ID: 902656709

View in Genome Browser
Species Human (GRCh38)
Location 1:17874071-17874093
Sequence AATAATTCTGCTTACCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902656709_902656710 12 Left 902656709 1:17874071-17874093 CCTTAGAGGTAAGCAGAATTATT No data
Right 902656710 1:17874106-17874128 CAGATGAAGAAACTAAGACATGG No data
902656709_902656711 15 Left 902656709 1:17874071-17874093 CCTTAGAGGTAAGCAGAATTATT No data
Right 902656711 1:17874109-17874131 ATGAAGAAACTAAGACATGGAGG No data
902656709_902656712 16 Left 902656709 1:17874071-17874093 CCTTAGAGGTAAGCAGAATTATT No data
Right 902656712 1:17874110-17874132 TGAAGAAACTAAGACATGGAGGG No data
902656709_902656713 23 Left 902656709 1:17874071-17874093 CCTTAGAGGTAAGCAGAATTATT No data
Right 902656713 1:17874117-17874139 ACTAAGACATGGAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902656709 Original CRISPR AATAATTCTGCTTACCTCTA AGG (reversed) Intergenic
No off target data available for this crispr