ID: 902656713

View in Genome Browser
Species Human (GRCh38)
Location 1:17874117-17874139
Sequence ACTAAGACATGGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902656709_902656713 23 Left 902656709 1:17874071-17874093 CCTTAGAGGTAAGCAGAATTATT No data
Right 902656713 1:17874117-17874139 ACTAAGACATGGAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902656713 Original CRISPR ACTAAGACATGGAGGGATGA AGG Intergenic
No off target data available for this crispr