ID: 902649326

View in Genome Browser
Species Human (GRCh38)
Location 1:17826380-17826402
Sequence CCTCCACCAAGGCCACAGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902649316_902649326 25 Left 902649316 1:17826332-17826354 CCGGGTTCACAAAGCGCCTGTTC 0: 1
1: 0
2: 1
3: 3
4: 64
Right 902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG 0: 1
1: 0
2: 1
3: 27
4: 277
902649315_902649326 26 Left 902649315 1:17826331-17826353 CCCGGGTTCACAAAGCGCCTGTT 0: 1
1: 0
2: 1
3: 4
4: 78
Right 902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG 0: 1
1: 0
2: 1
3: 27
4: 277
902649322_902649326 9 Left 902649322 1:17826348-17826370 CCTGTTCAGGGAGCTGATGGGGG 0: 1
1: 0
2: 0
3: 27
4: 187
Right 902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG 0: 1
1: 0
2: 1
3: 27
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902649326 Original CRISPR CCTCCACCAAGGCCACAGTC TGG Exonic
900366444 1:2313724-2313746 CCTCCACCAAGACCCCAGCCTGG - Intergenic
900532392 1:3161033-3161055 CCTCCACCAAACCCTCAGGCAGG + Intronic
900537343 1:3185440-3185462 CCTGCACTTAGGCCACAGCCTGG - Intronic
900884030 1:5402887-5402909 CAGCCACCAAGGGCACTGTCTGG - Intergenic
901272232 1:7961509-7961531 CCCCCACGAATGGCACAGTCCGG - Intronic
902194948 1:14791518-14791540 CCTCCACCAGGACCAGAGACTGG - Intronic
902401767 1:16161838-16161860 GCTCCACCAAGGCCACACAGTGG - Intergenic
902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG + Exonic
903188435 1:21642539-21642561 CCTGCACTAAGAGCACAGTCAGG + Intronic
903225352 1:21891463-21891485 CCTCCATCAAGCCTAGAGTCTGG - Intronic
903347943 1:22699718-22699740 CCTCCACCAAGGCTACAGCTGGG - Intergenic
903765284 1:25730109-25730131 CCAGCACCAAGGCCAAGGTCTGG + Intronic
904501570 1:30915722-30915744 CCTCCACCATGGCCAGCGGCAGG - Intergenic
906511600 1:46413261-46413283 CCTCCACAGCGGCCAGAGTCAGG - Intronic
906552468 1:46676905-46676927 CCTTCACCATGGATACAGTCCGG - Exonic
908536911 1:65086685-65086707 CTTCCAATCAGGCCACAGTCTGG + Intergenic
909020070 1:70420610-70420632 CCCCAACCCAGGCCACAGACAGG - Intronic
909890225 1:80996046-80996068 CCTCCAGCAAGAACACAGACTGG + Intergenic
912431204 1:109629395-109629417 CCTCCACCCACGCCTCAGGCAGG - Exonic
914916514 1:151822530-151822552 CCTCCGCCACCCCCACAGTCTGG + Intronic
916249285 1:162721250-162721272 CCTGCTCCAGGGCCACAGTGTGG - Intronic
919816485 1:201443960-201443982 CCTGCACTAAGGTCACCGTCTGG - Intergenic
920571639 1:207022376-207022398 ACTCCACCGAAGCCAGAGTCAGG - Exonic
921216080 1:212937753-212937775 CCTCCAACAATACCAGAGTCAGG - Intergenic
921314392 1:213876509-213876531 TCTCCACCATGGCCTCAGCCAGG + Intergenic
922440826 1:225653539-225653561 CCTCCCCCACGGCCACGGTGCGG + Intergenic
1064963042 10:20987562-20987584 CCACCACCAGAGCCACAGACTGG + Intronic
1065278017 10:24105861-24105883 CCTCCCCCAAGGCTCCACTCAGG - Intronic
1065378058 10:25062645-25062667 CCTCCACCCAGGCCTGAGTGTGG - Intergenic
1066802371 10:39206145-39206167 CTTCTGCCATGGCCACAGTCTGG + Intergenic
1067092064 10:43272257-43272279 CCCACCCCAAGGCCACAGACTGG - Intergenic
1068790568 10:61026477-61026499 CCTCCACCACGGTCACTCTCAGG - Intergenic
1068958101 10:62839131-62839153 CTGCCACCCAGGCCACAGACTGG + Intronic
1069071942 10:63998402-63998424 CCTCTCCCAAGGCCCCAGCCTGG + Intergenic
1069779666 10:70946757-70946779 CCTTCGCCAAGGCCTCAGTCTGG + Intergenic
1071363844 10:84878605-84878627 GACCCACCCAGGCCACAGTCAGG - Intergenic
1072625044 10:97105888-97105910 CCTCCGCCAAGGGCACCATCAGG + Intronic
1074150578 10:110756056-110756078 CCTGAGCCATGGCCACAGTCAGG - Intronic
1076426743 10:130372429-130372451 CCAGCACCAAGGACACAGGCTGG - Intergenic
1077364506 11:2156087-2156109 CCTCAGCAAAGGCCACAGCCTGG + Intronic
1077466394 11:2735634-2735656 TCACCACCAAGACCACAGTGGGG + Intronic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1078916482 11:15783511-15783533 GCCCCACCAAGGACACTGTCTGG - Intergenic
1079203805 11:18396458-18396480 CCTACAGCAAGGACACAGCCAGG - Exonic
1081639462 11:44742860-44742882 CCTCAGCCAAGGCCCCAGCCAGG - Intronic
1083751686 11:64764410-64764432 CCACCACCAAAGCCACACACAGG + Intergenic
1083945386 11:65920145-65920167 ACACCAGCAAGGCCACAGACTGG + Intronic
1083955671 11:65981648-65981670 CCTCAACCAGGGCCTCAGCCAGG + Intergenic
1084045272 11:66564513-66564535 CATCCAGCCAGGCCACAGGCAGG - Intronic
1084330114 11:68425201-68425223 CCACCACCAGGGCCACAGGGCGG - Exonic
1085516174 11:77113128-77113150 CCCCAACCAAGGCCCCAGGCAGG - Intronic
1086091748 11:83011751-83011773 CCTTCACCAAGGCCAGACTCTGG + Intronic
1086753546 11:90529748-90529770 CATTCCCCAAGGCCACAGTGGGG - Intergenic
1087513614 11:99129066-99129088 TCTCCAGCAAGGCCACAGAACGG + Intronic
1090497837 11:127231983-127232005 CCTCCGAGAAGGCCACAATCAGG - Intergenic
1090669413 11:128935700-128935722 CCTAGACCAAGGCCTCAGTAGGG + Exonic
1092886381 12:12927736-12927758 CCTACACCAAGGGAAGAGTCAGG + Intergenic
1093728679 12:22544060-22544082 CCTCCACGAAGGCATCAGTCAGG + Exonic
1101082601 12:101204192-101204214 CCTCCACCAAGGTGACAGGAAGG - Intronic
1102578370 12:113871745-113871767 CCTGAGCCCAGGCCACAGTCTGG - Intronic
1103904639 12:124321098-124321120 CCTCCACCCAGGGCACAGAGTGG - Intergenic
1104017318 12:124969609-124969631 CATAAACCAAGGCCACAGTGAGG + Intronic
1104500586 12:129281939-129281961 CCTCCACCAACCCCACAGGGAGG - Intronic
1105200680 13:18172246-18172268 CCAACCCCCAGGCCACAGTCAGG - Intergenic
1108483928 13:50905934-50905956 TCTCCACCCAGTCCACAGTGTGG - Intergenic
1108518134 13:51221990-51222012 TCTCCCCCAGGCCCACAGTCCGG - Intergenic
1113269523 13:108657305-108657327 CCTCTACCAAAGCCACAGTTAGG + Intronic
1113665533 13:112138582-112138604 CCTCCACCCAGGCAAGAGTTTGG + Intergenic
1113812317 13:113150150-113150172 CCTGCATCCAGGCCACAGCCTGG + Intergenic
1114612776 14:24053215-24053237 TCCCCACCAATGCCACACTCAGG + Intronic
1115678527 14:35709947-35709969 CATTCACCAAGACCACATTCTGG - Intronic
1116056230 14:39866787-39866809 CCTCCACCTAGGCCTCCGGCAGG - Intergenic
1118357595 14:65027484-65027506 CCTCCTCCAAAGCCACCTTCTGG - Exonic
1118661334 14:68016326-68016348 CTCCCACCATGGCCTCAGTCAGG + Intronic
1118893933 14:69930459-69930481 CCTGCCCCAAAGCCACAGTTTGG - Intronic
1119716095 14:76860595-76860617 CTTCCACCCAAGCCAAAGTCAGG - Intronic
1121649125 14:95544038-95544060 CTTCCACCAAGTCCCCATTCTGG - Exonic
1122103121 14:99429353-99429375 ACACCACCAAGGGCACAGGCTGG + Intronic
1122322997 14:100866764-100866786 CCAGCACCCAGGCCACAGACAGG - Intergenic
1122716179 14:103698309-103698331 CCACCACTCAGGCCACAGTGGGG - Exonic
1122884657 14:104705685-104705707 CCTCCCCCAAGGTCACGGCCCGG + Intronic
1122919276 14:104873410-104873432 ACCCCACCCAGGCCACAGTCAGG - Intronic
1123071574 14:105644962-105644984 CCTGCCCCAAAGCCAAAGTCAGG + Intergenic
1123076535 14:105670017-105670039 CCTGCCCCAAAGCCAAAGTCAGG + Intergenic
1123938216 15:25204166-25204188 CCTCCTCCAGGGCCACCATCTGG - Intergenic
1124659828 15:31538134-31538156 CCTTCACAAGGGCCACAATCAGG + Intronic
1125328670 15:38562562-38562584 CCTCCACCAAAGGCAGAGTAGGG + Intronic
1126243378 15:46472570-46472592 CCCACACCAAGGCCATACTCTGG - Intergenic
1127762002 15:62148544-62148566 CCTCCCCCAAGTCCACAGGCTGG + Intergenic
1127773697 15:62250053-62250075 ACTTGACCAAGGCCACAGCCAGG + Intergenic
1129227583 15:74179027-74179049 CCTCCACCAAGCCCCCAGTAGGG + Intergenic
1131154288 15:90065290-90065312 CCTCTCCCAGGGCCACGGTCAGG - Intronic
1131512473 15:93056889-93056911 CCCCCACAAAGGCCACAGTGGGG + Intronic
1132025110 15:98398755-98398777 CAGCCACCAAAGCCACAGGCTGG - Intergenic
1132204667 15:99978117-99978139 TCTCCAGCAAGGCCAGGGTCAGG - Intronic
1132265891 15:100470404-100470426 CCTCTGCCAACCCCACAGTCAGG - Intronic
1132311511 15:100861219-100861241 CCACCACCAAGGTCTCAGCCTGG + Intergenic
1132881181 16:2162362-2162384 CCACCACCGTGCCCACAGTCTGG - Intronic
1134026085 16:10955092-10955114 CCTTGTCCAAGGCCACAGTTAGG + Intronic
1134749755 16:16616684-16616706 ATTCCACCAAGGCCAAAGCCAGG - Intergenic
1134995718 16:18736931-18736953 ATTCCACCAAGGCCAAAGCCAGG + Intergenic
1135232335 16:20720579-20720601 CCAACACCCAGGCCACAGACCGG - Intronic
1136545628 16:30953178-30953200 CCTCCACCATGGCCACCTGCAGG - Exonic
1137056720 16:35749610-35749632 CCTCCATCCAGGCCCCAGCCAGG - Intergenic
1139583464 16:67886387-67886409 CCGCAAGCAAGGCCACAGCCAGG - Intronic
1139969978 16:70768292-70768314 ACTTGACCAAGGCCACAGCCAGG + Intronic
1140349438 16:74248007-74248029 CCTCCCCCAAGGTGTCAGTCAGG - Intergenic
1142228362 16:88888322-88888344 CCCCAGCCCAGGCCACAGTCAGG + Intronic
1143190024 17:5034125-5034147 CCAACACCAAGGCCAGAGTTAGG + Exonic
1143239186 17:5429558-5429580 CTTCCACCAAGGCCTGAGCCTGG - Intronic
1143962712 17:10733854-10733876 CCTCCACCCCTGCCACATTCCGG - Intergenic
1144146054 17:12398899-12398921 ACTGCAACAAGGCCAAAGTCGGG + Intergenic
1144631164 17:16873228-16873250 CCTCGACCAAGGCCTCAGGAAGG + Intergenic
1144650122 17:17002109-17002131 CCTCGACCAAGGCCTCAGGAAGG - Intergenic
1144671666 17:17136304-17136326 CCACCACCAAGTCCACACTCTGG + Exonic
1144759763 17:17700684-17700706 CGTCCGCCGAGGCCGCAGTCCGG + Intronic
1144997708 17:19281889-19281911 CCCTCAAGAAGGCCACAGTCTGG - Intronic
1145029713 17:19495357-19495379 CCCCCACCCTGGCCAGAGTCTGG + Intergenic
1145274914 17:21423476-21423498 CCTCCACCATAGCCACAGCGTGG + Intergenic
1145312767 17:21709375-21709397 CCTCCACCATAGCCACAGCATGG + Intergenic
1145939306 17:28734201-28734223 CCTCCAGCCAGGCCACTGTAAGG - Intronic
1146398381 17:32486360-32486382 CCTCCGCCGAGGCCAGGGTCCGG - Intergenic
1146650339 17:34602467-34602489 CCTCCACCCTGGCCCCTGTCAGG - Intronic
1146794693 17:35773072-35773094 CCTCAGCCAAGGCCACAGGGAGG + Intronic
1147918509 17:43902346-43902368 CCTCCTCCTACGCCCCAGTCAGG + Intronic
1148509470 17:48156427-48156449 CCTGCACCAGCGCCACAATCTGG + Intronic
1151627091 17:75283676-75283698 CCTCCACCTGGGCCCCAGCCGGG - Intronic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1152784694 17:82241639-82241661 CCTCACCCACGGCCACAGTGAGG + Intronic
1153094257 18:1383081-1383103 CCTCTCCCAGGGCCGCAGTCTGG + Intergenic
1157716286 18:49889831-49889853 CCTGAGCCAAGGCTACAGTCTGG + Intronic
1157781552 18:50444373-50444395 CCTCCACCAAGTCCCCACTGGGG - Intergenic
1158877069 18:61743649-61743671 CCACCACCATGGCCTAAGTCAGG + Intergenic
1159995431 18:74960214-74960236 CCTCCACCCAGTCCACACTCAGG - Intronic
1159995438 18:74960250-74960272 CCTCCACCAAGCACTCACTCAGG - Intronic
1159995445 18:74960286-74960308 CCTCCACCAAGCACTCACTCAGG - Intronic
1159995452 18:74960322-74960344 CCTCCACCAAGCACTCACTCAGG - Intronic
1159995459 18:74960358-74960380 CCTCCACCAAGCACTCACTCAGG - Intronic
1159995468 18:74960394-74960416 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995475 18:74960430-74960452 CCTCCACCAAGCACTCAGTCGGG - Intronic
1159995505 18:74960574-74960596 CCTCCACCCAGTCCACACTCAGG - Intronic
1159995537 18:74960718-74960740 CCTCCACCCAGTCCACACTCAGG - Intronic
1159995551 18:74960790-74960812 CCTCCACCAAGCACTCACTCAGG - Intronic
1159995574 18:74960898-74960920 CCTTCACCCAGTCCACACTCAGG - Intronic
1159995583 18:74960934-74960956 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995591 18:74960970-74960992 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995600 18:74961006-74961028 CCTCCACCCAGTCCTCACTCAGG - Intronic
1159995609 18:74961042-74961064 CCTCCACCCAGTCCTCACTCAGG - Intronic
1160512456 18:79460177-79460199 CCTCCACCCAGGCAGCAGCCCGG + Intronic
1160682390 19:417813-417835 CCTCCACCCAGCCCCCAGCCAGG - Intronic
1161724932 19:5923257-5923279 CCTACACCAAGGCAACAGCGCGG - Exonic
1162323618 19:9985753-9985775 CATCCCCCAAGACCACAGCCTGG + Intronic
1162822392 19:13230946-13230968 CCCCCAACAAGGCCAAAGTGAGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165778425 19:38418251-38418273 CCGCCCCCGAGGCCACAGCCTGG - Intronic
1167390794 19:49193638-49193660 CCTCCAGCCAGGCCACAGGCAGG - Intronic
925657814 2:6168130-6168152 ACTCCACCAAGCTCACAGTTTGG - Intergenic
926152467 2:10432692-10432714 CCTCTTCCCAGGCCACAGTAAGG - Intergenic
926315105 2:11703976-11703998 CCCCCACCAAGGCAGCAGTCAGG - Intronic
926670711 2:15574664-15574686 CCTCCTCCAAGGCCCCACACAGG - Intergenic
927435641 2:23064020-23064042 CCACCACCACCACCACAGTCAGG + Intergenic
927513355 2:23658190-23658212 CCTCCACCAAGGCCAGCTCCAGG + Intronic
927633400 2:24793545-24793567 CCGCCACCCTGGCCACGGTCCGG - Intronic
930372105 2:50514987-50515009 CCACCCCCCAGGCCACAGACAGG + Intronic
932862789 2:75312045-75312067 TCTCACCCAAGGACACAGTCAGG + Intergenic
933553338 2:83802798-83802820 CCTCCACCAGCACCACAGTGTGG + Intergenic
934653034 2:96103274-96103296 GCTCCACCTAGGCCAGAGTATGG + Intergenic
935264105 2:101380296-101380318 TCTCCACCAAGGATACAGCCCGG - Intronic
935818239 2:106867900-106867922 CCCCCACAAAAGCCACTGTCTGG + Intronic
936076298 2:109403882-109403904 CCCCCACCATGGCCACTGTGAGG + Intronic
938138743 2:128779923-128779945 CCTCCTCCCAGGCCCCAGGCAGG - Intergenic
938552931 2:132397318-132397340 CCAGCCCCAAGGCCACAGCCAGG - Intergenic
942597797 2:177608715-177608737 CCTCCATCAAGGTCACAAACTGG + Intergenic
943697590 2:190952613-190952635 CCACCAACAAAGCCACAGCCTGG - Intronic
945590513 2:211723837-211723859 CTTACACCAAGGCCTTAGTCTGG + Intronic
947593042 2:231395872-231395894 CCTCCTCCGTGGCCACAGACGGG + Intronic
948202983 2:236143099-236143121 CCTCCCCCAAACCCACAGACAGG - Intergenic
948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG + Intronic
948407569 2:237733874-237733896 CCCCCACCAAGCCCAGAGCCGGG + Intronic
1168956075 20:1835424-1835446 CCTCCATAACGTCCACAGTCAGG + Intergenic
1171185442 20:23121181-23121203 ATTCCACCAAAGCCACAGTCTGG + Intergenic
1175016291 20:55794608-55794630 CCTCCACCAAGGATAGAGTAGGG - Intergenic
1175264439 20:57694025-57694047 CCTGCAGCAGGGCCACAGCCTGG + Intronic
1176111217 20:63411593-63411615 CCTCCACCAGGGCCCCAGGCAGG - Intronic
1180500192 22:15923315-15923337 CCTCCTCCAGGGCCACAGGGTGG - Intergenic
1180747824 22:18103663-18103685 CCTCCACCCTGCCCACAGCCCGG + Exonic
1180938366 22:19640936-19640958 CCTGCACTAACGCCACAGGCAGG - Intergenic
1181027874 22:20136065-20136087 CCTCCTCCAGGGCCACAGGCAGG - Intronic
1181393917 22:22604564-22604586 CATTCACCAAGGCCACAGGAGGG + Intergenic
1182257481 22:29049444-29049466 CCTCCACCTGGACCACAGCCTGG + Exonic
1182299609 22:29330302-29330324 CCTCCACCAGGGCCACCCCCTGG + Intronic
1183152308 22:36047469-36047491 CCTCCACAGAGCCCCCAGTCTGG - Intergenic
1183198179 22:36367715-36367737 CCTTTGCCCAGGCCACAGTCTGG + Intronic
1183338354 22:37264085-37264107 CTGCCACCGAGGCCACAGCCAGG + Intergenic
1183648867 22:39142348-39142370 ACCCCACCCAGGCCACAGCCAGG + Intronic
1183816691 22:40307772-40307794 CCTCCACCCACCCCACACTCAGG + Intronic
1183986212 22:41572009-41572031 ACTCCCCCAAGTCCCCAGTCTGG + Exonic
1184884187 22:47332285-47332307 CCTCCACCAGGGTCAGAGCCAGG - Intergenic
1185035792 22:48476172-48476194 CCTCTGCCCTGGCCACAGTCTGG + Intergenic
1185185297 22:49395698-49395720 GCTGCATCATGGCCACAGTCAGG - Intergenic
1185186247 22:49402237-49402259 CCTCCAGCAGGGCCAGTGTCTGG + Intergenic
1185274478 22:49944404-49944426 CCTCCTCCATGGCCAGAGTGAGG - Intergenic
949906862 3:8864928-8864950 CCACCAGCGAGGCCAGAGTCAGG + Intronic
951737858 3:25887557-25887579 CCTGCACCAAGCCCACAGAGAGG - Intergenic
952838626 3:37625865-37625887 CCTCCACCCATGCCTCAGTGTGG + Intronic
953418245 3:42735167-42735189 CCTCCCCCACGGCCTCGGTCTGG - Intronic
953627129 3:44580424-44580446 CCACCACCAAGTCCACACTCTGG - Intronic
953908188 3:46878852-46878874 CCTCCTCCTAGGCCCCAGCCTGG + Intronic
954449750 3:50565459-50565481 CTCTCACCAAGGCCACAGCCAGG + Exonic
954702510 3:52457692-52457714 CCCACCCCAAGGCCAAAGTCAGG - Intronic
955303670 3:57809041-57809063 CCTCCACCAAGAGCACAGGGAGG - Intronic
958056462 3:88418790-88418812 CCAACACCTAGGCCACTGTCTGG + Intergenic
958768802 3:98402211-98402233 CCTCTCCCAGGGCCACAGCCTGG + Intergenic
960341365 3:116479008-116479030 CTTGCACCCAGGCCACAGGCTGG - Intronic
962330227 3:134471823-134471845 CCTCCACCATGCCCACAGAGTGG - Intergenic
964074814 3:152680827-152680849 CCTCCACCATGCCAACAGTGTGG - Intergenic
965793308 3:172411751-172411773 CCTTCACCAAGCCCACGGCCTGG + Intergenic
967271784 3:187738685-187738707 CAGCCACAAAGGCCGCAGTCTGG + Intronic
968006336 3:195245670-195245692 CCTCCCACCAGGCCCCAGTCCGG - Intronic
968570546 4:1338225-1338247 TCTCCACCGAGGCCTCAGTGGGG + Intronic
968593843 4:1472559-1472581 TCTCCACCAAGACGCCAGTCTGG + Intergenic
969477469 4:7429702-7429724 CCTGAACCAAGGCCACAGAGTGG + Intronic
971487283 4:27173124-27173146 CTTCCACCACATCCACAGTCGGG - Intergenic
972158935 4:36198888-36198910 CCTCCACCAAGAGCACAGGGAGG + Intronic
972285446 4:37643823-37643845 CCTGCACCAAAACCACAGCCTGG - Intronic
972717550 4:41662858-41662880 ATTCCACAAAGGCCACGGTCGGG - Exonic
985606547 5:861180-861202 TCTCCTCCAAGACCTCAGTCTGG - Intronic
985822014 5:2166829-2166851 CCTCCCCCAGGTCCACAGACTGG - Intergenic
987255231 5:16143568-16143590 TCTCCTCCAAGGGCACATTCCGG - Intronic
987769655 5:22284356-22284378 CCTCTCTCAAGGCTACAGTCAGG + Intronic
992518405 5:77521413-77521435 CCAACCCCAAGGCCACAGACCGG - Intronic
993587208 5:89746239-89746261 TCTCCAGCAAGGGCACAGACTGG - Intergenic
995145794 5:108786091-108786113 CCTCCAACAAAGCCAAACTCAGG - Intronic
997472275 5:134123672-134123694 CCAGCACCAAGGTCACAGGCTGG - Intronic
998094669 5:139390506-139390528 CCTCCACCCAGGCCATACCCAGG + Intergenic
998253312 5:140567014-140567036 CATCTACCAACTCCACAGTCAGG - Exonic
998959664 5:147471333-147471355 CCTCCACCTAGGCTAGAATCAGG + Intronic
999202503 5:149826313-149826335 CCCCCACCAAGGACAGAGGCTGG - Intronic
999290203 5:150419973-150419995 CCTTCACCCAAGCCACAGCCTGG + Intergenic
999296191 5:150461058-150461080 CCTTCACACAGCCCACAGTCTGG + Intergenic
1002088201 5:176789041-176789063 CCTCTATCAAGGACAAAGTCTGG + Intergenic
1002598502 5:180339800-180339822 TCCCCACCAAGGGCACAGGCTGG + Intronic
1002948804 6:1788184-1788206 AGCCGACCAAGGCCACAGTCGGG + Intronic
1003399587 6:5780967-5780989 CCTGCTCCAAGGCCCCAGGCTGG - Intergenic
1003769913 6:9288774-9288796 CCTCCACTAAGGCCAGAGCAGGG + Intergenic
1004515430 6:16318647-16318669 CTTCCACCAAGGACTGAGTCAGG - Intronic
1004806811 6:19211486-19211508 CCTCTCCCAAGGCCCCAGCCAGG - Intergenic
1007634610 6:43291177-43291199 CCTCCAAGAAGGCCACTCTCTGG + Intergenic
1010514699 6:76759406-76759428 CCTCCACCCAGGCCCCACTGTGG + Intergenic
1015915965 6:138216791-138216813 CCTCCAACAACGACACATTCAGG - Exonic
1017979280 6:159385395-159385417 CCTCCACAATGGCCACTTTCAGG - Intergenic
1018343995 6:162882164-162882186 TCTCCACCAAGACCAGAGACTGG + Intronic
1018864138 6:167734507-167734529 GCTCCACCCAGACCACAGTGAGG - Intergenic
1019135733 6:169906596-169906618 CCAACACCGAGGCCACAGCCTGG - Intergenic
1019267849 7:128810-128832 CCTCCTCCGAGGCCACCGGCAGG - Intergenic
1020140123 7:5607304-5607326 ACTTTACCAAGGCCACAGTCAGG + Intergenic
1021390736 7:20089582-20089604 TCTCCACCAAGGGCACACTATGG + Intergenic
1023000431 7:35801817-35801839 CCTCCACCACAGCCTCAGCCTGG - Intronic
1023539824 7:41253137-41253159 GCTCCACCAACCCCACAGGCAGG + Intergenic
1023761965 7:43472990-43473012 CCTCCAACACTGCCACAGTGGGG - Intronic
1023828359 7:44024715-44024737 TATCCACCAAGGCCACAGCCAGG + Intergenic
1023859982 7:44212779-44212801 CCACCACAGAGGCCACAGGCAGG + Exonic
1023896466 7:44437564-44437586 CCCCCACACAGGCCAGAGTCAGG - Intronic
1024724718 7:52179630-52179652 CTTCCACGAAGGCCTCTGTCTGG + Intergenic
1028889780 7:95974080-95974102 GGTCCACCAAGGCCACAATGAGG - Intronic
1029284470 7:99456314-99456336 CATCCACCAAGTCCCCAGTCGGG - Intronic
1029299107 7:99564536-99564558 CCTCCATCAAGGACAGAGTAAGG - Intronic
1029732297 7:102446506-102446528 CCTCCACCATGGCCACCTGCGGG - Exonic
1029756659 7:102578162-102578184 TATCCACCAAGGCCACAGCCAGG + Intronic
1031972516 7:128074823-128074845 CCCACACCAAGGCCACACACAGG + Intronic
1033352719 7:140574629-140574651 CCTGCAGCAAGGCCAAAGTGAGG - Intronic
1033367962 7:140685615-140685637 TCCCTACCAAAGCCACAGTCTGG + Intronic
1035024289 7:155815993-155816015 CCTGCAGCCAGGCCACAATCAGG - Intergenic
1035103545 7:156421335-156421357 CCTCCAACAATGCCACACTGGGG - Intergenic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1036473794 8:9074933-9074955 CCCCCACCAGCGCCACAGTGAGG + Intronic
1038437412 8:27545651-27545673 CCTCCTCCAAGCCCATAGGCTGG + Intergenic
1039563030 8:38528363-38528385 CCTCCACCAAGGCTGCTGTGGGG - Exonic
1041984558 8:63906700-63906722 CCGCAGCCAAGGCCACAGTGTGG - Intergenic
1047707888 8:127519963-127519985 CCTCTGCCAATACCACAGTCTGG - Intergenic
1047816118 8:128464863-128464885 CCTTCAAGAAGCCCACAGTCTGG - Intergenic
1048451256 8:134535576-134535598 CCTACACCAAGGCCACACTCTGG + Intronic
1048976074 8:139673871-139673893 GCTCCCCCAAGGCCAGATTCGGG + Intronic
1049546888 8:143236428-143236450 CCCCCACCACTGTCACAGTCAGG + Intergenic
1050681575 9:8117607-8117629 CCTACACCATGGCCACAGCTTGG + Intergenic
1051014756 9:12461369-12461391 ACTCCACCTATGCCACACTCTGG - Intergenic
1056566447 9:87776943-87776965 CCCCTCCCAAGGCCCCAGTCAGG + Intergenic
1061063826 9:128265314-128265336 ACTTGACCAAGGCCACAGCCAGG + Intronic
1061181441 9:129027365-129027387 CCTCCCCCAAGGTCACAGGAGGG + Intronic
1062172700 9:135144319-135144341 CCTCCACCAAATCCACACTCAGG + Intergenic
1203583673 Un_KI270746v1:41693-41715 CCAACCCCCAGGCCACAGTCAGG + Intergenic
1185716640 X:2348037-2348059 CCTCAGCCAAACCCACAGTCAGG + Intronic
1186841134 X:13485705-13485727 TCTCCACCATGGCCACCCTCAGG + Intergenic
1188833723 X:34931895-34931917 CCTCTGCCAAGGCCCCAGCCTGG + Intergenic
1189730284 X:44012914-44012936 CCGCAACCCAGGCCACAGTGAGG - Intergenic
1192361001 X:70439409-70439431 CTTCCACTAACACCACAGTCAGG - Intergenic
1194512620 X:94814459-94814481 CCTCAACCAGGGCCCCAGCCTGG - Intergenic
1194917603 X:99723897-99723919 CCTCTCCCAAGGCCCCAGCCTGG + Intergenic
1195992274 X:110694279-110694301 CCTCCACCAAGCCGACAGGCTGG - Exonic
1199308769 X:146298048-146298070 CCGCAACCAAGTCCACTGTCTGG + Intergenic
1199786692 X:151112420-151112442 CCTCTCCCAAGGCCACAACCTGG - Intergenic
1199813273 X:151371667-151371689 CCACGACCAGGGCCACAGACAGG + Intergenic
1199903991 X:152206326-152206348 CCACCACCAATGCCACTGCCTGG - Intronic
1200143052 X:153911159-153911181 CCACCACCAGGGGCACAGGCTGG + Exonic
1201454185 Y:14150556-14150578 CCTCCCCCAAGGTGAAAGTCTGG - Intergenic
1202029289 Y:20554797-20554819 CCTCCACTAAAACTACAGTCGGG + Intergenic