ID: 902652071

View in Genome Browser
Species Human (GRCh38)
Location 1:17843637-17843659
Sequence GCCCATGAGCTCCCCTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902652070_902652071 -9 Left 902652070 1:17843623-17843645 CCGCGGTGGTAACTGCCCATGAG No data
Right 902652071 1:17843637-17843659 GCCCATGAGCTCCCCTTTACTGG No data
902652069_902652071 -8 Left 902652069 1:17843622-17843644 CCCGCGGTGGTAACTGCCCATGA No data
Right 902652071 1:17843637-17843659 GCCCATGAGCTCCCCTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902652071 Original CRISPR GCCCATGAGCTCCCCTTTAC TGG Intergenic
No off target data available for this crispr