ID: 902645565

View in Genome Browser
Species Human (GRCh38)
Location 1:17795668-17795690
Sequence GAAATTAAACAGAAGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902645558_902645565 9 Left 902645558 1:17795636-17795658 CCTTTGGCTCCAATCAGGGAGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 356
902645556_902645565 10 Left 902645556 1:17795635-17795657 CCCTTTGGCTCCAATCAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 356
902645559_902645565 0 Left 902645559 1:17795645-17795667 CCAATCAGGGAGGCAGTAAAACT 0: 1
1: 0
2: 0
3: 11
4: 132
Right 902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902645565 Original CRISPR GAAATTAAACAGAAGGGTGG GGG Intronic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
903996116 1:27306474-27306496 GAAATGAAAAAAAAGGGTGGTGG - Exonic
904336463 1:29801372-29801394 TAAATTAAACACAATGCTGGAGG - Intergenic
905282997 1:36860840-36860862 GAAATCAGGCAGAAGGGTAGCGG + Intronic
906101563 1:43267241-43267263 GAAATAAAACACAAGGGCAGGGG + Intronic
906464136 1:46061003-46061025 GAAATTACACAGAAAGGATGTGG - Intronic
906984099 1:50664495-50664517 ACAACTAAACAGAAGGCTGGGGG + Intronic
907110223 1:51920329-51920351 GGAATTAAACAGCTGGGCGGTGG - Intronic
908398665 1:63749808-63749830 CAAATAGAACAGAAAGGTGGGGG + Intergenic
909250873 1:73354435-73354457 GAAATGAAACAGAAGGAAAGAGG + Intergenic
909632656 1:77783850-77783872 GACAGGAAACAGAATGGTGGTGG - Intronic
910046701 1:82926151-82926173 GAAATTGAACAGAAGGGGCCAGG - Intergenic
910187592 1:84560253-84560275 GCTATTACACAGAAAGGTGGTGG - Intronic
911132919 1:94408834-94408856 GCAATGAAACACAAGGATGGAGG + Intergenic
912484652 1:110016160-110016182 GAAAATGAAAAGAAGTGTGGAGG + Intronic
913011992 1:114692531-114692553 AAAATTAGTCAGATGGGTGGTGG + Intronic
913517413 1:119616185-119616207 GAAACTAAGCAAAGGGGTGGAGG + Intergenic
913690455 1:121275020-121275042 GGATTTAAACAGAAGCGAGGGGG - Intronic
914147086 1:145004939-145004961 GGATTTAAACAGAAGCGAGGGGG + Intronic
915406984 1:155667528-155667550 TAAATAAAAAAGAAGGCTGGGGG + Intronic
915999119 1:160597539-160597561 GAAATTAAAAATCAGGGTGCTGG - Intergenic
916086568 1:161274641-161274663 GAAGATAAACAGGAGGGTTGAGG + Intronic
917329896 1:173869892-173869914 GAAGTTCAACAGAAGGTAGGGGG - Intronic
917337200 1:173937189-173937211 TAACTTAAACAAATGGGTGGTGG - Exonic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
917825798 1:178819139-178819161 GAAATTAACCAGGTGCGTGGTGG - Intronic
918431143 1:184462026-184462048 CAAATTAAACAACAGGGAGGAGG + Intronic
918935966 1:190922847-190922869 GAGATTAAACAGACAGGTGAGGG - Intergenic
920477773 1:206293508-206293530 GGATTTAAACAGAAGCGAGGGGG - Intronic
920949491 1:210558857-210558879 GAAATTAAAAAGGAAGGTGCGGG + Intronic
922522385 1:226266579-226266601 GAAATAAAAAAAAAGGGGGGGGG + Intronic
922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG + Intronic
923598422 1:235379377-235379399 ACAATTAAACAGCATGGTGGTGG + Intronic
924374467 1:243390911-243390933 GAAATTAAACATCAAGGTGATGG - Intronic
1063327441 10:5118477-5118499 TAATTTACACAGAAAGGTGGAGG + Intronic
1063462528 10:6223609-6223631 GAAATGAGACATGAGGGTGGGGG - Intronic
1064329042 10:14376681-14376703 AAAAAAAAACAAAAGGGTGGGGG + Intronic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068926303 10:62542862-62542884 GAAATTAAAAATAGAGGTGGTGG + Intronic
1069303848 10:66943511-66943533 GAAAAAAAAAAAAAGGGTGGGGG - Intronic
1069968600 10:72144504-72144526 GAAATTAAGAAGTAAGGTGGTGG - Intronic
1070385942 10:75924728-75924750 GACATTAAACAAGGGGGTGGGGG + Intronic
1071770772 10:88727042-88727064 CAAATTAAACAGAGAGATGGGGG - Intronic
1074233151 10:111557769-111557791 GAAATAAAACAGCAGCATGGAGG - Intergenic
1074457320 10:113606623-113606645 GAAATTTAGGAGAAGGGAGGTGG + Intronic
1075992902 10:126853170-126853192 AAAATAAAATAGAAGGCTGGAGG - Intergenic
1076282106 10:129256145-129256167 AAAAATAAACCGAAGGGAGGTGG + Intergenic
1078670268 11:13358081-13358103 GAAAGGAAAGAGAAGGGAGGTGG - Intronic
1079901725 11:26195116-26195138 GAAAGAAAACAGAAAGGTGGTGG + Intergenic
1080383471 11:31797012-31797034 GAAAATAAAGCGAGGGGTGGGGG - Intronic
1080576171 11:33601072-33601094 GAAATAAAACAGGTGGGTGCAGG + Intronic
1080805618 11:35650610-35650632 GAAAAAAAAAAGAAGGGAGGAGG + Intergenic
1081774692 11:45669275-45669297 GAAATAAAACAAAAAGGTGGGGG + Intergenic
1082569963 11:54726929-54726951 GAAATAAAATAAAATGGTGGTGG - Intergenic
1083788579 11:64969359-64969381 GAAATTATAGAGAAGGGATGAGG + Intronic
1085020776 11:73205538-73205560 GAAAATAGACTGAATGGTGGAGG - Intergenic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085374394 11:76045660-76045682 AAAATTCAACAGAATGCTGGAGG + Intronic
1085553833 11:77401557-77401579 GAAACTAAAAAGATAGGTGGGGG - Intronic
1085614782 11:77988598-77988620 GATATGAAACAGAAGGGTAAAGG + Intronic
1087621791 11:100551398-100551420 GTAATCATACAGAAGAGTGGAGG - Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1087861857 11:103168055-103168077 GAAACAAAACAGAAGGCTGAGGG - Intronic
1088779069 11:113116338-113116360 GAAGGGAAAGAGAAGGGTGGTGG + Intronic
1089740154 11:120576869-120576891 GACCTTAACCAGAAGGCTGGAGG - Intronic
1091142363 11:133246130-133246152 AAAATTAAAAAGAAGCTTGGTGG + Intronic
1092096630 12:5848303-5848325 GAAACTAAAAATAAGGGTGATGG - Intronic
1092533811 12:9367504-9367526 GAAATGGAACAGCAGGGAGGGGG + Intergenic
1093314618 12:17632813-17632835 GAAATGAATCAGAACAGTGGAGG - Intergenic
1093982613 12:25491367-25491389 GAAAGTCTACAGAGGGGTGGTGG + Intronic
1094219371 12:27975543-27975565 GAAATAAAACAGACGGGTCCCGG - Intergenic
1095369197 12:41446200-41446222 TACATAAAACAGAAGGGAGGGGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097480311 12:60116106-60116128 GAAAGGAAACAGAAGAGAGGAGG + Intergenic
1097605990 12:61755075-61755097 CTAATTAAAAAGAAGGGTGGGGG - Intronic
1099413192 12:82357819-82357841 CAAATTAAAGCGAAGGCTGGAGG + Intronic
1100960853 12:99961288-99961310 GAATTTAAACAGAAAGGAAGTGG + Intronic
1101473824 12:105024827-105024849 GAAATAAAAGAGAAGGGTTTTGG - Intronic
1101626492 12:106448036-106448058 CAAATCAAACAGAAAGGGGGAGG - Intronic
1102666473 12:114578244-114578266 TAAATAGAACAGAAAGGTGGAGG + Intergenic
1103074402 12:117970157-117970179 GACAATAAACAGATGGGTGGTGG - Intergenic
1103298901 12:119912182-119912204 GAAGCTAAACAGAAGGATTGAGG - Intergenic
1103319718 12:120084944-120084966 GAAAGAGAACAGAAGGGAGGGGG - Intronic
1103424694 12:120823006-120823028 CAAATTAAACAGACAGGTGTAGG + Intronic
1103722826 12:122983732-122983754 GAAATCAAAGAGAAGGCAGGTGG + Exonic
1104272136 12:127292173-127292195 CAAATAGAACAAAAGGGTGGAGG + Intergenic
1106711375 13:32337914-32337936 GAAATTAAACGGAAGTTTGCTGG + Exonic
1106909716 13:34450562-34450584 GAGAGTAAACAGGCGGGTGGTGG - Intergenic
1107197772 13:37674331-37674353 GAAATTAAACAGATGTGGGATGG - Exonic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108418608 13:50226441-50226463 GAAATTGAGCTGAAAGGTGGTGG - Intronic
1108739329 13:53319208-53319230 GAAAGTAAACCAAAAGGTGGGGG - Intergenic
1110186709 13:72683474-72683496 GAAATTAGAAAGAAGGGAAGGGG - Intergenic
1110609257 13:77470776-77470798 GAAATTAGTCAAAAGGGTGAAGG + Intergenic
1110925676 13:81148524-81148546 TCAAATAAACAGTAGGGTGGTGG - Intergenic
1110930832 13:81214189-81214211 GAAATCAAATATAAGGATGGAGG - Intergenic
1111062308 13:83038231-83038253 GAAATGGAAGATAAGGGTGGAGG - Intergenic
1111110271 13:83699481-83699503 GAAATTAAGGAAAAGGGTAGTGG - Intergenic
1112246555 13:97740469-97740491 GAAATTAACCAGGTGTGTGGTGG + Intergenic
1113725054 13:112592443-112592465 AAAATGAAACACCAGGGTGGGGG - Intergenic
1114811482 14:25905546-25905568 AAAAAAAAAAAGAAGGGTGGGGG - Intergenic
1114905830 14:27125036-27125058 GTAATTTATCAGAAGGGTGAAGG - Intergenic
1115183750 14:30660178-30660200 GCAATTAAAAAGAAGTGAGGAGG - Intronic
1115590668 14:34861672-34861694 TAAATTAAAGAGAAGGAAGGTGG + Intronic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1116664340 14:47755659-47755681 GGAATTACACAGAAGGAGGGAGG + Intergenic
1119056988 14:71432506-71432528 GTATTTACACAGAAAGGTGGAGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1120294817 14:82626426-82626448 GAAATAAGACAAAAGGGAGGAGG + Intergenic
1124037440 15:26068774-26068796 GAAAATAAAAAGAAGGAAGGAGG - Intergenic
1125180292 15:36875336-36875358 GAAATTTAAATGAAAGGTGGAGG - Intergenic
1125617545 15:41028704-41028726 GAAATTAGCCAGCATGGTGGCGG + Intronic
1125772555 15:42179645-42179667 GAAATAAAAAAGAAAGGTAGGGG + Intronic
1126600993 15:50427379-50427401 GAAAGTAAACTGAAGAGTGGTGG + Intronic
1127804550 15:62506888-62506910 AAAAATAAAAATAAGGGTGGAGG - Intronic
1128251134 15:66165152-66165174 GAAATAAACCAGAAGTGAGGTGG + Intronic
1128917718 15:71579683-71579705 GAAATAAAACCCAAGGGTTGAGG - Intronic
1128963350 15:72031621-72031643 GAAATCACAGATAAGGGTGGTGG + Intronic
1130760212 15:86811560-86811582 GAAATAAAACAGAGGGGAGTTGG - Intronic
1132100215 15:99017701-99017723 GTATGTAAACAGAAGGGAGGAGG - Intergenic
1133885360 16:9822460-9822482 GAAAAGAAAGAGAAGGGAGGAGG + Intronic
1134384893 16:13762578-13762600 GAATTTACAAAGAAAGGTGGGGG + Intergenic
1134444736 16:14322258-14322280 GAAATTAACAGGAGGGGTGGTGG - Intergenic
1135087945 16:19489768-19489790 GAAATTAAAGACAAGTATGGTGG - Intronic
1135159465 16:20080867-20080889 GAAATAAAACACATGGGTTGGGG - Intergenic
1135470513 16:22725476-22725498 GAAATTAACCATCACGGTGGTGG + Intergenic
1135513710 16:23111599-23111621 GGAATTCAACAGATGGGGGGTGG + Intronic
1138768420 16:59632084-59632106 GATATTCAACAAAAGTGTGGTGG + Intergenic
1140528392 16:75643154-75643176 GAAACTAAACAGATTGGTGTAGG + Intronic
1141111968 16:81277222-81277244 GTATTTAGACAGAAGGTTGGTGG + Intronic
1141280001 16:82622875-82622897 GAAATGAAGCAGAAGGGATGGGG - Intergenic
1141490550 16:84369394-84369416 GAAGCTAAAAAGAAGGGTGTTGG - Intronic
1141532937 16:84659296-84659318 GAAATTAAACAGAAGAGGCTGGG - Intronic
1143539090 17:7558886-7558908 GAAAATAAAAAGGAGGGAGGAGG - Exonic
1143643884 17:8217018-8217040 AAAATTAGCCAGAATGGTGGCGG - Intergenic
1143806519 17:9432803-9432825 GAAAGTACACAGAAGGTTAGAGG - Intronic
1143815433 17:9508658-9508680 GAAATAACACAGAAAGATGGGGG + Intronic
1143983477 17:10891266-10891288 GAAATTAAATACAATTGTGGAGG - Intergenic
1145803221 17:27705084-27705106 GAAATTAAACAAAAGCCTTGAGG - Intergenic
1147915415 17:43882634-43882656 GAATTTAGGCAGAAGGATGGAGG - Intronic
1148489025 17:48011601-48011623 GAAAGAAAAGAAAAGGGTGGAGG + Intergenic
1148631791 17:49116171-49116193 AAAATTTAAAAGAAGGGAGGGGG + Intergenic
1149793835 17:59501162-59501184 AAAATAAAGTAGAAGGGTGGGGG + Intergenic
1149853583 17:60057693-60057715 GATATAAAAAAGATGGGTGGGGG + Intronic
1150060280 17:62062825-62062847 GAAATTAAGAAGAGAGGTGGTGG + Intronic
1150519501 17:65851723-65851745 GAGATTAAATATAAGGGTGGTGG + Intronic
1151983593 17:77528434-77528456 GAAATTAAAAAGCAGGGGGAGGG - Intergenic
1152493998 17:80657825-80657847 TAAAATAAATAGGAGGGTGGTGG - Intronic
1152696539 17:81800505-81800527 GAAGGGAAACAGGAGGGTGGTGG - Intergenic
1153051412 18:905955-905977 GAAATGAAAAGAAAGGGTGGAGG - Intronic
1153682382 18:7512831-7512853 CAAATGAAAGAGAAGGGAGGGGG - Intergenic
1155049931 18:22138087-22138109 CAAATTAAAAAAAAGGGGGGGGG - Intergenic
1155579437 18:27286194-27286216 GAAAGTTAACAGCAGGGTTGGGG - Intergenic
1155920204 18:31596113-31596135 GAAATTAAGGAGAAGGCAGGGGG - Intronic
1156208493 18:34912229-34912251 GAAAACAAACAAAAGGCTGGAGG + Intergenic
1156259970 18:35437189-35437211 GAAATTTAACAGGAAGGTCGTGG - Intergenic
1156608453 18:38697410-38697432 AAAATAAAAAAGAATGGTGGTGG - Intergenic
1156767574 18:40676675-40676697 GAGATAAAACAGAGTGGTGGAGG - Intergenic
1158186504 18:54777865-54777887 GAAATAAAAAAGAAGGGGTGGGG - Intronic
1158259559 18:55591811-55591833 GAAATTCAGCAGAAGGGGGCTGG - Intronic
1158342828 18:56485140-56485162 TAAATTAAACATAAAGCTGGGGG + Intergenic
1158369520 18:56784121-56784143 GAAAGAAAACAAAAGGCTGGGGG - Intronic
1160830510 19:1102718-1102740 GAAAATAAACACAAGTCTGGAGG - Intergenic
1161622188 19:5303969-5303991 TAAAATAAACAGAAGCGCGGAGG + Intronic
1162157257 19:8686947-8686969 GAAATTAAACAGAAATTTGATGG + Intergenic
1163822143 19:19502168-19502190 TAAGTTACACAGAGGGGTGGGGG - Intronic
1164470772 19:28529697-28529719 TAAATTAAACATAAATGTGGTGG - Intergenic
1164856324 19:31527460-31527482 GAAGGGAAACAGAAGGGTGAGGG + Intergenic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
1166093129 19:40523151-40523173 GAAATAATACAGGAGGGTAGTGG + Intronic
1166733361 19:45070838-45070860 GACATTAGGCAGAAGAGTGGGGG + Exonic
1167450373 19:49564525-49564547 GCAATTAGACAGAGGGGTGCAGG + Intronic
1167634958 19:50649075-50649097 GAAATCAAGCAAAAGAGTGGTGG + Intronic
925296675 2:2781563-2781585 GAAGATAAACAGATGGGTGTGGG - Intergenic
925308635 2:2866361-2866383 GAATTAAAACAGGAGGCTGGAGG - Intergenic
926976457 2:18521167-18521189 GAAATTACATTGAAGGGGGGGGG - Intergenic
927069223 2:19508526-19508548 TAAATTATACACAAGGGTGTGGG - Intergenic
930247118 2:48995505-48995527 GAAATTAAAAGGCAGGGAGGAGG + Intronic
931969994 2:67575597-67575619 GAAATTAAACAGAAGTGTACAGG + Intergenic
932226200 2:70042946-70042968 GAAATTGAACCTCAGGGTGGAGG + Intergenic
932322707 2:70833909-70833931 GAAATTAAAAAGAATAGTGACGG - Exonic
932943943 2:76204755-76204777 CAAATTTAACAGAAGGGGGCAGG - Intergenic
935008490 2:99106639-99106661 GAAATTCCACAGAAGGTGGGAGG - Intronic
935243456 2:101197916-101197938 GAAAACAAACAAACGGGTGGGGG + Intronic
936096328 2:109532903-109532925 GAAACTAAACAGAAGGAAGCAGG - Intergenic
936768817 2:115887094-115887116 GTAATTAATCAGAATGGTTGGGG - Intergenic
939532206 2:143378076-143378098 GAAATTAACTAGAATGGTGAAGG + Intronic
940168971 2:150806172-150806194 AAATTTACACAGAAAGGTGGGGG + Intergenic
941662285 2:168207403-168207425 AAAATGAGACATAAGGGTGGAGG - Intronic
943139553 2:183963543-183963565 GAAATTCAAGAGATGGTTGGAGG + Intergenic
943305645 2:186258290-186258312 GAAAATATACTGAAGGGAGGAGG + Intergenic
944345092 2:198654310-198654332 GAAAGAAAACAGATAGGTGGAGG - Intergenic
946698673 2:222387581-222387603 GAAATTAATCACTAGGGTGATGG - Intergenic
946926340 2:224631010-224631032 GAAAACAAACAGCAGGGTGCAGG + Intergenic
948441459 2:237993284-237993306 GAAGTTAAAAAGAAGAGTGCTGG - Intronic
948542081 2:238698260-238698282 GAAAATAAAAAGATGGGTAGAGG - Intergenic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1171025247 20:21624231-21624253 GAAATGAGACATAAGGCTGGGGG + Intergenic
1171721289 20:28565708-28565730 CAAATAAAACACAAGGGTAGAGG - Intergenic
1171756784 20:29117853-29117875 CAAATAAAACACAAGGGTAGAGG + Intergenic
1171785486 20:29460069-29460091 CAAATAAAACACAAGGGTAGAGG - Intergenic
1171862827 20:30417116-30417138 CAAATAAAACACAAGGGTAGAGG + Intergenic
1172026909 20:31954815-31954837 GCATTTGAACAGAAGTGTGGAGG + Intergenic
1173507319 20:43598257-43598279 GACAGAAAATAGAAGGGTGGTGG + Intronic
1173628228 20:44489639-44489661 GTAATTAAACTGCAGGATGGAGG + Exonic
1174465409 20:50713303-50713325 AAAATTAACCAGCATGGTGGTGG - Intergenic
1175117349 20:56691921-56691943 CAAATAGAACAGAATGGTGGAGG + Intergenic
1175575552 20:60058133-60058155 GAAATTAAATAGGAGGCTGGTGG + Intronic
1178195536 21:30340630-30340652 GAAATTAATAAGAAGGCTGCTGG - Intergenic
1178386201 21:32152440-32152462 GAAATAAAACAAAAAGGGGGAGG - Intergenic
1180413836 22:12641696-12641718 CAAATAAAACACAAGGGTAGAGG + Intergenic
1181549476 22:23629014-23629036 AAAATTAAAGAGAAGAGCGGAGG - Intronic
1183295971 22:37029765-37029787 AAAATAAAACAGAAAGGAGGCGG - Exonic
1183436972 22:37802065-37802087 GTCATTAAACATAGGGGTGGGGG + Intergenic
1183598433 22:38826141-38826163 GGACTTAAAGAGAAGGGAGGTGG - Intronic
1183997734 22:41648066-41648088 GAAAAGAAACAGAAGAGAGGAGG - Intronic
949352631 3:3140020-3140042 GAAATTAAAATAAAGGCTGGGGG - Intronic
949906233 3:8860973-8860995 CAAATACAACAAAAGGGTGGAGG + Intronic
951154826 3:19338411-19338433 AAAATTATACAGAGTGGTGGTGG - Intronic
952070683 3:29631803-29631825 CAAATTAAACAGAAAAGGGGAGG + Intronic
952187026 3:30980963-30980985 GAAAAAAAAAAAAAGGGTGGGGG - Intergenic
952498513 3:33936928-33936950 AAAATTAGAAAGAAGGGAGGTGG - Intergenic
955203111 3:56869414-56869436 TAAGTTAAACAGCAGGGTAGAGG + Intronic
957842209 3:85686157-85686179 GATATTAAACAGAAGGAAGTAGG - Intronic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958913214 3:100018376-100018398 GAAATTAAACTGCAGTGTTGTGG + Intronic
959541711 3:107547638-107547660 GAAAGTACACAGAAGAGTGCCGG - Intronic
963372594 3:144420234-144420256 GAAATTTAAAAGAAGGGATGTGG + Intergenic
964335179 3:155647080-155647102 GAAATCAAAAAGGAAGGTGGTGG - Intronic
965134375 3:164742313-164742335 GAAATGAAACAGCAGTTTGGGGG - Intergenic
967515318 3:190361941-190361963 GTAATAAAAGATAAGGGTGGGGG + Intronic
968223065 3:196952815-196952837 TGAATAAAACAGAAAGGTGGAGG + Intronic
969909934 4:10435003-10435025 GAAATTAAAAATAAAGATGGGGG - Intergenic
969969956 4:11036472-11036494 GAATTTAAAAAGAATGGTTGCGG + Intergenic
972556771 4:40189376-40189398 GAAAGGACTCAGAAGGGTGGAGG + Intergenic
972659187 4:41097839-41097861 GAGGTTAAAAAGAAGTGTGGAGG + Intronic
973018142 4:45166982-45167004 TAAGTTATACAGAAGGTTGGAGG - Intergenic
973595399 4:52483547-52483569 GTAATTAAACATAAGGCTGTTGG - Intergenic
973686650 4:53377453-53377475 GTTATTAAAAAGAAGGGTGGGGG + Intergenic
974467137 4:62271951-62271973 GTTTTTACACAGAAGGGTGGAGG - Intergenic
974912365 4:68138052-68138074 GAAATTGAACAGAAGGTTCAAGG - Intergenic
975110189 4:70614726-70614748 TTAATTAAACAGGTGGGTGGGGG + Intergenic
976536211 4:86221195-86221217 CAAACTAAACAGAAGTGAGGAGG + Intronic
976788583 4:88851190-88851212 GAAAAAAAAAAGAGGGGTGGGGG + Intronic
978571274 4:110140545-110140567 AAAATTAAAAAGAAGCATGGTGG - Intronic
978815152 4:112896040-112896062 GAACTGAAGCAGTAGGGTGGCGG - Intronic
980383098 4:132051493-132051515 GAATATAAACACAAGAGTGGAGG - Intergenic
981283500 4:142988980-142989002 GAATTGAAACAGAAGGATGCTGG - Intergenic
983279008 4:165656812-165656834 GTAACTAATAAGAAGGGTGGAGG + Intergenic
984352126 4:178608628-178608650 GAAAGAAAACAGTGGGGTGGAGG + Intergenic
985785201 5:1889710-1889732 GAAACTCAGCAGGAGGGTGGGGG - Intergenic
986359519 5:6962973-6962995 CAAATGAAACAGAAGAGTGGAGG + Intergenic
986840231 5:11688045-11688067 GAAATCAAAGAGAAAAGTGGTGG + Intronic
987053688 5:14170391-14170413 AAAGTTAAACTGAAGGGTGGAGG - Intronic
987183065 5:15386491-15386513 GAGATGAGACAGAAGGGTGGGGG - Intergenic
987254001 5:16130088-16130110 GAAGTTAGACAGAAGGTTAGTGG - Intronic
988040409 5:25881694-25881716 GAAAATAAAAAGGAGGGTGAGGG + Intergenic
988063918 5:26210067-26210089 GAAAGTAAACAGCATGGTAGTGG + Intergenic
988140548 5:27233521-27233543 CAAAATAAACATAAGGGTGCGGG + Intergenic
989058547 5:37387749-37387771 GAAATTGAAGAGAGGGGTTGTGG + Intronic
989085674 5:37673589-37673611 GAAAGAAAAAAAAAGGGTGGGGG - Intronic
989419154 5:41215667-41215689 GTAAAAAAACAGAAGGGTGCAGG + Intronic
992390310 5:76325164-76325186 GAAAGTCAACAGAGGGCTGGAGG + Intronic
994302941 5:98167713-98167735 GAAATTAAATAGAATGATGAAGG + Intergenic
994906454 5:105845747-105845769 GAAATTTAACAGCAGTATGGGGG - Intergenic
994926534 5:106122952-106122974 GACTTTAAACAGAAGGGTCAGGG + Intergenic
995099740 5:108285277-108285299 AACATTAAACAGAAGCTTGGAGG - Intronic
995312227 5:110726777-110726799 GAAATTGAACACAAATGTGGTGG - Intronic
995702070 5:114947360-114947382 GAAATAAAAGAGAAGGGATGGGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
997626305 5:135333299-135333321 GAAATGAGAGAGAACGGTGGAGG - Intronic
998536959 5:142942097-142942119 AAAACTAAAGGGAAGGGTGGAGG + Intronic
999655508 5:153806689-153806711 GAAAAGAGAAAGAAGGGTGGAGG + Intronic
999899670 5:156073134-156073156 GAAACTAGAAAGAAGGGAGGTGG - Intronic
1000205952 5:159058753-159058775 AAAATTAAACAGAAGGGAAGTGG - Intronic
1000931953 5:167262579-167262601 GAGATTAAAATGAAGGGTAGAGG + Intergenic
1001108495 5:168875790-168875812 GAAGGGAAAGAGAAGGGTGGAGG + Intronic
1002692215 5:181058421-181058443 GATCTTAAACAGAAGGGAGGTGG + Intronic
1002867245 6:1132309-1132331 AAAATTAAACGTAAGGGTGTGGG + Intergenic
1003354114 6:5350044-5350066 GAAAGTAAAGAAAGGGGTGGGGG - Intronic
1003890638 6:10560946-10560968 GAATGTAAGCAGAAGGGAGGGGG - Intronic
1003933081 6:10946154-10946176 GAAAGAAAACAGAATGGTTGGGG - Intronic
1004553781 6:16675452-16675474 AAAATTAAAACGAAGGGTGGAGG + Intronic
1005122250 6:22402427-22402449 GAAATGAAAGCGAAGGGAGGAGG + Intergenic
1005123741 6:22421148-22421170 GGCATTAAACAGAAGGATCGTGG - Intergenic
1005359995 6:25023057-25023079 GTCATTAAAGGGAAGGGTGGGGG - Intronic
1006760134 6:36453303-36453325 AAAATAAAACAAAAGGCTGGGGG - Intronic
1008062604 6:47014330-47014352 GGAATTAAAGAGAAGAGTGAAGG - Intronic
1009021633 6:57952939-57952961 GAAATTGAAGAGAGGGGTTGCGG - Intergenic
1009403276 6:63281255-63281277 GAAAACAAACAAAAGGGTCGGGG + Intronic
1010182642 6:73105903-73105925 GAAAATAATCAGAAGCTTGGGGG - Intronic
1010240796 6:73613963-73613985 GAAATTAAACAAAATGGCTGGGG + Intronic
1010786179 6:80004249-80004271 GAAACGAAGGAGAAGGGTGGCGG + Intronic
1012551557 6:100468116-100468138 AAAAATAAAGAGAATGGTGGTGG - Intergenic
1013091574 6:106905190-106905212 GTTTTTAAACAGAAAGGTGGGGG - Intergenic
1015405682 6:132834690-132834712 GGAAAAAAACAGAAGGGTAGAGG - Intergenic
1016984631 6:149885717-149885739 GAAATGGAACAGAAGAGTGCAGG + Intronic
1017655963 6:156630326-156630348 AAAATTAACCAGAGTGGTGGTGG + Intergenic
1017731302 6:157318922-157318944 GAAATGAAACAGAAAAGTTGAGG + Intronic
1018072612 6:160178870-160178892 GAAATTTAAAAGCAGGGTTGCGG + Intronic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1020497250 7:8871418-8871440 GAAATTAAAAAGTATGGTTGGGG + Intergenic
1020993429 7:15231145-15231167 GAAATTAAGCAGGGGAGTGGTGG - Intronic
1021014327 7:15513874-15513896 AAAATATCACAGAAGGGTGGTGG - Intronic
1021044780 7:15909150-15909172 GAAGTTATACAGAAGGGGGCAGG - Intergenic
1022200398 7:28110958-28110980 AAAATTAAAAACTAGGGTGGGGG + Intronic
1022812941 7:33886962-33886984 GAAATAAAATAGAATGGTGCTGG + Intergenic
1024366811 7:48529526-48529548 GAAACTGAACAGAAAGCTGGAGG - Intronic
1026442970 7:70459951-70459973 ACAATTCTACAGAAGGGTGGAGG + Intronic
1027338384 7:77178994-77179016 GCAAATAAACAGAAGGGAGCAGG + Intronic
1027450321 7:78324238-78324260 AAAAAAAAACAGAAGGCTGGTGG + Intronic
1027727956 7:81830916-81830938 GAAAGTAAAGAGTAGAGTGGTGG + Intergenic
1027849976 7:83438836-83438858 AAAATTTAACTGAAGGATGGAGG + Intronic
1028161800 7:87494126-87494148 TAAAGTAAACAGCAGTGTGGAGG + Intergenic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1028985504 7:97005821-97005843 GAATTTAAAGAGGGGGGTGGAGG - Exonic
1029227467 7:99038531-99038553 GAAATAAGACAGAAGGATGTAGG + Intronic
1029777344 7:102691808-102691830 GCAAATAAACAGAAGGGAGTAGG - Intergenic
1029977959 7:104851952-104851974 GAAAGGAGACAGAAGGGAGGAGG - Intronic
1030233471 7:107233189-107233211 GAAAATAAACTGAGGGGTGGAGG + Intronic
1031579268 7:123451209-123451231 GAAAGTAAACATCAGGGCGGGGG - Intergenic
1031862638 7:126999024-126999046 CAAATAAAACAGCAGGGTGCTGG + Intronic
1032988923 7:137368850-137368872 GAAATTGAGCAGTAAGGTGGTGG + Intergenic
1034038349 7:147848616-147848638 GAAATGCAACTGAAGGGAGGAGG - Intronic
1034079704 7:148265111-148265133 GTAAGTAAACAGAAGTGCGGTGG + Intronic
1034119877 7:148617494-148617516 GAAAGGAAAAAGAAGGGAGGAGG + Intergenic
1034884100 7:154784344-154784366 TGAATTTTACAGAAGGGTGGGGG - Intronic
1035171502 7:157019694-157019716 GAAATTAAATTGAAGGGGGATGG - Intergenic
1035758046 8:2048937-2048959 AAAATTAGCCAGAATGGTGGGGG - Intronic
1036013385 8:4753483-4753505 GAAATGAAAAAGAAGAATGGAGG - Intronic
1036160080 8:6379641-6379663 GAAGCAAACCAGAAGGGTGGTGG - Intergenic
1036446415 8:8825154-8825176 GAACTTAAAGAAAAGGGTTGCGG + Intronic
1037590187 8:20305324-20305346 AAAATTAAATAGAATTGTGGTGG + Intergenic
1040332126 8:46391082-46391104 GAAAACAAACTGCAGGGTGGTGG + Intergenic
1041146344 8:54880512-54880534 GAAATAAAAAAGCAGGGTTGGGG - Intergenic
1041591319 8:59588071-59588093 GTACTTAAACAGAAGTGTGAAGG - Intergenic
1041711665 8:60899917-60899939 GAAAGTAAACAGGAGGCTTGAGG - Intergenic
1042767331 8:72337888-72337910 AAAATTAAGCAGAAGGTTGTGGG + Intergenic
1042811808 8:72833878-72833900 AAAATTAACAGGAAGGGTGGTGG - Intronic
1043029550 8:75116127-75116149 GAAATTAAAGAGAGAGGTAGAGG - Intergenic
1043058566 8:75471597-75471619 GAAATTAATAAGAAGGAAGGAGG - Intronic
1043985301 8:86688094-86688116 GAAAATGAACAGAAGCGTGAGGG + Intronic
1044046735 8:87444773-87444795 GAAATTATAAAGAAGTGTAGAGG + Intronic
1045077193 8:98583475-98583497 GAAAGTTAACAGCAGGGTTGGGG + Intronic
1045515247 8:102853855-102853877 GAAATTAAATCGGGGGGTGGGGG + Intronic
1046027511 8:108743425-108743447 GAAATTAAACAGAAAAAAGGTGG + Intronic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046614957 8:116466056-116466078 GAAATGAAAGAGAGTGGTGGAGG + Intergenic
1046857789 8:119053669-119053691 GCAATTAAAAAAAAAGGTGGGGG + Intronic
1047107316 8:121746762-121746784 GAAAAAAATCAGAAGAGTGGTGG - Intergenic
1050566300 9:6887477-6887499 GAAAAGAAACAGAAAGGTGGGGG + Intronic
1052273175 9:26648974-26648996 GAATTTAAAAAGAAGGTAGGTGG - Intergenic
1052431013 9:28366549-28366571 GAAATGAAAAAGAATGCTGGAGG + Intronic
1053325678 9:37147469-37147491 AAAATTAAAAATAAGAGTGGGGG + Intronic
1054990435 9:71319482-71319504 CAAATAAAACAGAACGGTAGAGG - Intronic
1056863272 9:90206869-90206891 GAAGTTATAAAAAAGGGTGGCGG + Intergenic
1059568102 9:115404051-115404073 AAAAATAGAAAGAAGGGTGGAGG - Intergenic
1061773200 9:132944099-132944121 GAACTTAAAGAGAGGGGTCGGGG - Intronic
1062571584 9:137188268-137188290 GAAACGAAACGGAAAGGTGGTGG + Intronic
1202801714 9_KI270720v1_random:5486-5508 CAAATAAAACACAAGGGTAGAGG - Intergenic
1203446264 Un_GL000219v1:59298-59320 CAAATAAAACACAAGGGTAGAGG - Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1189038754 X:37519820-37519842 GAAATTAAAAGAAAGGGTGAGGG + Intronic
1189490142 X:41464869-41464891 GAAAATAAAAAGAAGACTGGGGG - Intronic
1190688057 X:52891672-52891694 GAAGCTGAACAGAAGGCTGGAGG + Intronic
1190697925 X:52964120-52964142 GAAGCTGAACAGAAGGCTGGAGG - Intronic
1192017185 X:67343844-67343866 GAAGTTAATCATAAGGATGGTGG - Intergenic
1192327052 X:70141905-70141927 GAGATTAAAAAAAAGGGGGGGGG + Intronic
1192420268 X:71023088-71023110 AAAATACAACAGAGGGGTGGAGG + Intergenic
1194816361 X:98446717-98446739 GAAATAAAACAGAAAGGGGCTGG - Intergenic
1194846227 X:98812601-98812623 GCATTCAAAAAGAAGGGTGGAGG - Intergenic
1195764945 X:108286210-108286232 GAAAGTATATAGAAGTGTGGGGG + Intronic
1199955390 X:152737848-152737870 GAAATATAAGAGAAGGGTGAGGG + Intergenic
1200281565 X:154781317-154781339 GAAAAAAAAAAGAAGGGCGGCGG + Intronic