTGAGCTGG + Intronic
1059528856 9:115017641-115017663 GGCTATACCCTGCGTGGTGCTGG + Intergenic
1062329004 9:136028591-136028613 GGCTGCACGCTCCATGGAGCTGG + Intronic
1203751704 Un_GL000218v1:86653-86675 GGCTGTGCACTCCTCAGAGCTGG + Intergenic
1187871370 X:23767426-23767448 GGCTGCGTGCTCCGTGGAGCTGG - Intergenic
1188434752 X:30148028-30148050 GGCTCTGCACTCCATGGAGCTGG + Intergenic
1188727908 X:33607532-33607554 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1189360022 X:40343327-40343349 AGCTGTACACTCCATGGAGCCGG + Intergenic
1189416136 X:40815428-40815450 GGCTCCACACTTAGTGGAGCTGG + Intergenic
1190369382 X:49726783-49726805 GGCTGTGTGCTCCTTGGAGCTGG + Intergenic
1190445033 X:50515303-50515325 GGCTGCACACTCCCTGGAGCTGG - Intergenic
1190621038 X:52287517-52287539 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
1194380129 X:93181183-93181205 GGCTGCACACCCCATGAAGCTGG + Intergenic
1195454430 X:105051689-105051711 AGCTGCACACTCCATGCAGCCGG - Intronic
1196883846 X:120224176-120224198 GGCTGCACATTCCATGGAGCTGG - Intergenic
1197342084 X:125287035-125287057 GACTGCACACTCCATGGAGCTGG + Intergenic
1197428805 X:126332824-126332846 GGCTGTTCATACCGTGAAGCTGG - Intergenic
1197796152 X:130300107-130300129 GGCTGCCCACTCCATGGAGCAGG - Intergenic
1197951950 X:131907825-131907847 TGCTGCACACTCCGTGGAGCCGG + Intergenic
1199103627 X:143837149-143837171 GACTGTACACTCCATGGAGCAGG + Intergenic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1200972078 Y:9163586-9163608 GGCTCTTCACTCTGTGAAGCTGG + Intergenic
1201983210 Y:19930438-19930460 GGCTGCATGCTCTGTGGAGCTGG + Intergenic
1202138946 Y:21700705-21700727 GGCTCTTCACTCTGTGAAGCTGG - Intergenic
1202340605 Y:23861071-23861093 AGCTGTACACTCTGTGAAACTGG + Intergenic
1202530161 Y:25809011-25809033 AGCTGTACACTCTGTGAAACTGG - Intergenic