ID: 902651616

View in Genome Browser
Species Human (GRCh38)
Location 1:17841233-17841255
Sequence CCAGAGGAGCTGCAGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902651616_902651625 10 Left 902651616 1:17841233-17841255 CCCCTCACCTGCAGCTCCTCTGG No data
Right 902651625 1:17841266-17841288 GTCCTGGCTCTCCAGCTGCCTGG No data
902651616_902651623 -6 Left 902651616 1:17841233-17841255 CCCCTCACCTGCAGCTCCTCTGG No data
Right 902651623 1:17841250-17841272 CTCTGGCTGGCCATCTGTCCTGG No data
902651616_902651627 18 Left 902651616 1:17841233-17841255 CCCCTCACCTGCAGCTCCTCTGG No data
Right 902651627 1:17841274-17841296 TCTCCAGCTGCCTGGTGCTGAGG 0: 2
1: 0
2: 1
3: 55
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902651616 Original CRISPR CCAGAGGAGCTGCAGGTGAG GGG (reversed) Intergenic
No off target data available for this crispr