ID: 902656752

View in Genome Browser
Species Human (GRCh38)
Location 1:17874350-17874372
Sequence GTATTCCAACAGAAGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902656746_902656752 6 Left 902656746 1:17874321-17874343 CCAGGGAAGTGAGCTCCCCATCT No data
Right 902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG No data
902656744_902656752 15 Left 902656744 1:17874312-17874334 CCTCCTGGTCCAGGGAAGTGAGC No data
Right 902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG No data
902656749_902656752 -9 Left 902656749 1:17874336-17874358 CCCCATCTTTGGAGGTATTCCAA No data
Right 902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG No data
902656745_902656752 12 Left 902656745 1:17874315-17874337 CCTGGTCCAGGGAAGTGAGCTCC No data
Right 902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG No data
902656750_902656752 -10 Left 902656750 1:17874337-17874359 CCCATCTTTGGAGGTATTCCAAC No data
Right 902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902656752 Original CRISPR GTATTCCAACAGAAGCCAGA TGG Intergenic
No off target data available for this crispr