ID: 902650227

View in Genome Browser
Species Human (GRCh38)
Location 1:17832593-17832615
Sequence GCCCCACCTGGTGTTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902650227_902650232 -9 Left 902650227 1:17832593-17832615 CCTTGCTGAACACCAGGTGGGGC No data
Right 902650232 1:17832607-17832629 AGGTGGGGCTGCTGGGGACATGG No data
902650227_902650233 19 Left 902650227 1:17832593-17832615 CCTTGCTGAACACCAGGTGGGGC No data
Right 902650233 1:17832635-17832657 AGACCTGACTCCCACTCCTTAGG No data
902650227_902650234 20 Left 902650227 1:17832593-17832615 CCTTGCTGAACACCAGGTGGGGC No data
Right 902650234 1:17832636-17832658 GACCTGACTCCCACTCCTTAGGG No data
902650227_902650238 29 Left 902650227 1:17832593-17832615 CCTTGCTGAACACCAGGTGGGGC No data
Right 902650238 1:17832645-17832667 CCCACTCCTTAGGGTTTGATGGG No data
902650227_902650236 28 Left 902650227 1:17832593-17832615 CCTTGCTGAACACCAGGTGGGGC No data
Right 902650236 1:17832644-17832666 TCCCACTCCTTAGGGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902650227 Original CRISPR GCCCCACCTGGTGTTCAGCA AGG (reversed) Intergenic
No off target data available for this crispr